Next Article in Journal
Interleukin-6: Cardiovascular Aspects of Long-Term Cytokine Suppression in Patients with Rheumatoid Arthritis
Next Article in Special Issue
Enhancing Crop Resilience: The Role of Plant Genetics, Transcription Factors, and Next-Generation Sequencing in Addressing Salt Stress
Previous Article in Journal
Mechanistic Insights into the Stimulatory Effect of Melanogenesis of 4-Methylcoumarin Derivatives in B16F10 Melanoma Cells
Previous Article in Special Issue
Comparative Analyses of the Complete Mitogenomes of Two Oxyria Species (Polygonaceae) Provide Insights into Understanding the Mitogenome Evolution Within the Family
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of GATA Family Genes in Potato and Characterization of StGATA12 in Response to Salinity and Osmotic Stress

1
Key Laboratory of Tropical Fruit Biology, Ministry of Agriculture and Rural Affairs, South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang 524091, China
2
Key Laboratory of Hainan Province for Postharvest Physiology and Technology of Tropical Horticultural Products, South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang 524091, China
3
National Key Laboratory for Tropical Crop Breeding, Sanya Research Institute, Chinese Academy of Tropical Agricultural Sciences, Sanya 572025, China
4
State Key Laboratory of Aridland Crop Science, Gansu Agricultural University, Lanzhou 730070, China
5
College of Life Science and Technology, Gansu Agricultural University, Lanzhou 730070, China
6
College of Agronomy, Gansu Agricultural University, Lanzhou 730070, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(22), 12423; https://doi.org/10.3390/ijms252212423
Submission received: 11 October 2024 / Revised: 8 November 2024 / Accepted: 14 November 2024 / Published: 19 November 2024
(This article belongs to the Special Issue Advances in Plant Genomics and Genetics: 2nd Edition)

Abstract

GATA factors are evolutionarily conserved transcription regulators that are implicated in the regulation of physiological changes under abiotic stress. Unfortunately, there are few studies investigating the potential role of GATA genes in potato plants responding to salt and osmotic stresses. The physicochemical properties, chromosomal distribution, gene duplication, evolutionary relationships and classification, conserved motifs, gene structure, interspecific collinearity relationship, and cis-regulatory elements were analyzed. Potato plants were treated with NaCl and PEG to induce salinity and osmotic stress responses. qRT-PCR was carried out to characterize the expression pattern of StGATA family genes in potato plants subjected to salinity and osmotic stress. StGATA12 loss-of-function and gain-of-function plants were established. Morphological phenotypes and growth were indicated. Photosynthetic gas exchange was suggested by the net photosynthetic rate, transpiration rate, and stomatal conductance. Physiological indicators and the corresponding genes were indicated by enzyme activity and mRNA expression of genes encoding CAT, SOD, POD, and P5CS, and contents of H2O2, MDA, and proline. The expression patterns of StGATA family genes were altered in response to salinity and osmotic stress. StGATA12 protein is located in the nucleus. StGATA12 is involved in the regulation of potato plant growth in response to salinity and osmotic stress. Overexpression of StGATA12 promoted photosynthesis, transpiration, and stomatal conductance under salinity and osmotic stress. StGATA12 overexpression induced biochemical responses of potato plants to salinity and osmotic stress by regulating the levels of H2O2, MDA, and proline and the activity of CAT, SOD, and POD. StGATA12 overexpression induced the up-regulation of StCAT, StSOD, StPOD, and StP5CS against salinity and osmotic stress. StGATA12 could reinforce the ability of potato plants to resist salinity and osmosis-induced damages, which may provide an effective strategy to engineer potato plants for better adaptability to adverse salinity and osmotic conditions.

1. Introduction

Soil salinization is defined as the upward movement of salinity from the lower soil layers or groundwater to the surface via capillary action [1]. This phenomenon, resulting from a combination of human and natural factors, threatens nearly 20% of the world’s irrigated agriculture [2]. Salinity persists in various cultivated areas due to insufficient efforts to address the issue. Additionally, arid regions cover 41% of the world’s land area and are inhabited by 38% of the global population [3]. Soil salinization is particularly severe in drylands, where 30% of the water used for agricultural irrigation is saline, leading to reduced crop yields, land degradation, and loss of biodiversity [4]. According to global saline soil distribution data released by the Food and Agriculture Organization (FAO) in October 2021, over 833 million hm2 of the world’s soils have been affected by salinization, with more than 10% of agricultural land classified as saline. These figures are on the rise, and soil salinization has become a major threat to crop production and productivity.
Potato (Solanum tuberosum L.) is regarded by the FAO as a key crop for ensuring food security, which is severely affected by salinity [2]. Growth of potato plants is inhibited under salt stress due to ion toxicity caused by osmotic stress [5]. Salt-induced osmotic stress often elicits complex and multifaceted physiological responses [6]. NaCl, as a major abiotic stressor, inhibits plant growth by altering transpiration rate, stomatal conductance, net photosynthetic rate, and other thermal parameters [7]. Salt stress results in stomatal closure, which reduces the ratio of CO2 to O2 in leaves and inhibits CO2 fixation [8]. Under osmotic stress, the production of reactive oxygen species such as superoxide radicals, hydrogen peroxide, and hydroxyl radicals increases due to enhanced electron leakage to oxygen [9]. These reactive oxygen species can damage membranes and other essential macromolecules, including photosynthetic pigments [10]. In response to salinity stress, various physiological components, such as antioxidant enzymes, are produced to mitigate this damage [11,12].
To prevent further salinization, a drainage system is established to enhance soil permeability and functionality by leaching out salts, thereby promoting better root development [13]. Additionally, another approach to mitigate the negative effects of soil salinization on agriculture is to identify crops and crop varieties that are salt tolerant. Conventional breeding is a well-established method for genetically improving crops by combining desirable traits from different varieties or species. However, developing salt-tolerant varieties through conventional breeding is challenging due to the difficulty in identifying clearly defined physiological traits associated with salt tolerance and the involvement of multiple genes. The integration of molecular tools into breeding programs is accelerating the development of salt-tolerant crop varieties with high yields and desirable agronomic traits. Genetic engineering has been successfully employed to produce salt-tolerant plants, either by overexpressing or introducing selected genes into elite cultivars. Numerous transgenic studies have focused on improving salt tolerance in potato using genes from various sources [14,15,16].
GATA factors are evolutionarily conserved transcription regulators that are found in animals, fungi, and plants, which recognize the DNA sequence W-G-A-T-A-R through a single type IV zinc finger. Genome-wide identification and characterization of GATA family genes have been reported in Arabidopsis [17], Rubiaceae [18], tomato, potato [19], rapeseed [20], and cucumber [21]. In recent years, knowledge about the biological role and regulation of plant GATAs has substantially improved. Individual family members have been implicated in the regulation of chlorophyll biosynthesis, glucose sensitivity [17], flower development [22], chloroplast division [23], photosynthesis [24], light and circadian response [25], et al. GATA factors also respond to diverse abiotic stresses in plants, which have been investigated under salinity, drought, exogenous ABA, high temperature, and low nitrogen conditions [21,26,27]. Unfortunately, there are few studies investigating the potential role of GATAs in potato plants responding to salinity and osmotic stresses.
In this study, we aimed to investigate the expression patterns of StGATA genes in response to salt and osmotic stress. We then selected the responsive genes for further validation of their roles following NaCl and PEG6000 treatment. Our findings may provide insights into the molecular mechanisms underlying plant tolerance to salt and osmotically induced oxidative stress.

2. Results

In this study, we identified 57 StGATA genes in potato plants and classified them into four subfamily groups. The StGATA genes exhibited organ-specific expression patterns and showed altered expression in response to salinity and osmotic stresses. Notably, StGATA12 was found to modulate photosynthesis, transpiration, and stomatal conductance under these stress conditions. Furthermore, overexpression of StGATA12 enhanced the biochemical responses of potato plants to salinity and osmotic stress by regulating levels of H2O2, MDA, and proline, as well as the activities of CAT, SOD, and POD. It also induced genetic responses, including the expression of StCAT, StSOD, StPOD, and StP5CS, thereby enhancing the plant’s resilience to salinity and osmotic stress. The study design is presented in Figure 1.

2.1. Identification of GATA Gene Family in Potato

Through searching against Arabidopsis thaliana, we identified 57 GATA family members in potato. The protein features and subcellular location of GATA proteins in potato are depicted in Supplementary Table S1. We found the distribution of 57 StGATAs on chromosomes 1–10. The fifty-seven StGATA protein members exhibit different protein properties. The protein length of StGATA members ranges between 81 and 543 aa, and protein weights differ between 8782.43 and 60,626.92 Da. The isoelectric points range from 3.38 to 10.34. The GRAVY values of StGATA proteins are negative, ranging from −1.056 to −0.221. All GATA gene-coding proteins were located in the nucleus. Particularly, StGATA54 was located in the cell membrane, chloroplasts, and nucleus.

2.2. Chromosome Localization and Gene Duplication

Chromosomal localizations of StGATA genes were shown in Supplementary Figure S1A. StGATA genes numbered 1–13 were distributed in chr01, 14–18 in chr02, 19–20 in chr03, 21–27 in chr04, 28–33 in chr05, 34–38 in chr06, 39 in chr07, 40–45 in chr08, 46–48 in chr09, 49 in chr10, 50–51 in chr11, and 52–57 in chr12. Supplementary Figure S1B indicated 14 segmental duplications of StGATA genes. The pairs of segmental duplications were predicated including StGATA12/17, StGATA12/14, StGATA5/25, StGATA3/46, StGATA14/17, StGATA15/18, StGATA17/19, StGATA14/19, StGATA20/43, StGATA31/55, StGATA34/40, StGATA34/44, StGATA38/50, StGATA39/52, and StGATA40/44. To evaluate the positive selection and to speculate the possible date of duplicate events, the ratio Ka/Ks of the segmental duplications was calculated. These pair genes of segmental duplications may differentiate from the same ancestor gene during the evolutionary process to respond to natural selection, which may have occurred 14.95–66.48 million years ago (Supplementary Table S2).

2.3. Phylogenetic Analysis, Conserved Motifs, and Exon–Intron Organization of StGATA Family Members

To evaluate the evolutionary relationship of StGATAs, a polygenetic analysis was conducted using the amino acid sequences of 57 GATA genes from potato plants. As shown in Supplementary Figure S2, StGATAs were clustered into four distinct groups: I, II, III, and IV. There were 20 StGATAs in subfamily I, 15 in subfamily II, 12 in subfamily III, and 10 in subfamily IV. Subfamily I comprised six groups, with two StGATAs in 1A, two in 1B, four in 1C, six in 1D, three in 1E, and three in 1F. Using the bioinformatics tool “MEME motif”, conserved motif domains among 57 StGATA genes were identified. This analysis was integrated with phylogenetic studies, revealing that the number of conserved motifs in each gene ranged from 1 to 14. The amino acid sequences of the conserved motifs are presented in Supplementary Table S3. Notably, the highest number of conserved domains was found in the gene StGATA44, which contained 14 motifs. The gene structure of StGATAs is closely related to the functional diversity and expression patterns observed among various members in potato plants. All StGATAs contain introns and exhibit a range of exon numbers from 1 to 11, as revealed by gene structure analysis. Notably, some StGATAs share the same number of exons and exhibit similar exon–intron patterns. Examples include StGATA15/18, StGATA24/25, StGATA21/33, StGATA28/47, and StGATA36/37. This structural similarity suggests potential functional redundancy among these genes. In contrast, the remaining StGATA genes display differences in the number of exons and distinct exon–intron patterns. We then analyzed the cis-regulatory elements in the promoter regions of StGATA genes. The detailed functions of the cis-regulatory elements are shown in Supplementary Figure S3. Of note, these findings recommend that StGATAs are not only involved in hormonal signal transduction but also play a vital role under biotic and abiotic stress conditions and stimulate the growth, development, biochemical processes, physiological processes, and metabolism regulation in potato plants.

2.4. Syntenic Analysis of GATA Genes in 4 Plant Species

To analyze the similarity of gene arrangement in different genomes, synteny analysis was carried out between Solanum tuberosum (St), Arabidopsis thaliana (At), Oryza sativa (Os), and Solanum lycopersicum (Sl). Gene synteny also indicates the evolutionary relationship of genes in different species. In general, 26 potato GATA genes showed a closer syntenic relationship with those in Solanum lycopersicum, followed by Arabidopsis thaliana (21) and then Oryza sativa (5) (Supplementary Figure S4).

2.5. Organ-Specific Expression of StGATA Genes and Expression Signatures of StGATAs in Potato Plants Under Biotic and Abiotic Stresses

Next, we detected the mRNA expression of StGATA genes in the potato (Solanum tuberosum L.) cultivar “Atlantic”. Figure 2A displays the expression of StGATA genes in six potato organs. mRNA expression of StGATA genes varied significantly in root, tuber, leaf, petiole, stem, and flower. Potato organs exhibited significant changes in mRNA expression of StGATA genes after treatment by NaCl (75 mM and 150 mM) (Figure 2B,C) and PEG6000 (10% and 20%) (Figure 2D,E). Notably, it was observed that StGATA12 expression was significantly increased after treatment with NaCl (75 mM and 150 mM) and PEG6000 (10% and 20%). Consequently, StGATA12 may be involved in the regulation of salt and osmotic stress in potato plant.

2.6. Phenotypic and Physiological Alterations Induced by StGATA12 Under NaCl and PEG Treatments

To confirm that StGATA12 regulates the response of potato plant to salt stress and osmotic stress, StGATA12-overexpressing plants and RNA interference plants were generated and selected. The GFP-positive tobacco epidermal cells were observed under a laser scanning confocal microscope 48 h after p35S–StGATA12-GFP transfection. Figure 3A showed that chloroplasts emit red autofluorescence when excited. GFP is observable in the cytoblast, cytomembrane, and cytoplasm of plant cells. GFP-StGATA12 fusion proteins are observed in the nucleus. The relative expression level of StGATA12 in sense lines (OE-1, OE-2, OE-3, OE-4, OE-5, OE-6, OE-7, and OE-8) was significantly increased with respect to non-transgenic plants (p < 0.05) (Figure 3B). In RNA interference plants (Ri-1, Ri-2, Ri-3, Ri-4, Ri-5, Ri-6, Ri-7, and Ri-8), expression of the endogenous StGATA12 was down-regulated compared to NT plants (p < 0.05) (Figure 3C).
Under normal growth conditions, StGATA12-overexpressing and RNA interference plants showed no abnormal morphological phenotype compared with NT plants (Figure 4A). Salt stress and osmotic stress assays were carried out with these plants. Salinity and osmotic stress significantly decreased plant height, fresh plant weight, dry plant weight, fresh root weight, and dry root weight (Figure 4B–F). After NaCl treatment (75 mM and 150 mM), StGATA12-overexpressing plants were detected with increased plant height, fresh plant weight, dry plant weight, fresh root weight, and dry root weight compared to NT plants, while RNA interference plants showed the reverse trend. In response to 10% PEG treatment, StGATA12-overexpressing plants showed signs of increased growth, while RNA interference plants exhibited reduced growth compared to NT plants. However, there was no distinction in plant growth between the transgenic plants and non-transgenic plants after 20% PEG treatment. This may be due to the high concentration of PEG severely inhibiting the growth of potato tissue culture plantlets, resulting in no significant difference in growth between transgenic and non-transgenic plants.
Subsequently, we examined the effects of StGATA12 on the accumulation of osmotic regulatory substances and the metabolism of reactive oxygen species under salt and osmotic stress conditions. The diverse physiological parameters, including levels of H2O2, MDA, proline, CAT, SOD, and POD, were assays for evaluating damages. Under normal conditions, StGATA12-overexpressing plants and RNA interference plants exhibited no significant changes in contents of H2O2 (Figure 5A,B), MDA (Figure 5C,D), and proline (Figure 5E,F), and showed no abnormal activities of CAT (Figure 5G,H), SOD (Figure 5I,J), and POD (Figure 5K,L). After 4 weeks of NaCl or PEG treatment, StGATA12-overexpressing plants had lower contents of H2O2 and MDA and higher proline levels, and elevated activities of CAT, SOD, and POD, compared with NT lines (p < 0.05). In contrast, RNA interference plants demonstrated higher contents of H2O2 and MDA, while decreased proline levels and activities of CAT, SOD, and POD were observed when compared with NT lines (p < 0.05).

2.7. Photosynthesis and Transpiration Affected by StGATA12 Under NaCl and PEG Treatments

On account of salinity and osmotic stress, the net photosynthetic rate (Figure 6A,B), transpiration rate (Figure 6C,D), and stomatal conductance (Figure 6E,F) were significantly decreased. The effect was more pronounced in StGATA12-overexpressing plants and RNA interference plants compared to the NT plants after NaCl or PEG treatment (p < 0.05). However, StGATA12 overexpression improved net photosynthetic rate, transpiration rate, and stomatal conductance in response to salinity and osmotic stress. Under salinity and osmotic stress, the improvement of the photosynthetic capacity might be due to the closure of the stomata, which decreases the availability of internal CO2. StGATA12 might be involved in this process in potato plant.
Chlorophyll is an important pigment involved in photosynthesis within plant cells, playing a crucial role in the process. This study further analyzed the changes in chlorophyll content in transgenic and non-transgenic potato plants under salt and osmotic stress conditions. At the beginning of the assays, NT, StGATA12-overexpressing, and RNA interference plants exhibited normal levels of chlorophyll content (Figure 7A,B). However, salt treatment and osmotic stress caused a constant and marked decrease in chlorophyll content for NT, StGATA12-overexpressing, and RNA interference plants. StGATA12-overexpressing plants have a higher content of chlorophyll than NT plants in response to salt stress or osmotic stress (p < 0.05). RNA interference plants lost more chlorophyll than NT plants (p < 0.05). Damage was evaluated by measuring ion leakage. In NT plants, ion leakage significantly increased after NaCl and PEG treatment (Figure 7C,D). In RNA interference plants, this parameter was obviously increased with respect to NT plants. StGATA12-overexpressing plants demonstrated decreased ion leakage relative to NT plants.

2.8. Effects of StGATA12 on Gene Expression in Response to Saline and Osmotic Stress

In order to avoid the production of reactive molecules, plants have evolved an effective scavenging system involving antioxidant enzymes. Superoxide dismutase (SOD, EC 1.115.1.1), catalase (CAT, EC 1.11.1.6), and peroxidase (POD, EC 1.11.1.7). SOD reacts with the superoxide radical to produce H2O2. Hydrogen peroxide is scavenged by CAT and POD. Saline and osmotic stress-induced significant increases in mRNA expression of StSOD (Figure 8A), StCAT (Figure 8B), and StPOD (Figure 8C) in the NT, StGATA12-overexpressing, and RNA interference plants. Our results have shown that under normal conditions, StGATA12 overexpression enhanced the mRNA levels of StSOD, StCAT, and StPOD. Compared to the NT plants, there was a significant increase in mRNA levels of StSOD, StCAT, and StPOD in StGATA12-overexpressing plants, while these genes were down-regulated in RNA interference plants.
To counter the effects of saline and osmotic stress, plants have developed a number of mechanisms such as accumulation of compatible solutes, and proline is the most widely distributed amino acid as an osmotically active compound. Delta 1-pyrroline-5-carboxylate synthetase (P5CS, γ-glutamyl kinase, EC 2.7.2.11 and glutamate-5-semialdehyde dehydrogenase, EC 1.2.1.41) is a key regulatory enzyme involved in the biosynthesis of proline [28]. Treatment with NaCl or PEG resulted in a significant expression of the StP5CS gene in the NT plants (Figure 8D). After salinity and osmotic stress induction, StP5CS expression was significantly enhanced in StGATA12-overexpressing plants compared to the NT plants, while decreased in RNA interference plants. Interestingly, StGATA12 overexpression per se induced the expression of StP5CS.

3. Discussion

The GATA transcription factor family plays diverse roles in plant growth, development, and responses to abiotic stresses. In this study, we identified 57 StGATAs in potato plants and classified them into four subfamily groups. The StGATAs exhibited organ-specific expression patterns and showed altered expression in response to salinity and osmotic stresses. Notably, StGATA12 was found to modulate photosynthesis, transpiration, and stomatal conductance under these stress conditions. Furthermore, overexpression of StGATA12 enhanced the biochemical responses of potato plants to salinity and osmotic stress by regulating the levels of H2O2, MDA, and proline, as well as the activities of CAT, SOD, and POD. It also induced genetic responses, including the expression of StCAT, StSOD, StPOD, and StP5CS, thereby enhancing the plant’s resilience to salinity and osmotic stress.
Previous studies have systematically identified multiple members of the GATA family genes in potato plants [29,30,31]. In this study, a total of 57 GATA genes were confirmed in potato plant. Based on the phylogenetic relationships, we defined four different subfamilies of GATA genes in potato plant, which is consistent with the classification reported by previous studies [29,30,31]. Further support for this classification comes from a comparison of motif constitutes and exon–intron structures, which are conserved among the members of each subfamily. The analysis of conserved motifs revealed that StGATA12, StGATA13, and StGATA19 shared identical motifs, which were motifs 1, 2, 16, 23, and 26. This suggested a similarity in their molecular features and functions. The gene structure analysis indicated significant variation in the number of introns and exons among the StGATA genes.
To facilitate inferences of functional relationships, including potential redundancy between genes, we integrated expression pattern data for all 57 genes across six different samples. Strikingly, few GATA genes are expressed in specific organs neither under normal conditions nor under salt stress. Rather, StGATA2 and StGATA19 are highly expressed in flowers compared to other organs, revealing that the genes may be involved in flower development. A number of genes show increased expression after NaCl or PEG treatment, with the greatest differences observed for StGATA12. In plants, GATAs are known to be involved in the regulation of salt stress in Rice [26], common bean [32], grapevine [27], et al. For Solanaceae plants, GATA genes have been reported to respond to salt stress in wolfberry [33] and tomato [34]. In this study, we revealed the presence of 57 genes encoding the corresponding putative GATA transcription factors in the potato genome, which are differentially expressed in response to salinity stress.
Numerous studies have reported that GATAs regulate plant growth and development previously [24,35]. In poplar, PdGATA19-overexpressing transformants exhibited 25–30% faster growth, while CRISPR/Cas9-medicated mutant showed severely retarded growth compared with the wild type [24]. GmGATA58 also alters the plant growth and inflorescence axis of Arabidopsis [35]. In this study, we found that the StGATA12 gene also controls plant growth under normal conditions. Besides, in response to salinity stress, StGATA12-overexpressing plants show faster growth than the NT plants. However, the antisense lines exhibited the reverse effects on plant growth. Ion leakage was used to evaluate membrane permeability in the leaves. Salinity stress has been reported to disturb the integrity of cell membranes, resulting in increased membrane permeability [36]. StGATA12 overexpression decreased ion leakage in response to salinity or osmotic stress. This result indicates that StGATA12 may be helpful in osmotic adjustment or alleviating membrane permeability induced by salinity stress.
This study confirmed that StGATA12 regulates net photosynthetic rate, transpiration rate, and stomatal conductance under salinity and osmotic stress. Many recent studies reinforce the perception that NaCl causes growth inhibition by changes in net photosynthetic rate, transpiration rate, and stomatal conductance [37,38,39]. Many studies have concluded that the reduction in photosynthesis in response to salinity is, to some extent, the result of reduced stomatal conductance [40,41]. Reduction in transpiration rate under salinity is further evidence of interference of salinity to stomatal conductance. Photosynthesis, a major contributor to crop yield, predominantly takes place in leaves where chlorophyll, one of the most abundant biological molecules in high plants, plays unique and essential roles in photosynthetic light harvesting and energy transduction. Reduction in photosynthesis activity under salt stress is due to the reduction in chlorophyll to a certain extent. Recently, GATA genes have been demonstrated to contribute to the regulatory mechanism of chlorophyll biosynthesis [35]. It is interesting that StGATA12 overexpression did not lead to an increase in chlorophyll content under normal conditions, while in response to salinity stress, chlorophyll was increased in StGATA12-overexpressing plants. The reasonable explanation may be that StGATA12 does not directly trigger the biosynthesis of chlorophyll but indirectly affects salinity or osmotic stress.
There is strong evidence that salinity-induced osmotic stress, ionic stress, and nutrient imbalance, as well as their secondary effects, altogether lead to the overexpression of reactive oxygen species [42]. SOD is the primary scavenger, which converts O2 to H2O2. This toxic product of the SOD reaction is eliminated by catalase. Peroxidases are often the first enzymes that alter their activities under stress. Yu et al. reported that grape GATA2 is involved in plant disease resistance by the H2O2 pathway and benefits transgenic Arabidopsis plants by preventing oxidative damage [43]. Here, the transgenic lines with significantly increased StGATA12 gene expression exhibited reduced oxidative products, along with increased antioxidative components and higher contents of antioxidant enzymes, compared to the non-transgenic plants. Recent studies carried out in other plants have revealed the involvement of GATA transcription factors in the regulation of chlorophyll biosynthetic pathway genes under normal conditions [35]. Here, we found that StGATA12 mediates the gene expression of the major components of the antioxidant defense system (StSOD, StCAT, StPOD, and StP5CS). This finding provided a base for further understanding the molecular evolution and functional characterization of the StGATA12 gene in response to salinity and osmotic stress.
Conclusively, the StGATA12 gene is highly expressed in potato leaves subjected to salinity and osmotic stress in a concentration-dependent manner. Plants overexpressing GATA12 demonstrate normal growth, maintained photosynthetic capacity, and enhanced antioxidative ability when exposed to NaCl and PEG6000. Based on these findings, StGATA12 can be identified as a candidate gene for salt tolerance, which could facilitate the development and utilization of saline land affected by seawater intrusion. However, future studies should focus more on assessing tuber yield and quality.

4. Materials and Methods

4.1. Identification of GATA Gene Family

Chromosome location, whole genome CDS, protein sequence, and genome length were downloaded from the Spud DB (http://spuddb.uga.edu/, accessed on 28 August 2022). Arabidopsis thaliana GATA protein sequence (TAIR10) was downloaded from the TAIR database (https://www.arabidopsis.org/Blast/index.jsp, accessed on 3 April 2022), and protein sequences with an e-value ≤ 1 × 10−5 were blasted. The hidden Markov model (HMM) of the GATA protein domain (PF00320) was obtained from the Pfam website [44]. The Hmmsearch procedure in HMMER Package Version 3.0 was used to search StGATA members from potato annotated protein sequences (DM v4.03/v4.04) with the default parameters [45]. GATA without conserved domains was removed after analysis of the assumed StGATA in the PfamScan database (https://www.ebi.ac.uk/Tools/pfa/pfamscan/, accessed on 3 April 2022) [46]. The repeated sequence was removed after the alignment using the MUSCLE algorithm in MEGA Version 11.0 (https://www.megasoftware.net/, accessed on 3 April 2022) [47,48].

4.2. Bioinformatic Prediction of Biochemical Properties and Subcellular Location

Amino acid composition, molecular weight (MV), isoelectric point (pI), and grand average of hydropathicity (GRAVY) of StGATA proteins were analyzed using ExPASy ProtParam (https://web.expasy.org/protparam/, accessed on 15 May 2022) [49]. Subcellular location was predicted using Plant-mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/, accessed on 3 April 2023) [50] and ProComp 9.0 (http://www.softberry.com/berry.phtml?topic=protcomppl&group=programs&subgroup=proloc, accessed on 29 June 2022) [51].

4.3. Analysis of Chromosome Localization and Gene Duplication

All StGATA genes were localized onto potato chromosomes using Circos Version 0.69-9 (https://circos.ca/software/download/, accessed on 16 July 2022) based on physical location information obtained from the potato genome database Spud DB (http://spuddb.uga.edu/, accessed on 9 December 2022) [52]. The gene replication events of StGATA genes were analyzed using MCScanX (https://github.com/wyp1125/MCScanx, accessed on 3 April 2023) with the default parameters [53]. The synonymous substitution rate (Ks) and non-synonymous substitution rate (Ka) were calculated using TBtools (https://github.com/CJ-Chen/TBtools/releases, accessed on 23 April 2022). The evolutionary divergence times of StGATA genes were analyzed according to the method reported by Shen and Yuan [54].

4.4. Conserved Motif and Exon–Intron Structure

The conserved motifs of StGATA proteins were analyzed using MEME Software Version 5.3.0 (http://meme-suite.org/meme-software/5.3.0/meme-5.3.0.tar.gz, accessed on 8 October 2022) [55]. The parameters were set as follows: the number of motifs searched was 20, and the motif length range was 6–200 residues. All motifs were further annotated with InterProScan (http://www.ebi.ac.uk/interpro/, accessed on 23 April 2023) [56,57]. The CDS sequences and genomic sequences of 57 StGATA genes were downloaded from the Spud DB potato genome database. The CDS of the StGATAs were compared with their corresponding genomic DNA sequences using GSDS Version 2.0 (http://gsds.gao-lab.org/, accessed on 30 October 2023) to characterize the exon and intron distribution of StGATAs [58].

4.5. Phylogenetic Analysis and Classification of GATA Gene Family

The potato genome sequencing data were retrieved from the Spud DB database (DM v4.03/v4.04) [45,59], Arabidopsis thaliana genome sequences from The Arabidopsis Information Resource (TAIR10) (https://www.arabidopsis.org/, accessed on 21 January 2022), Oryza sativa v7.0 reference genome from the Rice Genome Annotation Project (http://rice.uga.edu/, accessed on 22 March 2022), and Solanum lycopersicum L. genome (ITAG Release 4.0) from the International Tomato Genome Sequencing Project (https://solgenomics.net/organism/Solanum_lycopersicum/genome/, accessed on 26 April 2022). Multiple alignment of protein sequences was performed using the MUSCLE algorithm [47]. Phylogenetic analysis was conducted using MEGA X software version 11.0 [48]. The p-distance was utilized to establish the neighbor-joining (NJ) tree with a 1000 replicate bootstrap.

4.6. Synteny and Collinearity Analysis

Makeblastdb was used to create a BLAST protein database [60]. BLASTP was used for the comparative analysis of GATA protein sequences [61]. Gene synteny and collinearity were analyzed using the MCScan X algorithm (https://github.com/wyp1125/MCScanx, accessed on 3 April 2023) [53].

4.7. Promoter Sequence Analysis

Custom perl scripts were used to retrieve the DNA sequence from +2000 bp upstream of the transcription start codon (ATG) in the 5′-UTR. Promoter sequences were identified through the PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 13 May 2022) [62].

4.8. Plant Material and Treatment

Four-week-old, virus-free tissue culture seedlings of the Atlantic potato variety that were in similar growth conditions were selected. After removing the top and bottom parts, the middle section containing two axillary buds was cut into 2 cm long segments. The segments were inoculated into 150 mL Erlenmeyer flasks containing 30 mL of MS liquid medium (without agar, containing 30 g/L sucrose, pH 5.8 ± 0.1). Each flask contained 3 stem segments and was cultured under conditions of 21 °C temperature and 2800 lx light intensity with a 16 h/day photoperiod for 4 weeks.
To induce tuber production, 4-week-old seedlings were cultured in an MS medium containing 8% sucrose. The sprouted tubers were grown in pots (20 cm diameter × 40 cm height) containing a 1:1 (v/v) mixture of nutrient soil and perlite, with soil moisture maintained at 70–75%. The sprouted tubers were cultivated until the flowering stage to collect flowers, leaves, stems, petioles, and roots, and were then grown to maturity for tuber collection. Samples were frozen in liquid nitrogen and stored at −80 °C for quantitative reverse transcription PCR (RT-qPCR) analysis of StGATAs. To assay the expression patterns of StGATAs in response to salinity and osmotic stress, the well-growing 4-week-old seedlings were selected and inoculated into 30 mL of liquid medium containing 0%, 10%, and 20% PEG6000 (W/V), as well as 0, 75, and 150 mM NaCl. After culturing for 0, 1, 3, 6, 12, and 24 h, the leaves were collected for the examination of StGATAs mRNA expression. After 24 h of treatment, the leaves were collected for evaluation of physiological parameters, photosynthetic gas exchange parameters, enzyme activities, chlorophyll contents, and gene expression. The leaves collected were the fully expanded third leaf from the top of the plant, gathered between 9:30 and 11:30 AM. To evaluate phenotypes and plant growth, 4-week-old seedlings were cultured for 6 days, followed by transferred into a medium containing PEG or NaCl. After 4 weeks, we analyzed plant phenotypes and measured plant height, fresh plant weight, dry plant weight, fresh root weight, and dry root weight.

4.9. Plasmid Construction and Transfection

To create StGATA12-overexpressing plants (referred to as OE), the gene encoding the StGATA12 protein was cloned using the following primers: forward 5′-CTCGAGATGTCTATGAAAAATACCCAAC-3′ and reverse 5′-GTCGACACAAGTTGAAATCATAGAAGCTAA-3′ into the pBI121-EGFP plasmid according to a previously reported approach [63]. An RNA hairpin was created by cloning the StGATA12 cDNA fragment (designated as Ri) using the following primers: forward 5′-TGTCTATGAAAAATACCCAACA-3′ and reverse 5′-ATCCACAAATTGGGATAACCATT-3′ into the gene-silencing vector pHannibal [64]. Agrobacterium containing the plasmids was cultured for approximately 48 h in LB medium supplemented with 50 mg/L gentamicin and 50 mg/L spectinomycin at 28 °C. The culture was then harvested by centrifugation (5000 rpm for 10 min) and re-suspended in MS medium to an optical density of 0.3 (OD600). The sterile seedling stems (2 cm) were incubated in the Agrobacterium suspension for 10 min, then transferred to MS medium (pH 5.8) containing 7.4 g/L agar, 30 g/L sucrose, 0.5 mg/L 6-BA, 2.0 mg/L ZT, 0.2 mg/L GA3, and 1.0 mg/L IAA. The samples were maintained in the dark for 48 to 72 h. Next, the plants were transferred to differentiation media consisting of MS, 7.4 g/L agar, 30 g/L sucrose, 300 mg/L Timentin, 100 mg/L kanamycin, 0.5 mg/L 6-BA, 2.0 mg/L ZT, 0.2 mg/L GA3, and 1.0 mg/L IAA (pH 5.8). The media were changed every 2 weeks. After the induction of adventitious buds, the resistant buds were transferred to a rooting medium composed of MS, 7.4 g/L agar, 30 g/L sucrose, 300 mg/L Timentin, and 100 mg/L kanamycin (pH 5.8) until adventitious roots were induced.

4.10. Subcellular Location

The constructs were cloned with the following primers: forward 5′-CTCGAGATGGATTACTCCGGCAACTGTCAAAGT-3′ and reverse 5′-GTCGACAAAACTCTGAACCGGCGGACCCGGTTCAGT-3′. They were then fused into pCAM35s-GFP, which was then transformed into Agrobacterium tumefaciens GV3101. The transformed strain was utilized to infiltrate tobacco epidermal cells according to the method reported by Sparkes et al. [65]. Infected areas were marked, and green fluorescence was detected using a Leica TCA confocal scanning laser microscope (Leica, Wetzlar, Germany) 48 h after infiltration. Green fluorescence was detected after emission/excitation at 510/488 nm, and chloroplast fluorescence was examined after emission/excitation at 675/640 nm.

4.11. Physiological Evaluation

4.11.1. Ion Leakage

The fully expanded top-third functional leaves were collected from transgenic and non-transgenic potato plants at the same position. The leaves were washed twice with distilled water to remove any adhering electrolytes from the surface or cut ends of the tissues. Surface water was absorbed using filter paper. Leaf discs were punched from the potato leaves using a 10 mm punch, ensuring to avoid the central veins. These discs were placed in a 0.1 mol/L mannitol aqueous solution and shaken at 100 rpm for 2 h. Relative electrolyte leakage was measured using a conductometer (DDS-11A, Shanghai Scientific Instruments, Shanghai, China). The initial conductivity of the solution was recorded as L1. The solution was then boiled for 10 min, cooled to 20 °C, and the final conductivity was measured as L2. Ion leakage was expressed as the ratio of L1 to L2.

4.11.2. H2O2 Content

H2O2 content was determined using a previously described method with minor modifications [66]. Briefly, 0.5 g of leaves was extracted with 5 mL of TCA (0.1%, w/v), and the extract was centrifuged at 12,000 rpm for 15 min. The supernatant (0.5 mL) was then collected and diluted with 1 mol/L KI and 0.5 mL of potassium phosphate buffer (10 mM, pH 7.0). The absorbance was measured spectrophotometrically at 390 nm.

4.11.3. MDA Content

The MDA content was measured using a modified version of Heath’s method [67]. Briefly, 0.2 g of fresh leaves was extracted with 5 mL of TCA (10%). The extract was then centrifuged at 4000× g for 10 min, and the supernatant was collected. A 2 mL aliquot of the supernatant was mixed with 2 mL of 0.6% TBA prepared in 10% TCA and incubated at 100 °C for 15 min. After centrifugation at 3500 rpm for 10 min, the absorbance was measured at 532 nm, 600 nm, and 450 nm.

4.11.4. Proline Content

Proline content was measured using a modified version of Bates’ method [68]. Briefly, 0.2 g of potato leaves was homogenized in 5 mL of 3% sulfosalicylic acid and the mixture was heated in a boiling water bath for 10 min. After cooling, 2 mL of the supernatant was combined with 3 mL of 2.5% ninhydrin and 2 mL of acetic acid. The color reaction was allowed to proceed for 40 min in a boiling water bath. The product was then extracted with toluene, and the absorbance was measured at 520 nm.

4.12. Photosynthetic Gas Exchange Parameters

The third leaf from the top of the plant was collected when fully expanded between 9:30 and 11:30 AM. The net photosynthetic rate, transpiration rate, and stomatal conductance were measured using a portable LI-6400XT photosynthesis system (Li-COR, Lincoln, NE, USA). The photon flux density was set to 1500 μmol·m−2·s−1, with relative humidity in the leaf chamber maintained at 50% to 70%. The CO2 concentration was set at 400 μmol/mol.

4.13. Activity of Catalase (CAT), Superoxide Dismutase (SOD), and Peroxidase (POD)

4.13.1. CAT Activity

To measure CAT activity, 2.5 g of leaves were homogenized in 25 mL of phosphate-buffered saline (pH 7.8). The mixture was centrifuged at 4000 rpm for 15 min to collect the supernatant. This supernatant was then incubated with 2.5 mL of 0.1 mol/L H2O2 at 30 °C for 10 min. The reaction was terminated by adding 2.5 mL of 10% H2SO4. CAT content was determined by titration with 0.1 M KMnO4 in the presence of H2SO4. An extracted solution that had been boiled for 5 min served as a control.

4.13.2. SOD Activity

To measure SOD activity, 0.5 g of leaves were homogenized in phosphate-buffered saline to obtain a 5 mL mixture. The supernatant was collected by centrifugation at 1000 rpm for 20 min. A 0.05 mL aliquot of the extract was incubated with a chromogenic reagent composed of 1.5 mL of 0.05 mol/L phosphate-buffered saline, 0.3 mL of 130 mM methionine, 0.3 mL of 750 μM nitroblue tetrazolium, 0.3 mL of 100 μM EDTA-Na2, 0.3 mL of 20 μM riboflavin, and 0.25 mL of H2O under 4000 Lux for 20 min. A separate mixture was maintained in the dark as a control. The absorbance was measured at 560 nm.

4.13.3. POD Activity

To measure POD activity, 5.0 g of leaves were homogenized in 10 mL of phosphate-buffered saline. The supernatant was collected by centrifugation at 3000× g for 10 min and transferred to a 25 mL volumetric flask, then diluted with phosphate-buffered saline. A 0.1 mL aliquot of the extracted solution was incubated with a reaction mixture containing 2.9 mL of 0.05 mol/L phosphate-buffered saline, 1.0 mL of 2% H2O2, and 1.0 mL of 0.05 mol/L guaiacol at 37 °C for 15 min. The reaction was terminated by adding 2.0 mL of TCA. The reaction mixture was then filtered, and the absorbance was measured at 470 nm. An extracted solution that had been boiled for 5 min served as a control.

4.14. Chlorophyll Content

Chlorophyll content in potato leaves was measured using a commercial chlorophyll assay kit according to the manufacturer’s instructions (Solarbio, Beijing, China). Fresh potato leaves were collected and washed with distilled water. After draining the surface moisture, the midrib was removed, and the leaves were cut into pieces. Approximately 0.1 g of the leaves was weighed and ground thoroughly in 1 mL of water in the dark. The mixture was then transferred into a 10 mL volumetric flask, diluted with water to the mark, and mixed thoroughly. The volumetric flask was kept in the dark for 3 h. The absorbance of the supernatant was measured at wavelengths of 663 nm and 645 nm using a spectrophotometer (model 552, Perkin Elmer, Shelton, CT, USA).

4.15. qRT-PCR

Relative mRNA expression was assessed using qRT-PCR. cDNA synthesized from total RNA extracted from plant leaves served as the template for analysis. The qPCR reaction mixture contained 100 ng of cDNA, 0.6 µL of specific primers (10 µM), 10 µL of 2 × SuperReal PreMix Plus, and 0.4 µL of 50 × ROX Reference Dye (Tiangen Biotech, Beijing, China), adjusted to a final volume of 20 µL. The thermal cycling conditions on the ABI 3000 system (Applied Biosystems, Foster City, CA, USA) were as follows: initial denaturation at 94 °C for 2 min, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 34 s, and extension at 72 °C for 30 s. Cycle threshold (CT) values were recorded, and mRNA levels were calculated using the formula 2−ΔΔCt [69]. Each experiment comprised three technical replicates and three biological replicates, with StEf1a serving as an internal control. Specific primers used in this study are listed in Table 1.

4.16. Statistical Analysis

Statistical analysis was conducted using GraphPad Prism Software Version 9 (GraphPad, San Diego, CA, USA) and IBM SPSS Statistical Software Version 19 (IBM, Chicago, IL, USA). The Kolmogorov–Smirnov test and the Shapiro–Wilk test were employed to assess the normality of the data. Levene’s test was used to evaluate homoscedasticity. All data were found to fit a normal distribution and exhibited homoscedasticity. Results are presented as the mean ± standard deviation. The statistical significance of differences in mean values was determined using one-way ANOVA, with corrections applied using Dunnett’s method.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms252212423/s1.

Author Contributions

X.Z., H.D., Y.Z. and H.S. planned and designed the research. X.Z., H.D., N.Z., Y.M., H.J., W.L., Z.C., S.C., J.T. and Y.Z. collected the data. X.Z., H.D., H.J., Z.C., S.C., J.T. and Y.Z. analyzed the data. X.Z. and H.S. drafted the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This Research Program was financially supported by the Hainan Provincial Natural Science Foundation of China (No. 324QN327, 322MS116, 323MS095), the National Natural Science Foundation of China (No. 32360459), the Guangdong Provincial Natural Science Foundation of China (No. 2024A1515010068), and Central Public-interest Scientific Institution Basal Research Fund for Chinese Academy of Tropical Agricultural Sciences (No. 1630062024005).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding authors. The GATA protein sequence described in this article can be obtained from the Potato genome resources using the DM v4.03 database (https://spuddb.uga.edu/integrated_searches.shtml, accessed on 24 August 2023).

Acknowledgments

We thank Rongkai Wang (Bioediates, Shaanxi, China) for providing the plasmids pBI121-EGFP, pHANNIBAL, and pART, as well as the construction of overexpression vectors and RNA interference expression vectors.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. Rengasamy, P. Soil salinization. In Oxford Research Encyclopedia of Environmental Science; Oxford University Press: Oxford, UK, 2016. [Google Scholar]
  2. Singh, A. Soil salinization management for sustainable development: A review. J. Environ. Manag. 2021, 277, 111383. [Google Scholar] [CrossRef] [PubMed]
  3. Gaur, M.K.; Squires, V.R. Geographic extent and characteristics of the world’s arid zones and their peoples. In Climate Variability Impacts on Land Use and Livelihoods in Drylands; Springer: Berlin/Heidelberg, Germany, 2018; pp. 3–20. [Google Scholar]
  4. Haj-Amor, Z.; Araya, T.; Kim, D.-G.; Bouri, S.; Lee, J.; Ghiloufi, W.; Yang, Y.; Kang, H.; Jhariya, M.K.; Banerjee, A. Soil salinity and its associated effects on soil microorganisms, greenhouse gas emissions, crop yield, biodiversity and desertification: A review. Sci. Total Environ. 2022, 843, 156946. [Google Scholar] [CrossRef] [PubMed]
  5. Chourasia, K.N.; Lal, M.K.; Tiwari, R.K.; Dev, D.; Kardile, H.B.; Patil, V.U.; Kumar, A.; Vanishree, G.; Kumar, D.; Bhardwaj, V. Salinity stress in potato: Understanding physiological, biochemical and molecular responses. Life 2021, 11, 545. [Google Scholar] [CrossRef] [PubMed]
  6. Xiong, L.; Zhu, J.K. Molecular and genetic aspects of plant responses to osmotic stress. Plant Cell Environ. 2002, 25, 131–139. [Google Scholar] [CrossRef] [PubMed]
  7. Sharma, N.; Gupta, N.; Gupta, S.; Hasegawa, H. Effect of NaCl salinity on photosynthetic rate, transpiration rate, and oxidative stress tolerance in contrasting wheat genotypes. Photosynthetica 2005, 43, 609–613. [Google Scholar] [CrossRef]
  8. Zahra, N.; Al Hinai, M.S.; Hafeez, M.B.; Rehman, A.; Wahid, A.; Siddique, K.H.; Farooq, M. Regulation of photosynthesis under salt stress and associated tolerance mechanisms. Plant Physiol. Biochem. 2022, 178, 55–69. [Google Scholar] [CrossRef]
  9. Sachdev, S.; Ansari, S.A.; Ansari, M.I.; Fujita, M.; Hasanuzzman, M. Abiotic stress and reactive oxygen species: Generation, signaling, and defense mechanisms. Antioxidants 2021, 10, 277. [Google Scholar] [CrossRef]
  10. Tiwari, S.; Ansari, S.A.; Ansari, M.I.; Fujita, M.; Hasanuzzaman, M. Generation mechanisms of reactive oxygen species in the plant cell: An overview. In Reactive Oxygen Species in Plants: Boon or Bane-Revisiting the Role of ROS; Wiley: Hoboken, NJ, USA, 2017; pp. 1–22. [Google Scholar]
  11. Vighi, I.; Benitez, L.; Amaral, M.; Moraes, G.; Auler, P.; Rodrigues, G.; Deuner, S.; Maia, L.; Braga, E. Functional characterization of the antioxidant enzymes in rice plants exposed to salinity stress. Biol. Plant. 2017, 61, 540–550. [Google Scholar] [CrossRef]
  12. Harinasut, P.; Poonsopa, D.; Roengmongkol, K.; Charoensataporn, R. Salinity effects on antioxidant enzymes in mulberry cultivar. Sci. Asia 2003, 29, 109–113. [Google Scholar] [CrossRef]
  13. Singh, A. Salinization and drainage problems of agricultural land. Irrig. Drain. 2020, 69, 844–853. [Google Scholar] [CrossRef]
  14. Han, X.; Yang, R.; Zhang, L.; Wei, Q.; Zhang, Y.; Wang, Y.; Shi, Y. A review of potato salt tolerance. Int. J. Mol. Sci. 2023, 24, 10726. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, M.M.; Li, Y.L.; Li, G.C.; Dong, T.T.; Liu, S.Y.; Pei, L.I.; Wang, Q.G. Overexpression of StCYS1 gene enhances tolerance to salt stress in the transgenic potato (Solanum tuberosum L.) plant. J. Integr. Agric. 2020, 19, 2239–2246. [Google Scholar] [CrossRef]
  16. Ali, A.; Ali, Q.; Iqbal, M.S.; Nasir, I.A.; Wang, X. Salt tolerance of potato genetically engineered with the Atriplex canescens BADH gene. Biol. Plant. 2020, 64, 271–279. [Google Scholar] [CrossRef]
  17. Bi, Y.M.; Zhang, Y.; Signorelli, T.; Zhao, R.; Zhu, T.; Rothstein, S. Genetic analysis of Arabidopsis GATA transcription factor gene family reveals a nitrate-inducible member important for chlorophyll synthesis and glucose sensitivity. Plant J. 2005, 44, 680–692. [Google Scholar] [CrossRef]
  18. Shi, M.; Huang, Q.; Wang, Y.; Wang, C.; Zhu, R.; Zhang, S.; Kai, G. Genome-wide survey of the GATA gene family in camptothecin-producing plant Ophiorrhiza pumila. BMC Genom. 2022, 23, 256. [Google Scholar] [CrossRef]
  19. Saidi, A.; Hajibarat, Z.; Hajibarat, Z. Phylogeny, gene structure and GATA genes expression in different tissues of solanaceae species. Biocatal. Agric. Biotechnol. 2021, 35, 102015. [Google Scholar] [CrossRef]
  20. Zhu, W.; Guo, Y.; Chen, Y.; Wu, D.; Jiang, L. Genome-wide identification, phylogenetic and expression pattern analysis of GATA family genes in Brassica napus. BMC Plant Biol. 2020, 20, 543. [Google Scholar] [CrossRef]
  21. Zhang, K.; Jia, L.; Yang, D.; Hu, Y.; Njogu, M.K.; Wang, P.; Lu, X.; Yan, C. Genome-Wide Identification, Phylogenetic and Expression Pattern Analysis of GATA Family Genes in Cucumber (Cucumis sativus L.). Plants 2021, 10, 1626. [Google Scholar] [CrossRef]
  22. Zhao, Y.; Medrano, L.; Ohashi, K.; Fletcher, J.C.; Yu, H.; Sakai, H.; Meyerowitz, E.M. HANABA TARANU Is a GATA Transcription Factor That Regulates Shoot Apical Meristem and Flower Development in Arabidopsis. Plant Cell 2004, 16, 2586–2600. [Google Scholar] [CrossRef]
  23. Chiang, Y.-H.; Zubo, Y.O.; Tapken, W.; Kim, H.J.; Lavanway, A.M.; Howard, L.; Pilon, M.; Kieber, J.J.; Schaller, G.E. Functional Characterization of the GATA Transcription Factors GNC and CGA1 Reveals Their Key Role in Chloroplast Development, Growth, and Division in Arabidopsis. Plant Physiol. 2012, 160, 332–348. [Google Scholar] [CrossRef]
  24. An, Y.; Zhou, Y.; Han, X.; Shen, C.; Wang, S.; Liu, C.; Yin, W.; Xia, X. The GATA transcription factor GNC plays an important role in photosynthesis and growth in poplar. J. Exp. Bot. 2019, 71, 1969–1984. [Google Scholar] [CrossRef] [PubMed]
  25. Manfield, I.W.; Devlin, P.F.; Jen, C.-H.; Westhead, D.R.; Gilmartin, P.M. Conservation, Convergence, and Divergence of Light-Responsive, Circadian-Regulated, and Tissue-Specific Expression Patterns during Evolution of the Arabidopsis GATA Gene Family. Plant Physiol. 2007, 143, 941–958. [Google Scholar] [CrossRef] [PubMed]
  26. Gupta, P.; Nutan, K.K.; Singla-Pareek, S.L.; Pareek, A. Abiotic stresses cause differential regulation of alternative splice forms of GATA transcription factor in rice. Front. Plant Sci. 2017, 8, 1944. [Google Scholar] [CrossRef] [PubMed]
  27. Zhang, X.; Ma, J.; Yang, S.; Yao, W.; Zhang, N.; Hao, X.; Xu, W. Analysis of GATA transcription factors and their expression patterns under abiotic stress in grapevine (Vitis vinifera L.). BMC Plant Biol. 2023, 23, 611. [Google Scholar] [CrossRef]
  28. Hu, C.; Delauney, A.J.; Verma, D. A bifunctional enzyme (delta 1-pyrroline-5-carboxylate synthetase) catalyzes the first two steps in proline biosynthesis in plants. Proc. Natl. Acad. Sci. USA 1992, 89, 9354–9358. [Google Scholar] [CrossRef]
  29. Yu, R.; Chang, Y.; Chen, H.; Feng, J.; Wang, H.; Tian, T.; Song, Y.; Gao, G. Genome-wide identification of the GATA gene family in potato (Solanum tuberosum L.) and expression analysis. J. Plant Biochem. Biotechnol. 2022, 31, 37–48. [Google Scholar] [CrossRef]
  30. Zhang, X.; Fan, R.; Yu, Z.; Du, X.; Yang, X.; Wang, H.; Xu, W.; Yu, X. Genome-wide identification of GATA transcription factors in tetraploid potato and expression analysis in differently colored potato flesh. Front. Plant Sci. 2024, 15, 1330559. [Google Scholar] [CrossRef]
  31. Aksoy, E.; Yavuz, C.; Yagiz, A.K.; Unel, N.M.; Baloğlu, M.C. Genome-wide characterization and expression analysis of GATA transcription factors under combination of light wavelengths and drought stress in potato. Plant Direct 2024, 8, e569. [Google Scholar] [CrossRef]
  32. Abdulla, M.F.; Mostafa, K.; Aydin, A.; Kavas, M.; Aksoy, E. GATA transcription factor in common bean: A comprehensive genome-wide functional characterization, identification, and abiotic stress response evaluation. Plant Mol. Biol. 2024, 114, 1–22. [Google Scholar] [CrossRef]
  33. Zhang, F.; Wu, Y.; Shi, X.; Wang, X.; Yin, Y. Comparative Analysis of the GATA Transcription Factors in Five Solanaceae Species and Their Responses to Salt Stress in Wolfberry (Lycium barbarum L.). Genes 2023, 14, 1943. [Google Scholar] [CrossRef]
  34. Wang, Y.; Cao, X.; Zhang, D.; Li, Y.; Wang, Q.; Ma, F.; Xu, X.; Zhan, X.; Hu, T. SlGATA17, A tomato GATA protein, interacts with SlHY5 to modulate salinity tolerance and germination. Environ. Exp. Bot. 2023, 206, 105191. [Google Scholar] [CrossRef]
  35. Zhang, C.; Huang, Y.; Xiao, Z.; Yang, H.; Hao, Q.; Yuan, S.; Chen, H.; Chen, L.; Chen, S.; Zhou, X.; et al. A GATA Transcription Factor from Soybean (Glycine max) Regulates Chlorophyll Biosynthesis and Suppresses Growth in the Transgenic Arabidopsis thaliana. Plants 2020, 9, 1036. [Google Scholar] [CrossRef] [PubMed]
  36. Khan, W.-u.-D.; Tanveer, M.; Shaukat, R.; Ali, M.; Pirdad, F. An overview of salinity tolerance mechanism in plants. In Salt and Drought Stress Tolerance in Plants: Signaling Networks and Adaptive Mechanisms; Springer: Berlin/Heidelberg, Germany, 2020; pp. 1–16. [Google Scholar]
  37. Zhang, Y.; Kaiser, E.; Li, T.; Marcelis, L.F. NaCl affects photosynthetic and stomatal dynamics by osmotic effects and reduces photosynthetic capacity by ionic effects in tomato. J. Exp. Bot. 2022, 73, 3637–3650. [Google Scholar] [CrossRef]
  38. Jaramillo Roman, V.; van de Zedde, R.; Peller, J.; Visser, R.G.; van der Linden, C.G.; van Loo, E.N. High-resolution analysis of growth and transpiration of quinoa under saline conditions. Front. Plant Sci. 2021, 12, 634311. [Google Scholar] [CrossRef]
  39. Ali, L.; Shaheen, M.R.; Ihsan, M.Z.; Masood, S.; Zubair, M.; Shehzad, F. Growth, photosynthesis and antioxidant enzyme modulations in broccoli (Brassica oleracea L.) under salinity stress. S. Afr. J. Bot. 2022, 148, 104–111. [Google Scholar] [CrossRef]
  40. Farquhar, G.D.; Sharkey, T.D. Stomatal conductance and photosynthesis. Annu. Rev. Plant Physiol. 1982, 33, 317–345. [Google Scholar] [CrossRef]
  41. Jiang, Q.; Roche, D.; Monaco, T.; Hole, D. Stomatal conductance is a key parameter to assess limitations to photosynthesis and growth potential in barley genotypes. Plant Biol. 2006, 8, 515–521. [Google Scholar] [CrossRef]
  42. Chakraborty, K.; Basak, N.; Bhaduri, D.; Ray, S.; Vijayan, J.; Chattopadhyay, K.; Sarkar, R.K. Ionic basis of salt tolerance in plants: Nutrient homeostasis and oxidative stress tolerance. In Plant Nutrients and Abiotic Stress Tolerance; Springer: Berlin/Heidelberg, Germany, 2018; pp. 325–362. [Google Scholar]
  43. Yu, Y.-H.; Bian, L.; Yu, K.-K.; Yang, S.-D.; Zhang, G.-H.; Guo, D.-L. Grape (Vitis davidii) VdGATA2 functions as a transcription activator and enhances powdery mildew resistance via the active oxygen species pathway. Sci. Hortic. 2020, 267, 109327. [Google Scholar] [CrossRef]
  44. Mistry, J.; Finn, R.D.; Eddy, S.R.; Bateman, A.; Punta, M. Challenges in homology search: HMMER3 and convergent evolution of coiled-coil regions. Nucleic Acids Res. 2013, 41, e121. [Google Scholar] [CrossRef]
  45. Xu, X.; Pan, S.; Cheng, S.; Zhang, B.; Mu, D.; Ni, P.; Zhang, G.; Yang, S.; Li, R.; Wang, J.; et al. Genome sequence and analysis of the tuber crop potato. Nature 2011, 475, 189–195. [Google Scholar]
  46. Madeira, F.; Park, Y.M.; Lee, J.; Buso, N.; Gur, T.; Madhusoodanan, N.; Basutkar, P.; Tivey, A.R.N.; Potter, S.C.; Finn, R.D.; et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 2019, 47, W636–W641. [Google Scholar] [CrossRef] [PubMed]
  47. Edgar, R.C. MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinform. 2004, 5, 113. [Google Scholar] [CrossRef] [PubMed]
  48. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  49. Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003, 31, 3784–3788. [Google Scholar] [CrossRef]
  50. Chou, K.C.; Shen, H.B. Plant-mPLoc: A top-down strategy to augment the power for predicting plant protein subcellular localization. PLoS ONE 2010, 5, e11335. [Google Scholar] [CrossRef]
  51. Jing, L.; Guo, D.; Hu, W.; Niu, X. The prediction of a pathogenesis-related secretome of Puccinia helianthi through high-throughput transcriptome analysis. BMC Bioinform. 2017, 18, 166. [Google Scholar] [CrossRef]
  52. Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef]
  53. Wang, Y.; Tang, H.; Debarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef]
  54. Shen, C.; Yuan, J. Genome-Wide Investigation and Expression Analysis of K(+)-Transport-Related Gene Families in Chinese Cabbage (Brassica rapa sspekinensis). Biochem. Genet. 2021, 59, 256–282. [Google Scholar] [CrossRef]
  55. Li, J.; Wang, Z.; Qi, B.; Zhang, J.; Yang, H. MEMe: A Mutually Enhanced Modeling Method for Efficient and Effective Human Pose Estimation. Sensors 2022, 22, 632. [Google Scholar] [CrossRef]
  56. Wei, J.; Tiika, R.J.; Cui, G.; Ma, Y.; Yang, H.; Duan, H. Transcriptome-wide identification and expression analysis of the KT/HAK/KUP family in Salicornia europaea L. under varied NaCl and KCl treatments. PeerJ 2022, 10, e12989. [Google Scholar] [CrossRef] [PubMed]
  57. Blum, M.; Chang, H.Y.; Chuguransky, S.; Grego, T.; Kandasaamy, S.; Mitchell, A.; Nuka, G.; Paysan-Lafosse, T.; Qureshi, M.; Raj, S.; et al. The InterPro protein families and domains database: 20 years on. Nucleic Acids Res. 2021, 49, D344–D354. [Google Scholar] [CrossRef] [PubMed]
  58. Hu, B.; Jin, J.; Guo, A.Y.; Zhang, H.; Luo, J.; Gao, G. GSDS 2.0, an upgraded gene feature visualization server. Bioinformatics 2015, 31, 1296–1297. [Google Scholar] [CrossRef]
  59. Hardigan, M.A.; Crisovan, E.; Hamilton, J.P.; Kim, J.; Laimbeer, P.; Leisner, C.P.; Manrique-Carpintero, N.C.; Newton, L.; Pham, G.M.; Vaillancourt, B.; et al. Genome Reduction Uncovers a Large Dispensable Genome and Adaptive Role for Copy Number Variation in Asexually Propagated Solanum tuberosum. Plant Cell 2016, 28, 388–405. [Google Scholar] [CrossRef]
  60. Johnson, M.; Zaretskaya, I.; Raytselis, Y.; Merezhuk, Y.; McGinnis, S.; Madden, T.L. NCBI BLAST: A better web interface. Nucleic Acids Res. 2008, 36 (Suppl. S2), W5–W9. [Google Scholar] [CrossRef]
  61. Jacob, A.; Lancaster, J.; Buhler, J.; Harris, B.; Chamberlain, R.D. Mercury BLASTP: Accelerating Protein Sequence Alignment. ACM Trans. Reconfigurable Technol. Syst. 2008, 1, 9. [Google Scholar] [CrossRef]
  62. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  63. Li, G.; Cao, C.; Yang, H.; Wang, J.; Wei, W.; Zhu, D.; Gao, P.; Zhao, Y. Molecular cloning and potential role of DiSOC1s in flowering regulation in Davidia involucrata Baill. Plant Physiol. Biochem. 2020, 157, 453–459. [Google Scholar] [CrossRef]
  64. Lu, H.; Klocko, A.L.; Brunner, A.M.; Ma, C.; Magnuson, A.C.; Howe, G.T.; An, X.; Strauss, S.H. RNA interference suppression of AGAMOUS and SEEDSTICK alters floral organ identity and impairs floral organ determinacy, ovule differentiation, and seed-hair development in Populus. New Phytol. 2019, 222, 923–937. [Google Scholar] [CrossRef]
  65. Sparkes, I.A.; Runions, J.; Kearns, A.; Hawes, C. Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nat. Protoc. 2006, 1, 2019–2025. [Google Scholar] [CrossRef]
  66. Junglee, S.; Urban, L.; Sallanon, H.; Lopez-Lauri, F. Optimized assay for hydrogen peroxide determination in plant tissue using potassium iodide. Am. J. Anal. Chem. 2014, 5, 730. [Google Scholar] [CrossRef]
  67. Heath, R.L.; Packer, L. Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophys. 1968, 125, 189–198. [Google Scholar] [CrossRef] [PubMed]
  68. Bates, L.S.; Waldren, R.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
  69. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Figure 1. Study design flowchart.
Figure 1. Study design flowchart.
Ijms 25 12423 g001
Figure 2. Heatmap presenting mRNA expression of StGATA family genes in different potato plant organs and in leaves responding to NaCl-induced salt stress and PEG-induced osmotic stress. (A) mRNA expression of StGATA genes in potato roots, tubers, leaves, petioles, stems, and flowers; different letters indicate significant difference (p < 0.05, by one-way ANOVA with Tukey test or Dunnett’s T3 for post hoc analysis) among root, tuber, leaf, petiole, stem, and flower. mRNA expression profiles of StGATA genes under (B,C) salt stress and (D,E) osmotic stress; different letters indicate significant difference (n = 9, p < 0.05, by one-way ANOVA with Tukey test or Dunnett’s T3 for post hoc analysis) among leaf samples; four-week-old normally grown plants were subjected to 0 h, 1 h, 3 h, 6 h, 12 h, and 24 h of cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%).
Figure 2. Heatmap presenting mRNA expression of StGATA family genes in different potato plant organs and in leaves responding to NaCl-induced salt stress and PEG-induced osmotic stress. (A) mRNA expression of StGATA genes in potato roots, tubers, leaves, petioles, stems, and flowers; different letters indicate significant difference (p < 0.05, by one-way ANOVA with Tukey test or Dunnett’s T3 for post hoc analysis) among root, tuber, leaf, petiole, stem, and flower. mRNA expression profiles of StGATA genes under (B,C) salt stress and (D,E) osmotic stress; different letters indicate significant difference (n = 9, p < 0.05, by one-way ANOVA with Tukey test or Dunnett’s T3 for post hoc analysis) among leaf samples; four-week-old normally grown plants were subjected to 0 h, 1 h, 3 h, 6 h, 12 h, and 24 h of cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%).
Ijms 25 12423 g002
Figure 3. Subcellular localization of GATA12 and mRNA expression of GATA12 gene in the transgenic plants. (A) StGATA12 protein located on the cellular nucleus of tobacco epidermal cells; GFP-StGATA12 fusion protein was transiently expressed in tobacco leaves and observed using a laser scanning confocal microscope; Scale bar = 50 μm. (B,C) The relative quantification of StGATA12 mRNA in pBI121-EGFP-StGATA12-transgenic lines and pART-StGATA12-RNAi-transgenic lines; Data are the means ± standard deviation. *** p < 0.001 (OE or Ri compared to NC, two-way ANOVA corrected by Sidak’s multiple comparisons test).
Figure 3. Subcellular localization of GATA12 and mRNA expression of GATA12 gene in the transgenic plants. (A) StGATA12 protein located on the cellular nucleus of tobacco epidermal cells; GFP-StGATA12 fusion protein was transiently expressed in tobacco leaves and observed using a laser scanning confocal microscope; Scale bar = 50 μm. (B,C) The relative quantification of StGATA12 mRNA in pBI121-EGFP-StGATA12-transgenic lines and pART-StGATA12-RNAi-transgenic lines; Data are the means ± standard deviation. *** p < 0.001 (OE or Ri compared to NC, two-way ANOVA corrected by Sidak’s multiple comparisons test).
Ijms 25 12423 g003
Figure 4. Phenotypical and growth alterations of non-transgenic and transgenic lines in response to NaCl-induced salt stress and PEG-induced osmotic stress. (A) Representative phenotypes of NT and transgenic plants; bar = 2 cm. Morphological changes ((B), plant height; (C), fresh plant weight; (D), dry plant weight; (E), fresh root weight; (F), dry root weight) of potato plants were imaged 2 days after cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%). NT, non-transgenic plants; OE, pBI121-EGFP-StGATA12-transgenic lines; Ri, pART-StGATA12-RNAi-transgenic lines. Mean ± standard deviation (n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 4. Phenotypical and growth alterations of non-transgenic and transgenic lines in response to NaCl-induced salt stress and PEG-induced osmotic stress. (A) Representative phenotypes of NT and transgenic plants; bar = 2 cm. Morphological changes ((B), plant height; (C), fresh plant weight; (D), dry plant weight; (E), fresh root weight; (F), dry root weight) of potato plants were imaged 2 days after cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%). NT, non-transgenic plants; OE, pBI121-EGFP-StGATA12-transgenic lines; Ri, pART-StGATA12-RNAi-transgenic lines. Mean ± standard deviation (n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Ijms 25 12423 g004
Figure 5. Physiological indexes of non-transgenic and transgenic plants in response to NaCl-induced salt stress and PEG-induced osmotic stress. (A,B) H2O2 content, (C,D) MDA content, (E,F) proline content, (G,H) CAT activity, (I,J) SOD activity, and (K,L) POD activity were examined 24 h after cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%) treatment. NT, non-transgenic plants; OE, pBI121-EGFP-StGATA12-transgenic lines; Ri, pART-StGATA12-RNAi-transgenic lines. Mean ± standard deviation (n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 5. Physiological indexes of non-transgenic and transgenic plants in response to NaCl-induced salt stress and PEG-induced osmotic stress. (A,B) H2O2 content, (C,D) MDA content, (E,F) proline content, (G,H) CAT activity, (I,J) SOD activity, and (K,L) POD activity were examined 24 h after cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%) treatment. NT, non-transgenic plants; OE, pBI121-EGFP-StGATA12-transgenic lines; Ri, pART-StGATA12-RNAi-transgenic lines. Mean ± standard deviation (n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Ijms 25 12423 g005
Figure 6. Photosynthesis of non-transgenic and transgenic plants in response to NaCl-induced salt stress and PEG-induced osmotic stress. (A,B) Net photosynthesis rate, (C,D) transpiration rate, and (E,F) stomatal conductance were examined 24 h after cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%). NT, non-transgenic plants; OE, pBI121-EGFP-StGATA12-transgenic lines; Ri, pART-StGATA12-RNAi-transgenic lines. Mean ± standard deviation (n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 6. Photosynthesis of non-transgenic and transgenic plants in response to NaCl-induced salt stress and PEG-induced osmotic stress. (A,B) Net photosynthesis rate, (C,D) transpiration rate, and (E,F) stomatal conductance were examined 24 h after cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%). NT, non-transgenic plants; OE, pBI121-EGFP-StGATA12-transgenic lines; Ri, pART-StGATA12-RNAi-transgenic lines. Mean ± standard deviation (n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Ijms 25 12423 g006
Figure 7. Chlorophyll content and ion leakage of non-transgenic and transgenic plants in response to NaCl-induced salt stress and PEG-induced osmotic stress. Chlorophyll content (A,B) and ion leakage (C,D) were analyzed 24 h after cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%). NT, non-transgenic plants; OE, pBI121-EGFP-StGATA12-transgenic lines; Ri, pART-StGATA12-RNAi-transgenic lines. Mean ± standard deviation (n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 7. Chlorophyll content and ion leakage of non-transgenic and transgenic plants in response to NaCl-induced salt stress and PEG-induced osmotic stress. Chlorophyll content (A,B) and ion leakage (C,D) were analyzed 24 h after cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%). NT, non-transgenic plants; OE, pBI121-EGFP-StGATA12-transgenic lines; Ri, pART-StGATA12-RNAi-transgenic lines. Mean ± standard deviation (n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Ijms 25 12423 g007
Figure 8. mRNA expression of stress-responsive genes in non-transgenic and transgenic plants in response to NaCl-induced salt stress and PEG-induced osmotic stress. (A) StSOD mRNA, (B) StCAT mRNA, (C) StPOD mRNA, and (D) StP5CS mRNA in the leaves were assayed 24 h after cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%). NT, non-transgenic plants; OE, pBI121-EGFP-StGATA12-transgenic lines; Ri, pART-StGATA12-RNAi-transgenic lines. Mean ± standard deviation (n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 8. mRNA expression of stress-responsive genes in non-transgenic and transgenic plants in response to NaCl-induced salt stress and PEG-induced osmotic stress. (A) StSOD mRNA, (B) StCAT mRNA, (C) StPOD mRNA, and (D) StP5CS mRNA in the leaves were assayed 24 h after cultivation with NaCl (75 mM and 150 mM) or PEG6000 (10% and 20%). NT, non-transgenic plants; OE, pBI121-EGFP-StGATA12-transgenic lines; Ri, pART-StGATA12-RNAi-transgenic lines. Mean ± standard deviation (n = 9). Ordinary two-way ANOVA with Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Ijms 25 12423 g008
Table 1. Specific primers used in this study.
Table 1. Specific primers used in this study.
Gene IDGeneForward (5′-3′)Reverse (5′-3′)Length (bp)
XM_006347752.2StEf1αGGTTGTATCTCTTCCGATAAAGGCGGTTGTATCTCTTCCGATAAAGGC132
XM_015308529.1StP5CSTGCAATGCAATGGAAACGCTACAATTTCCACGGTGCAAGC194
AY442179StCATCCATGCTGAGGTGTATCCTATTCCCTTTCTCCTGGTTGCTTGA100
AF354748StSODCATTGGAAGAGCTGTTGTTGTTATCCTTCCGCCAGCATTT96
XM_006362636.2StPODAGATGTTGTGGCCATGTCTGGGCTTGTGTTGAAGGATGGAGC118
PGSC0003DMT400006011StGATA1TGGAGATCGCAACTCCAGAAGGCATTGCACAGCGACTTAGG196
PGSC0003DMT400066953StGATA2CTCTGCGTTCCCAGTGATGATTCCGTGAAACGACGCAGTA136
PGSC0003DMT400063771StGATA3TCCGACCCAAAAGGAGGAATCTCCCACAAGCATTGCACAGT137
PGSC0003DMT400061125StGATA4ATTGTGGCATCAAGCAAACCGCTGTTTGCATGTCGGGGAAC130
PGSC0003DMT400083773StGATA5CACCAAGATAGACACCAGCAAACTAGCGAATGTGAGGAGTAGGGTT136
PGSC0003DMT400083774StGATA6GTGGAAGTGGAGGAGGAATAGAGCCACACCATTCATCTCCATAGAAC131
PGSC0003DMT400027729StGATA7CCCTGTAGATAGCGGCAGAGTTACCTCACACCCTCCTAATAATAGCA142
PGSC0003DMT400027731StGATA8TGTGGGCTTATGTGGGCAAAAGCTTCTTGCATATCCTCTTGAT165
PGSC0003DMT400027733StGATA9CAGTTAACATTGATGAAGAGCAGGAGCAGGCCAGTGAACACTCAT130
PGSC0003DMT400027730StGATA10ACCACTGCTGAGCTGGATATGTCCTGCTCTTCATCAATGTTAACTG101
PGSC0003DMT400027728StGATA11ATGTGGGCAAACAAGGGTATCAGAAAGGAGAACTATCAGCAAAGT187
PGSC0003DMT400008112StGATA12CTTCTTCTCCAACCTCTTCGTCGGTCTCTGCTGATGGATTCTTT142
PGSC0003DMT400008111StGATA13ACTCCCTATTCCGGTTGATGACGGTTCAGACCGGAACTCTG145
PGSC0003DMT400031356StGATA14GAACTCAGTCTTCCTGGGGCTCGTTCGGCACTAAACGGAA192
PGSC0003DMT400040074StGATA15TTCTTCTTCGTCTTCCGTTGATATGTAAGAAGAAGAAGAGCGACG119
PGSC0003DMT400009117StGATA16AGTGAAATCAGTGTTCCGACTGCCGGCAGGATAAGCAAGTGA101
PGSC0003DMT400009118StGATA17CTTGTGGTGTTCGGTTCAAATCTTTCTTCTGATTCCTTCTTCCG137
PGSC0003DMT400009031StGATA18CATCGTTGTAGTGGGAGTATGGTTGATAAGGCGAGTAGAAGGAGTTC189
PGSC0003DMT400089018StGATA19CAAATTTCACCGTCTCTCTCACAGAAGCTGTCCATCCCCTGC100
PGSC0003DMT400006491StGATA20CGAACTCTGCGTTCCGTTTGTGAACTGTCGGTGGTGATGG148
PGSC0003DMT400070134StGATA21ATTCCTGACCTCAAGTCCTGTTTAGAAACAGGACTTGAGGTCAGGA124
PGSC0003DMT400070133StGATA22TTGGAACGATCCGTTGCCTGAACGATATCCTCGTACGGAACT106
PGSC0003DMT400070135StGATA23TCGGATTTCGTGGATGAGATAGTCCTTACAATCAACAGCGTCAA112
PGSC0003DMT400024208StGATA24TTGTGCTGATCTGGAAAAGAATCTGCAGGAATGACGACCTCAG154
PGSC0003DMT400024207StGATA25ATAGTGTCAGGAAAGAGGTTGCTACAGTTACAGAATGTTGTGTGCC141
PGSC0003DMT400024206StGATA26GATGGAGGAGAAGAGACTATGGATTAGAAACTTCCACAACTCCACCT123
PGSC0003DMT400024205StGATA27GGGAACTCCTGACAATCCCGACAGGCAGTCAACCTCAGTT203
PGSC0003DMT400069864StGATA28AGCCCTTCATTTCCTGATTATGTACTGAATTTGGGCTGTGGTGA137
PGSC0003DMT400069865StGATA29GCCCTTCATTTCCTGATTATGTGTTGTTGTTGTTGTTGTTGCTG172
PGSC0003DMT400060240StGATA30CAGCAGCAACAGTGAAGATAGTAAAATGCTGCTTGTTCTACTTCTCC167
PGSC0003DMT400060241StGATA31GGTGGATCTAAGTGATAAACAGGGTGCAGGTCCACCTCTCCAAAG141
PGSC0003DMT400060242StGATA32GCAGCAGCAACAGTGAAGATAGTAATGCTGCTTGTTCTACTTCTCCAA167
PGSC0003DMT400059990StGATA33AGCTCTCAGTTCCGTATGAGGGCCTTGGGATAACGGCTCTT134
PGSC0003DMT400068348StGATA34ACAGCCTTCTCAAGGACACAGCTTTCTTTGCACCTGCATACT148
PGSC0003DMT400068347StGATA35GACATCCGAACTCAATAGGTAGAGGTAGACAATCGTGAATAAGCCTCA102
PGSC0003DMT400068346StGATA36AGTGACAAGCCTATGGTCTCTGTTGGTAGACAATCGTGAATAAGCCTC155
PGSC0003DMT400068349StGATA37GAAGTTACAGGAGGGCCCAACTGAAGCGAAATGGTCTGCAT103
PGSC0003DMT400062488StGATA38CGAGGAAGATTGGGATGCGAGGGACTCCAGAAATTCGTTAGGA146
PGSC0003DMT400011449StGATA39TGGGAGATCAAAAGCAACAACCCCACATGCGTTACACAATGACTTA145
PGSC0003DMT400052800StGATA40TCCGAAGTGTTCAGGTGCAAAGGCAAACGAGCTTCTTGGA128
PGSC0003DMT400052799StGATA41AGAACCTTGTGACTTTGAGGAACAGAGCCAGAACTTGACCTATTGCTA188
PGSC0003DMT400052801StGATA42TCCGAAGTGTTCAGGTGCAAATTGGACTGAAGCAAGAGCCAT113
PGSC0003DMT400074935StGATA43TTGTCCGGAAGCAATCACCCCAGCCATATCTTCATATGGAACGG100
PGSC0003DMT400067506StGATA44GTCGGTTGACAACAAGCACCGGTGGTCCCTGCTCCTTTTA170
PGSC0003DMT400067505StGATA45ACAACAATGCTCATACTTCTCTGGGGCTTCTGATTCTTCTTCTCTACC144
PGSC0003DMT400081417StGATA46CATCAGGTCCCAAGTCGTTGGCCATCAATAATATCGCCGCT187
PGSC0003DMT400030274StGATA47CAACTGCATGTTTCATGGTGGATTCTTCCTCTACACACTCAGGG179
PGSC0003DMT400030276StGATA48GTGGATGATGACCTTCTCAACTTCGAAGAAGGCTAACAAGAGGGTTTG135
PGSC0003DMT400030708StGATA49ACCAACCACCTCCTACCGATTGCTACATCATCACTCGGAACA110
PGSC0003DMT400020876StGATA50CATCCACACCCTCCGATCAACGAGGACGTACGGGAATGAC152
PGSC0003DMT400020875StGATA51ACATCCACACCCTCCGATCAACTCTTTCCACCAGAGCAGG112
PGSC0003DMT400000761StGATA52AGCAACAGCTCTTCCAACAACCATGCGTTACAAAGAGACTTAGGG119
PGSC0003DMT400000760StGATA53CTCAAACTCTCACAGGAAAGTCGTTACTCATAGGAACAAACTCTGGCG172
PGSC0003DMT400000762StGATA54CTGATTACAGCAGCAACAGCTCCCACATGCGTTACAAAGAGACTTA133
PGSC0003DMT400011779StGATA55GACCTGCTGGACCTAAGTCATTTTCTCCGCTGCTGCTTGTA186
PGSC0003DMT400011778StGATA56ATGTGGAATAAGGAGCAGGAAGAGCTACTCTGGTTCTGAGGATGATG120
PGSC0003DMT400011780StGATA57ACCTGCTGGACCTAAGTCATTGTTGCTACTGCTATTGCTACTCTGGTT164
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhu, X.; Duan, H.; Zhang, N.; Majeed, Y.; Jin, H.; Li, W.; Chen, Z.; Chen, S.; Tang, J.; Zhang, Y.; et al. Genome-Wide Identification of GATA Family Genes in Potato and Characterization of StGATA12 in Response to Salinity and Osmotic Stress. Int. J. Mol. Sci. 2024, 25, 12423. https://doi.org/10.3390/ijms252212423

AMA Style

Zhu X, Duan H, Zhang N, Majeed Y, Jin H, Li W, Chen Z, Chen S, Tang J, Zhang Y, et al. Genome-Wide Identification of GATA Family Genes in Potato and Characterization of StGATA12 in Response to Salinity and Osmotic Stress. International Journal of Molecular Sciences. 2024; 25(22):12423. https://doi.org/10.3390/ijms252212423

Chicago/Turabian Style

Zhu, Xi, Huimin Duan, Ning Zhang, Yasir Majeed, Hui Jin, Wei Li, Zhuo Chen, Shu Chen, Jinghua Tang, Yu Zhang, and et al. 2024. "Genome-Wide Identification of GATA Family Genes in Potato and Characterization of StGATA12 in Response to Salinity and Osmotic Stress" International Journal of Molecular Sciences 25, no. 22: 12423. https://doi.org/10.3390/ijms252212423

APA Style

Zhu, X., Duan, H., Zhang, N., Majeed, Y., Jin, H., Li, W., Chen, Z., Chen, S., Tang, J., Zhang, Y., & Si, H. (2024). Genome-Wide Identification of GATA Family Genes in Potato and Characterization of StGATA12 in Response to Salinity and Osmotic Stress. International Journal of Molecular Sciences, 25(22), 12423. https://doi.org/10.3390/ijms252212423

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop