Detection of Potato Pathogen Clavibacter sepedonicus by CRISPR/Cas13a Analysis of NASBA Amplicons
Abstract
1. Introduction
2. Results
2.1. Primers and gRNA Selection
2.2. Sensitivity and Selectivity of NASBA/Cas13a Detection System
2.3. The “One-Pot” NASBA/Cas13a Detection System
2.4. “Naked-Eye” Detection of the Test Results
3. Discussion
4. Materials and Methods
4.1. DNA and RNA Oligonucleotide Synthesis
4.2. Bacteria Culturing and RNA Isolation
4.3. NASBA
4.4. Cas13a Cleavage Assay
4.5. The “One-Pot” Assay
4.6. Statistical Treatment
4.7. The Calculation of LOD in Colony-Forming Units per 1 g of Tuber Tissue
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Devaux, A.; Kromann, P.; Ortiz, O. Potatoes for Sustainable Global Food Security. Potato Res. 2014, 57, 185–199. [Google Scholar] [CrossRef]
- Devaux, A.; Goffart, J.-P.; Petsakos, A.; Kromann, P.; Gatto, M.; Okello, J.; Suarez, V.; Hareau, G. Global Food Security, Contributions from Sustainable Potato Agri-Food Systems. In The Potato Crop: Its Agricultural, Nutritional and Social Contribution to Humankind; Campos, H., Ortiz, O., Eds.; Springer International Publishing: Cham, Switzerland, 2020; pp. 3–35. ISBN 978-3-030-28683-5. [Google Scholar]
- Charkowski, A.; Sharma, K.; Parker, M.L.; Secor, G.A.; Elphinstone, J. Bacterial Diseases of Potato. In The Potato Crop: Its Agricultural, Nutritional and Social Contribution to Humankind; Campos, H., Ortiz, O., Eds.; Springer International Publishing: Cham, Switzerland, 2020; pp. 351–388. ISBN 978-3-030-28683-5. [Google Scholar]
- Li, X.; Tambong, J.; Yuan, K.X.; Chen, W.; Xu, H.; Lévesque, C.A.; De Boer, S.H. Re-Classification of Clavibacter michiganensis Subspecies on the Basis of Whole-Genome and Multi-Locus Sequence Analyses. Int. J. Syst. Evol. Microbiol. 2018, 68, 234–240. [Google Scholar] [CrossRef]
- Osdaghi, E.; van der Wolf, J.M.; Abachi, H.; Li, X.; De Boer, S.H.; Ishimaru, C.A. Bacterial Ring Rot of Potato Caused by Clavibacter sepedonicus: A Successful Example of Defeating the Enemy under International Regulations. Mol. Plant Pathol. 2022, 23, 911–932. [Google Scholar] [CrossRef]
- PM 7/59 (2) Clavibacter Sepedonicus. EPPO Bull. 2022, 52, 262–285. [CrossRef]
- Pastrik, K.-H. Detection of Clavibacter michiganensis subsp. sepedonicus in Potato Tubers by Multiplex PCR with Coamplification of Host DNA. Eur. J. Plant Pathol. 2000, 106, 155–165. [Google Scholar] [CrossRef]
- Gudmestad, N.C.; Mallik, I.; Pasche, J.S.; Anderson, N.R.; Kinzer, K. A Real-Time PCR Assay for the Detection of Clavibacter michiganensis subsp. sepedonicus Based on the Cellulase A Gene Sequence. Plant Dis. 2009, 93, 649–659. [Google Scholar] [CrossRef]
- Cho, M.S.; Park, D.H.; Namgung, M.; Ahn, T.-Y.; Park, D.S. Validation and Application of a Real-Time PCR Protocol for the Specific Detection and Quantification of Clavibacter michiganensis subsp. sepedonicus in Potato. Plant Pathol. J. 2015, 31, 123–131. [Google Scholar] [CrossRef]
- Safenkova, I.V.; Zaitsev, I.A.; Pankratova, G.K.; Varitsev, Y.A.; Zherdev, A.V.; Dzantiev, B.B. Lateral Flow Immunoassay for Rapid Detection of Potato Ring Rot Caused by Clavibacter michiganensis subsp. sepedonicus. Appl. Biochem. Microbiol. 2014, 50, 675–682. [Google Scholar] [CrossRef]
- Przewodowski, W.; Przewodowska, A. Development of a Sensitive and Specific Polyclonal Antibody for Serological Detection of Clavibacter michiganensis subsp. sepedonicus. PLoS ONE 2017, 12, e0169785. [Google Scholar] [CrossRef] [PubMed]
- NAPPO Diagnostic Protocol, NAPPO Regional Standard for Phytosanitary Measures (RSPM). Requirements for Importation of Potatoes into a NAPPO Member Country. RSPM 3. 2003, 28–30. Available online: https://www.nappo.org/english/products/regional-standards-phytosanitary-measures-rspm (accessed on 26 October 2024).
- Lee, I.-M.; Lukaesko, L.A.; Maroon, C.J.M. Comparison of Dig-Labeled PCR, Nested PCR, and ELISA for the Detection of Clavibacter michiganensis subsp. sepedonicus in Field-Grown Potatoes. Plant. Dis. 2001, 85, 261–266. [Google Scholar] [CrossRef] [PubMed]
- van Vaerenbergh, J.; Müller, P.; Elphinstone, J.G.; Vreeburg, R.A.M.; Janse, J.D. Euphresco Inter-Laboratory Comparison (2009–2012) on Detection of Clavibacter michiganensis subsp. sepedonicus and Ralstonia solanacearum in Potato Tubers: Proposal to Include TaqMan® Real-Time PCR as a Primary (Core) Screening Test in EU/EPPO Standard Methods. EPPO Bull. 2017, 47, 24–32. [Google Scholar] [CrossRef]
- Sagcan, H.; Turgut Kara, N. Detection of Potato Ring Rot Pathogen Clavibacter michiganensis subsp. sepedonicus by Loop-Mediated Isothermal Amplification (LAMP) Assay. Sci. Rep. 2019, 9, 20393. [Google Scholar] [CrossRef]
- van Beckhoven, J.R.C.M.; Stead, D.E.; van der Wolf, J.M. Detection of Clavibacter michiganensis subsp. sepedonicus by AmpliDet RNA, a New Technology Based on Real Time Monitoring of NASBA Amplicons with a Molecular Beacon. J. Appl. Microbiol. 2002, 93, 840–849. [Google Scholar] [CrossRef]
- Leone, G.; van Schijndel, H.; van Gemen, B.; Kramer, F.R.; Schoen, C.D. Molecular Beacon Probes Combined with Amplification by NASBA Enable Homogeneous, Real-Time Detection of RNA. Nucl. Acids Res. 1998, 26, 2150–2155. [Google Scholar] [CrossRef]
- Oliveira, B.B.; Veigas, B.; Baptista, P.V. Isothermal Amplification of Nucleic Acids: The Race for the Next “Gold Standard”. Front. Sens. 2021, 2, 752600. [Google Scholar] [CrossRef]
- Lee, Y.; Oh, Y.; Lee, S.H. Recent Advances in Genome Engineering by CRISPR Technology. BMB Rep. 2024, 57, 12–18. [Google Scholar] [CrossRef]
- Kaminski, M.M.; Abudayyeh, O.O.; Gootenberg, J.S.; Zhang, F.; Collins, J.J. CRISPR-Based Diagnostics. Nat. Biomed. Eng. 2021, 5, 643–656. [Google Scholar] [CrossRef]
- Chen, L.; Hu, M.; Zhou, X. Trends in Developing One-Pot CRISPR Diagnostics Strategies. Trends. Biotechnol. 2024. [Google Scholar] [CrossRef] [PubMed]
- Prasad, D.; Mani, N.K.; Pandey, D.M. CRISPR/Cas Technology: Opportunities for Phytopathogenic Viruses Detection. J. Biotechnol. 2022, 360, 211–217. [Google Scholar] [CrossRef]
- Islam, T.; Kasfy, S.H. CRISPR-Based Point-of-Care Plant Disease Diagnostics. Trends. Biotechnol. 2023, 41, 144–146. [Google Scholar] [CrossRef] [PubMed]
- Xue, T.; Lu, Y.; Yang, H.; Hu, X.; Zhang, K.; Ren, Y.; Wu, C.; Xia, X.; Deng, R.; Wang, Y. Isothermal RNA Amplification for the Detection of Viable Pathogenic Bacteria to Estimate the Salmonella Virulence for Causing Enteritis. J. Agric. Food Chem. 2022, 70, 1670–1678. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Xue, T.; Wang, M.; Ledesma-Amaro, R.; Lu, Y.; Hu, X.; Zhang, T.; Yang, M.; Li, Y.; Xiang, J.; et al. CRISPR-Cas13a Cascade-Based Viral RNA Assay for Detecting SARS-CoV-2 and Its Mutations in Clinical Samples. Sens. Actuators B Chem. 2022, 362, 131765. [Google Scholar] [CrossRef] [PubMed]
- López-Valls, M.; Escalona-Noguero, C.; Rodríguez-Díaz, C.; Pardo, D.; Castellanos, M.; Milán-Rois, P.; Martínez-Garay, C.; Coloma, R.; Abreu, M.; Cantón, R.; et al. CASCADE: Naked Eye-Detection of SARS-CoV-2 Using Cas13a and Gold Nanoparticles. Anal. Chim. Acta 2022, 1205, 339749. [Google Scholar] [CrossRef] [PubMed]
- Mao, Z.; Lei, H.; Chen, R.; Ren, S.; Liu, B.; Gao, Z. CRISPR/Cas13a Analysis Based on NASBA Amplification for Norovirus Detection. Talanta 2024, 280, 126725. [Google Scholar] [CrossRef]
- Deich, C.; Cash, B.; Sato, W.; Sharon, J.; Aufdembrink, L.; Gaut, N.J.; Heili, J.; Stokes, K.; Engelhart, A.E.; Adamala, K.P. T7Max Transcription System. J. Biol. Eng. 2023, 17, 4. [Google Scholar] [CrossRef]
- Conrad, T.; Plumbom, I.; Alcobendas, M.; Vidal, R.; Sauer, S. Maximizing Transcription of Nucleic Acids with Efficient T7 Promoters. Commun. Biol. 2020, 3, 439. [Google Scholar] [CrossRef]
- Tang, G.-Q.; Bandwar, R.P.; Patel, S.S. Extended Upstream A-T Sequence Increases T7 Promoter Strength. J. Biol. Chem. 2005, 280, 40707–40713. [Google Scholar] [CrossRef]
- Khutsishvili, S.S.; Perfileva, A.I.; Kon’kova, T.V.; Lobanova, N.A.; Sadykov, E.K.; Sukhov, B.G. Copper-Containing Bionanocomposites Based on Natural Raw Arabinogalactan as Effective Vegetation Stimulators and Agents against Phytopathogens. Polymers 2024, 16, 716. [Google Scholar] [CrossRef]
- Cai, J.; Wang, S.; Wang, Q. Antibacterial Activity of Dihydroquercetin Separated from Fructus Polygoni Orientalis against Clavibacter michiganensis subsp. sepedonicus via Damaging Cell Membrane. Foods 2023, 13, 23. [Google Scholar] [CrossRef]
- Kumar, S.S.; Ghosh, A.R. Assessment of Bacterial Viability: A Comprehensive Review on Recent Advances and Challenges. Microbiology 2019, 165, 593–610. [Google Scholar] [CrossRef]
- Bertani, G. Lysogeny at Mid-Twentieth Century: P1, P2, and Other Experimental Systems. J. Bacteriol. 2004, 186, 595–600. [Google Scholar] [CrossRef]
- Kurbatov, L.K.; Radko, S.P.; Kravchenko, S.V.; Kiseleva, O.I.; Durmanov, N.D.; Lisitsa, A.V. Single Stage Purification of CRISPR/Cas13a Nuclease via Metal-Chelating Chromatography Following Heterologous Expression with the Preservation of Collateral Ribonuclease Activity. Appl. Biochem. Microbiol. 2020, 56, 671–677. [Google Scholar] [CrossRef]
- Kurbatov, L.K.; Radko, S.P.; Kmeleva, S.A.; Timoshenko, O.S.; Lysitsa, A.V. Standardization of Recombinant CRISPR/Cas13a-Nuclease Preparations by Using RNase A of Known Activity. Biomed. Chem. Res. Meth. 2022, 5, e00177. [Google Scholar] [CrossRef]






| Oligonucleotide Name | Oligonucleotide Sequence (5′ → 3′) |
|---|---|
| P1-222 | aattctaatacgactcactatagggagaaggggttggccccggcagtctccta |
| P2 | cgatgcaacgcgaagaac |
| gRNA1 | gggauuuagaccaccccaaaaaugaaggggacuaaaacagaaacgugcagagaugugcgccccccaa |
| Specie | Host | Origin | Collection 1 | Strain Number | V0 Ratio 2 |
|---|---|---|---|---|---|
| Clavibacter sepedonicus | potato | USA | VKM | Ac-2753 | 1.00 ± 0.07 |
| Clavibacter sepedonicus | potato | USA | VKM | Ac-1405 | 0.94 ± 0.08 |
| Clavibacter michiganensis | tomato | Zambia | VKM | Ac-1144 | 0.05 ± 0.01 |
| Clavibacter michiganensis | tomato | USA | VKM | Ac-1403 | 0.04 ± 0.02 |
| Clavibacter phaseoli | common beans | Spain | VKM | Ac-2641 | 0.13 ± 0.02 |
| Clavibacter insidiosus | alfalfa | USA | VKM | Ac-1402T | 0.05 ± 0.01 |
| Clavibacter nebraskensis | maize | USA | VKM | Ac-1404T | 0.11 ± 0.02 |
| Clavibacter tesselarius | wheat | USA | VKM | Ac-1406T | 0.05 ± 0.02 |
| Dickeya zeae | maize | USA | DSMZ | DSM 18068 | 0.04 ± 0.01 |
| Dickeya chrysonthemi | Chrysanthemum morifolium | USA | DSMZ | DSM 4610 | 0.05 ± 0.02 |
| Dickeya paradisiaca | Musa paradisiaca | Colombia | IPO | 2127 | 0.09 ± 0.01 |
| Dickeya dadantii | Pelargonium capitatum | Comoros | DSMZ | DSM 18020 | 0.04 ± 0.02 |
| Dickeya dianthicola | Dianthus caryophyllus | United Kingdom | DSMZ | DSM 18054 | 0.03 ± 0.01 |
| Dickeya solani | potato | Russia | VNIIF | 1C3 | 0.04 ± 0.01 |
| Pectobacterium versatile | potato | Russia | VKM | B-3416 | 0.05 ± 0.02 |
| Pectobacterium aquaticum | potato | Russia | VKM | B-3417 | 0.04 ± 0.02 |
| Pectobacterium polaris | potato | Russia | VKM | B-3420 | 0.03 ± 0.01 |
| Pectobacterium parmentieri | potato | Russia | VKM | B-3423 | 0.05 ± 0.02 |
| Pectobacterium carotovorum | potato | Denmark | VKM | B-1247 | 0.03 ± 0.02 |
| Pectobacterium brasiliensis | potato | Russia | VKM | B-3424 | 0.03 ± 0.01 |
| Pectobacterium brasiliensis | potato | Russia | VKM | B-3425 | 0.04 ± 0.02 |
| Pectobacterium odoriferum | potato | Russia | VNIIF | 1557 | 0.03 ± 0.01 |
| Agrobacterium tumefaciens | undefined | USA | VKM | B-1573 | 0.07 ± 0.01 |
| Escherichia coli | clinical isolate | USA | VKM | B-3034 | 0.03 ± 0.01 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khmeleva, S.A.; Kurbatov, L.K.; Ptitsyn, K.G.; Timoshenko, O.S.; Morozova, D.D.; Suprun, E.V.; Radko, S.P.; Lisitsa, A.V. Detection of Potato Pathogen Clavibacter sepedonicus by CRISPR/Cas13a Analysis of NASBA Amplicons. Int. J. Mol. Sci. 2024, 25, 12218. https://doi.org/10.3390/ijms252212218
Khmeleva SA, Kurbatov LK, Ptitsyn KG, Timoshenko OS, Morozova DD, Suprun EV, Radko SP, Lisitsa AV. Detection of Potato Pathogen Clavibacter sepedonicus by CRISPR/Cas13a Analysis of NASBA Amplicons. International Journal of Molecular Sciences. 2024; 25(22):12218. https://doi.org/10.3390/ijms252212218
Chicago/Turabian StyleKhmeleva, Svetlana A., Leonid K. Kurbatov, Konstantin G. Ptitsyn, Olga S. Timoshenko, Darya D. Morozova, Elena V. Suprun, Sergey P. Radko, and Andrey V. Lisitsa. 2024. "Detection of Potato Pathogen Clavibacter sepedonicus by CRISPR/Cas13a Analysis of NASBA Amplicons" International Journal of Molecular Sciences 25, no. 22: 12218. https://doi.org/10.3390/ijms252212218
APA StyleKhmeleva, S. A., Kurbatov, L. K., Ptitsyn, K. G., Timoshenko, O. S., Morozova, D. D., Suprun, E. V., Radko, S. P., & Lisitsa, A. V. (2024). Detection of Potato Pathogen Clavibacter sepedonicus by CRISPR/Cas13a Analysis of NASBA Amplicons. International Journal of Molecular Sciences, 25(22), 12218. https://doi.org/10.3390/ijms252212218

