Role of DDR1 in Regulating MMPs in External Root Resorption
Abstract
1. Introduction
2. Results
2.1. Higher Levels of DDR1, MMP-1, MMP-2, and MMP-13 Expression Induced by ERR In Vivo
2.2. Lowered MMP-1, MMP-2, and MMP-13 Expression Caused by DDR1 Knockdown in hPDLCs
2.3. Differential Expression Analysis and KEGG Pathway Enrichment Analysis of RNA-seq
2.4. Decreased PI3K/Akt and Smad2/3 Expression Caused by DDR1 Knockdown in hPDLCs
2.5. Effects of DDR1 on MMP-1 Expression via the Smad2/3, MEK-ERK1/2, and PI3K/Akt Signaling Pathways
2.6. Effects of DDR1 on MMP-2 Expression via the Smad2/3 Signaling Pathway and MMP-13 Expression via the MEK-ERK1/2 and PI3K/Akt Signaling Pathways
3. Discussion
4. Materials and Methods
4.1. External Root Resorption Models in Rabbits
4.2. Micro-Computed Tomography (Micro-CT)
4.3. Immunohistochemistry (IHC)
4.4. High-Throughput RNA Sequencing
4.5. Cell Culture and Grouping
4.6. RNA Interference
4.7. RNA Extraction and RT-qPCR
4.8. ELISA
4.9. Western Blotting
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hannas, A.R.; Pereira, J.C.; Granjeiro, J.M.; Tjäderhane, L. The Role of Matrix Metalloproteinases in the Oral Environment. Acta Odontol. Scand. 2007, 65, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Heboyan, A.; Avetisyan, A.; Karobari, M.I.; Marya, A.; Khurshid, Z.; Rokaya, D.; Zafar, M.S.; de Oliviera Fernandes, G.V. Tooth Root Resorption: A Review. Sci. Prog. 2022, 105, 368504221109217. [Google Scholar] [CrossRef] [PubMed]
- Patel, S.; Saberi, N.; Pimental, T.; Teng, P.-H. Present Status and Future Directions: Root Resorption. Int. Endod. J. 2022, 55 (Suppl. S4), 892–921. [Google Scholar] [CrossRef] [PubMed]
- Evrosimovska, B.; Dimova, C.; Kovacevska, I.; Panov, S. Concentration of Collagenases (MMP-1, -8, -13) in Patients with Chronically Inflamed Dental Pulp Tissue. Prilozi 2012, 33, 191–204. [Google Scholar]
- Sapna, G.; Gokul, S.; Bagri-Manjrekar, K. Matrix Metalloproteinases and Periodontal Diseases. Oral Dis. 2014, 20, 538–550. [Google Scholar] [CrossRef]
- da Silva Lima, T.C.; Amaro, R.G.; Dos Santos, L.C.M.; Coste, S.C.; Silva, E.F.E.; Barbato-Ferreira, D.A.; Colosimo, E.A.; da Silva, T.A.; Bastos, J.V. Expression of Matrix Metalloproteinases 2 and 9 in Replanted Teeth with External Root Resorption: A Cross-Sectional Study. Arch. Oral Biol. 2021, 129, 105194. [Google Scholar] [CrossRef]
- Vincenti, M.P.; Brinckerhoff, C.E. Transcriptional Regulation of Collagenase (MMP-1, MMP-13) Genes in Arthritis: Integration of Complex Signaling Pathways for the Recruitment of Gene-Specific Transcription Factors. Arthritis Res. Ther. 2002, 4, 157. [Google Scholar] [CrossRef]
- Luchian, I.; Goriuc, A.; Sandu, D.; Covasa, M. The Role of Matrix Metalloproteinases (MMP-8, MMP-9, MMP-13) in Periodontal and Peri-Implant Pathological Processes. Int. J. Mol. Sci. 2022, 23, 1806. [Google Scholar] [CrossRef]
- Wang, Y.; Han, B.; Liu, K.; Wang, X. Effects of DDR1 on Migration and Adhesion of Periodontal Ligament Cells and the Underlying Mechanism. J. Periodontal Res. 2022, 57, 568–577. [Google Scholar] [CrossRef]
- Chang, Y.-C.; Yang, S.-F.; Lai, C.-C.; Liu, J.-Y.; Hsieh, Y.-S. Regulation of Matrix Metalloproteinase Production by Cytokines, Pharmacological Agents and Periodontal Pathogens in Human Periodontal Ligament Fibroblast Cultures. J. Periodontal Res. 2002, 37, 196–203. [Google Scholar] [CrossRef]
- El-Awady, A.R.; Lapp, C.A.; Gamal, A.Y.; Sharawy, M.M.; Wenger, K.H.; Cutler, C.W.; Messer, R.L.W. Human Periodontal Ligament Fibroblast Responses to Compression in Chronic Periodontitis. J. Clin. Periodontol. 2013, 40, 661–671. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Fu, Y.; Yao, S.; Huang, L. Programmed Cell Death of Periodontal Ligament Cells. J. Cell. Physiol. 2023, 238, 1768–1787. [Google Scholar] [CrossRef] [PubMed]
- Orgel, J.P.R.O.; Madhurapantula, R.S. A Structural Prospective for Collagen Receptors Such as DDR and Their Binding of the Collagen Fibril. Biochim. Biophys. Acta Mol. Cell Res. 2019, 1866, 118478. [Google Scholar] [CrossRef] [PubMed]
- Ma, R.; Xie, X.; Zhao, L.; Wu, Y.; Wang, J. Discoidin Domain Receptors (DDRs): Potential Implications in Periodontitis. J. Cell. Physiol. 2022, 237, 189–198. [Google Scholar] [CrossRef]
- Attur, M.; Yang, Q.; Kirsch, T.; Abramson, S.B. Role of Periostin and Discoidin Domain Receptor-1 (DDR1) in the Regulation of Cartilage Degeneration and Expression of MMP-13. Osteoarthr. Cartil. 2016, 24, S156. [Google Scholar] [CrossRef][Green Version]
- Li, W.; Ping, Z.; Xuemei, G.; Hongjuan, M.; Yi, H.; Xiaoli, L.; Zhongxiang, Z. Chlorogenic Acid Regulates the Proliferation and Migration of High-Grade Serous Ovarian Cancer Cells through Modulating the miR199a5p/DDR1 Axis. Acta Biochim. Pol. 2022, 69, 855–864. [Google Scholar] [CrossRef]
- Lee, J.-H.; Poudel, B.; Ki, H.-H.; Nepali, S.; Lee, Y.-M.; Shin, J.-S.; Kim, D.-K. Complement C1q Stimulates the Progression of Hepatocellular Tumor through the Activation of Discoidin Domain Receptor 1. Sci. Rep. 2018, 8, 4908. [Google Scholar] [CrossRef]
- Ferri, N.; Carragher, N.O.; Raines, E.W. Role of Discoidin Domain Receptors 1 and 2 in Human Smooth Muscle Cell-Mediated Collagen Remodeling: Potential Implications in Atherosclerosis and Lymphangioleiomyomatosis. Am. J. Pathol. 2004, 164, 1575–1585. [Google Scholar] [CrossRef]
- Van Doren, S.R. Matrix Metalloproteinase Interactions with Collagen and Elastin. Matrix Biol. J. Int. Soc. Matrix Biol. 2015, 44–46, 224–231. [Google Scholar] [CrossRef]
- Park, H.S.; Kim, K.R.; Lee, H.J.; Choi, H.N.; Kim, D.K.; Kim, B.T.; Moon, W.S. Overexpression of Discoidin Domain Receptor 1 Increases the Migration and Invasion of Hepatocellular Carcinoma Cells in Association with Matrix Metalloproteinase. Oncol. Rep. 2007, 18, 1435–1441. [Google Scholar] [CrossRef]
- Chavez, M.B.; Kolli, T.N.; Tan, M.H.; Zachariadou, C.; Wang, C.; Embree, M.C.; Lira Dos Santos, E.J.; Nociti, F.H.; Wang, Y.; Tatakis, D.N.; et al. Loss of Discoidin Domain Receptor 1 Predisposes Mice to Periodontal Breakdown. J. Dent. Res. 2019, 98, 1521–1531. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Raynal, N.; Stathopoulos, S.; Myllyharju, J.; Farndale, R.W.; Leitinger, B. Collagen Binding Specificity of the Discoidin Domain Receptors: Binding Sites on Collagens II and III and Molecular Determinants for Collagen IV Recognition by DDR1. Matrix Biol. 2011, 30, 16–26. [Google Scholar] [CrossRef] [PubMed]
- Matada, G.S.P.; Das, A.; Dhiwar, P.S.; Ghara, A. DDR1 and DDR2: A Review on Signaling Pathway and Small Molecule Inhibitors as an Anticancer Agent. Med. Chem. Res. 2021, 30, 535–551. [Google Scholar] [CrossRef]
- Mariadoss, A.V.A.; Wang, C.-Z. Exploring the Cellular and Molecular Mechanism of Discoidin Domain Receptors (DDR1 and DDR2) in Bone Formation, Regeneration, and Its Associated Disease Conditions. Int. J. Mol. Sci. 2023, 24, 14895. [Google Scholar] [CrossRef]
- Wang, C.-Z.; Yeh, Y.-C.; Tang, M.-J. DDR1/E-Cadherin Complex Regulates the Activation of DDR1 and Cell Spreading. Am. J. Physiol.-Cell Physiol. 2009, 297, C419–C429. [Google Scholar] [CrossRef]
- Chew, J.R.J.; Tan, B.L.; Lu, J.X.; Tong, H.J.; Duggal, M.S. Cell-Based Therapy for Tooth Replantation Following Avulsion: A Systematic Review. Tissue Eng. Part. B Rev. 2022, 28, 351–363. [Google Scholar] [CrossRef]
- Mittal, R.; Patel, A.P.; Debs, L.H.; Nguyen, D.; Patel, K.; Grati, M.; Mittal, J.; Yan, D.; Chapagain, P.; Liu, X.Z. Intricate Functions of Matrix Metalloproteinases in Physiological and Pathological Conditions. J. Cell. Physiol. 2016, 231, 2599–2621. [Google Scholar] [CrossRef]
- Triantafilou, M.; Triantafilou, K. Lipopolysaccharide Recognition: CD14, TLRs and the LPS-Activation Cluster. Trends Immunol. 2002, 23, 301–304. [Google Scholar] [CrossRef]
- Akira, S.; Takeda, K. Toll-like Receptor Signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef]
- Haffajee, A.D.; Socransky, S.S. Microbial Etiological Agents of Destructive Periodontal Diseases. Periodontology 2000 1994, 5, 78–111. [Google Scholar] [CrossRef]
- Coats, S.R.; Reife, R.A.; Bainbridge, B.W.; Pham, T.T.-T.; Darveau, R.P. Porphyromonas Gingivalis Lipopolysaccharide Antagonizes Escherichia Coli Lipopolysaccharide at Toll-like Receptor 4 in Human Endothelial Cells. Infect. Immun. 2003, 71, 6799–6807. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.-S.; Shin, S.-I.; Kang, K.-L.; Chung, J.-H.; Herr, Y.; Bae, W.-J.; Kim, E.-C. Nicotine and Lipopolysaccharide Stimulate the Production of MMPs and Prostaglandin E2 by Hypoxia-Inducible Factor-1α up-Regulation in Human Periodontal Ligament Cells. J. Periodontal Res. 2012, 47, 719–728. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.; Lu, G.; Li, Q.; Zhang, J.; Huang, Z.; Gao, X. Selenium Modulates MMP2 Expression through the TGFβ1/Smad Signalling Pathway in Human Umbilical Vein Endothelial Cells and Rabbits Following Lipid Disturbance. J. Trace Elem. Med. Biol. 2017, 42, 59–67. [Google Scholar] [CrossRef] [PubMed]
- Wilmink, M.; Spalinger, M.R. SKAP2—A Molecule at the Crossroads for Integrin Signalling and Immune Cell Migration and Function. Biomedicines 2023, 11, 2788. [Google Scholar] [CrossRef]
- Zeng, L.; Rong, X.-F.; Li, R.-H.; Wu, X.-Y. Icariin Inhibits MMP-1, MMP-3 and MMP-13 Expression through MAPK Pathways in IL-1β-stimulated SW1353 Chondrosarcoma Cells. Mol. Med. Rep. 2017, 15, 2853–2858. [Google Scholar] [CrossRef]
- Acosta-Martinez, M.; Cabail, M.Z. The PI3K/Akt Pathway in Meta-Inflammation. Int. J. Mol. Sci. 2022, 23, 15330. [Google Scholar] [CrossRef]
- Xiong, B.; Song, F.-X.; Chen, H.-L.; Wang, X.-J.; Jin, Z.-X.; Han, T.-Y.; Li, Y.; Zhang, D.-K. Discoidin Domain Receptor 1a (DDR1a) Confers 5-Fluorouracil Cytotoxicity in LoVo Cell via PI3K/AKT/Bcl-2 Pathway. Bioengineered 2022, 13, 9805–9814. [Google Scholar] [CrossRef]
- Chappell, W.H.; Candido, S.; Abrams, S.L.; Akula, S.M.; Steelman, L.S.; Martelli, A.M.; Ratti, S.; Cocco, L.; Cervello, M.; Montalto, G.; et al. Influences of TP53 and the Anti-Aging DDR1 Receptor in Controlling Raf/MEK/ERK and PI3K/Akt Expression and Chemotherapeutic Drug Sensitivity in Prostate Cancer Cell Lines. Aging 2020, 12, 10194–10210. [Google Scholar] [CrossRef]
- Leask, A. CCN2: A Novel, Specific and Valid Target for Anti-Fibrotic Drug Intervention. Expert Opin. Ther. Targets 2013, 17, 1067–1071. [Google Scholar] [CrossRef]
- Zaykov, V.; Chaqour, B. The CCN2/CTGF Interactome: An Approach to Understanding the Versatility of CCN2/CTGF Molecular Activities. J. Cell Commun. Signal 2021, 15, 567–580. [Google Scholar] [CrossRef]
- Samarin, J.; Cicha, I.; Goppelt-Struebe, M. Cell Type-Specific Regulation of CCN2 Protein Expression by PI3K-AKT-FoxO Signaling. J. Cell Commun. Signal 2009, 3, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Samarin, J.; Rehm, M.; Krueger, B.; Waschke, J.; Goppelt-Struebe, M. Up-Regulation of Connective Tissue Growth Factor in Endothelial Cells by the Microtubule-Destabilizing Agent Combretastatin A-4. Mol. Cancer Res. 2009, 7, 180–188. [Google Scholar] [CrossRef] [PubMed]
- Daly, C.; Wong, V.; Burova, E.; Wei, Y.; Zabski, S.; Griffiths, J.; Lai, K.-M.; Lin, H.C.; Ioffe, E.; Yancopoulos, G.D.; et al. Angiopoietin-1 Modulates Endothelial Cell Function and Gene Expression via the Transcription Factor FKHR (FOXO1). Genes Dev. 2004, 18, 1060–1071. [Google Scholar] [CrossRef] [PubMed]
- Bujor, A.M.; Nakerakanti, S.; Morris, E.; Hant, F.N.; Trojanowska, M. Akt Inhibition Up-Regulates MMP1 through a CCN2-Dependent Pathway in Human Dermal Fibroblasts. Exp. Dermatol. 2010, 19, 347–354. [Google Scholar] [CrossRef] [PubMed]
- Daniels, J.T.; Schultz, G.S.; Blalock, T.D.; Garrett, Q.; Grotendorst, G.R.; Dean, N.M.; Khaw, P.T. Mediation of Transforming Growth Factor-Beta(1)-Stimulated Matrix Contraction by Fibroblasts: A Role for Connective Tissue Growth Factor in Contractile Scarring. Am. J. Pathol. 2003, 163, 2043–2052. [Google Scholar] [CrossRef]
- Kondo, S.; Kubota, S.; Shimo, T.; Nishida, T.; Yosimichi, G.; Eguchi, T.; Sugahara, T.; Takigawa, M. Connective Tissue Growth Factor Increased by Hypoxia May Initiate Angiogenesis in Collaboration with Matrix Metalloproteinases. Carcinogenesis 2002, 23, 769–776. [Google Scholar] [CrossRef]
- Wang, K.; Zheng, J.; Yu, J.; Wu, Y.; Guo, J.; Xu, Z.; Sun, X. Knockdown of MMP-1 Inhibits the Progression of Colorectal Cancer by Suppressing the PI3K/Akt/C-myc Signaling Pathway and EMT. Oncol. Rep. 2020, 43, 1103–1112. [Google Scholar] [CrossRef]
- Olwal, C.O.; Fabius, J.M.; Zuliani-Alvarez, L.; Eckhardt, M.; Kyei, G.B.; Quashie, P.K.; Krogan, N.J.; Bouhaddou, M.; Bediako, Y. Network Modeling Suggests HIV Infection Phenocopies PI3K-AKT Pathway Mutations to Enhance HPV-Associated Cervical Cancer. Mol. Omics 2023, 19, 538–551. [Google Scholar] [CrossRef]
- Zare, Z.; Dizaj, T.N.; Lohrasbi, A.; Sheikhalishahi, Z.S.; Asadi, A.; Zakeri, M.; Hosseinabadi, F.; Abazari, O.; Abbasi, M.; Khanicheragh, P. Silibinin Inhibits TGF-β-Induced MMP-2 and MMP-9 Through Smad Signaling Pathway in Colorectal Cancer HT-29 Cells. Clin. Cancer Res. 2020, 12, 81–90. [Google Scholar] [CrossRef]
- Chen, G.-Y.; Chen, J.-Q.; Liu, X.-Y.; Xu, Y.; Luo, J.; Wang, Y.-F.; Zhou, T.-L.; Yan, Z.-R.; Zhou, L.; Tao, Q.-W. Total Flavonoids of Rhizoma Drynariae Restore the MMP/TIMP Balance in Models of Osteoarthritis by Inhibiting the Activation of the NF-κB and PI3K/AKT Pathways. Evid. Based Complement. Altern. Med. 2021, 2021, 6634837. [Google Scholar] [CrossRef]
- Carpio, L.R.; Bradley, E.W.; Westendorf, J.J. Histone Deacetylase 3 Suppresses Erk Phosphorylation and Matrix Metalloproteinase (Mmp)-13 Activity in Chondrocytes. Connect. Tissue Res. 2017, 58, 27–36. [Google Scholar] [CrossRef] [PubMed]
- Hough, C.; Radu, M.; Doré, J.J.E. TGF-Beta Induced Erk Phosphorylation of Smad Linker Region Regulates Smad Signaling. PLoS ONE 2012, 7, e42513. [Google Scholar] [CrossRef] [PubMed]
- Barter, M.J.; Pybus, L.; Litherland, G.J.; Rowan, A.D.; Clark, I.M.; Edwards, D.R.; Cawston, T.E.; Young, D.A. HDAC-Mediated Control of ERK- and PI3K-Dependent TGF-β-Induced Extracellular Matrix-Regulating Genes. Matrix Biol. 2010, 29, 602–612. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Wang, X.-F. Signaling Cross-Talk between TGF-β/BMP and Other Pathways. Cell Res. 2009, 19, 71–88. [Google Scholar] [CrossRef] [PubMed]
- Morikawa, M.; Derynck, R.; Miyazono, K. TGF-β and the TGF-β Family: Context-Dependent Roles in Cell and Tissue Physiology. Cold Spring Harb. Perspect. Biol. 2016, 8, a021873. [Google Scholar] [CrossRef] [PubMed]
- ten Dijke, P.; Hill, C.S. New Insights into TGF-β–Smad Signalling. Trends Biochem. Sci. 2004, 29, 265–273. [Google Scholar] [CrossRef]
- Chen, W.; Frank, M.E.; Jin, W.; Wahl, S.M. TGF-β Released by Apoptotic T Cells Contributes to an Immunosuppressive Milieu. Immunity 2001, 14, 715–725. [Google Scholar] [CrossRef]
- Kim, H.; Baker, J.B.; Lee, S.-U.; Park, Y.; Bolduc, K.L.; Park, H.-B.; Dickens, M.G.; Lee, D.-S.; Kim, Y.; Kim, S.H.; et al. Stereoselective Synthesis and Osteogenic Activity of Subglutinols A and B. J. Am. Chem. Soc. 2009, 131, 3192–3194. Available online: https://pubs.acs.org/doi/abs/10.1021/ja8101192 (accessed on 23 October 2024). [CrossRef]
- Su, H.; Yang, F.; Fu, R.; Trinh, B.; Sun, N.; Liu, J.; Kumar, A.; Baglieri, J.; Siruno, J.; Le, M.; et al. Collagenolysis-Dependent DDR1 Signalling Dictates Pancreatic Cancer Outcome. Nature 2022, 610, 366–372. [Google Scholar] [CrossRef]
- Li, R.; Xiao, L.; Gong, T.; Liu, J.; Li, Y.; Zhou, X.; Li, Y.; Zheng, X. Role of Oral Microbiome in Oral Oncogenesis, Tumor Progression, and Metastasis. Mol. Oral Microbiol. 2023, 38, 9–22. [Google Scholar] [CrossRef]
- Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated Genome Annotation and Pathway Identification Using the KEGG Orthology (KO) as a Controlled Vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Liu, K.; Hou, J. Extending the Vitamin D Pathway to Vitamin D3 and CYP27A1 in Periodontal Ligament Cells. J. Periodontol. 2020, 92, 44–53. [Google Scholar] [CrossRef] [PubMed]
- Gao, Z.; Liu, K.; Meng, H. Preliminary Investigation of the Vitamin D Pathway in Periodontal Connective Tissue Cells. J. Periodontol. 2018, 89, 294–302. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.; Han, B.; Hou, J.; Meng, H. Preliminary Investigation on the Molecular Mechanisms Underlying the Correlation between VDR-FokI Genotype and Periodontitis. J. Periodontol. 2020, 91, 403–412. [Google Scholar] [CrossRef]
- Chen, T.; Chen, X.; Zhang, S.; Zhu, J.; Tang, B.; Wang, A.; Dong, L.; Zhang, Z.; Yu, C.; Sun, Y.; et al. The Genome Sequence Archive Family: Toward Explosive Data Growth and Diverse Data Types. Genom. Proteom. Bioinform. 2021, 19, 578–583. [Google Scholar] [CrossRef]
- CNCB-NGDC Members and Partners Database Resources of the National Genomics Data Center, China National Center for Bioinformation in 2024. Nucleic Acids Res. 2024, 52, D18–D32. [CrossRef]
Group | Treatment |
---|---|
Blank | Cells without any treatment |
Negative control (NC) | Cells transfected with NC siRNA (siRNA nonhomologous to any known gene sequence) |
Knockdown (KD) | Cells transfected with DDR1 siRNA |
Negative control + LPS (NC + LPS) | Cells transfected with NC siRNA and stimulated with LPS derived from P. gingivalis (Pg-LPS; 10 μg/mL; Sigma-Aldrich, St. Louis, MO, USA) for 24 h |
Knockdown + LPS (KD + LPS) | Cells transfected with DDR1 siRNA and stimulated with Pg-LPS for 24 h |
Group | Treatment |
---|---|
Blank + DMSO | Pre-treated with DMSO |
Blank + DMSO + LPS | Pre-treated with DMSO and treated with Pg-LPS |
PD98059 + LPS | Pre-treated with PD98059 at the concentration of 20 µM and treated with Pg-LPS |
PD98059 + LPS + NC | Pre-treated with PD98059 and treated with NC siRNA and Pg-LPS |
PD98059 + LPS + KD | Pre-treated with PD98059 and treated with DDR1 siRNA and Pg-LPS |
MK2206 | Pre-treated with Akt inhibitor (MK2206) at a concentration of 10 µM for 24 h |
MK2206 + LPS | Pre-treated with MK2206 and treated with Pg-LPS |
MK2206 + LPS + NC | Pre-treated with MK2206 and treated with NC siRNA and Pg-LPS |
MK2206 + LPS + KD | Pre-treated with MK2206 and treated with DDR1 siRNA and Pg-LPS |
LY294002 | Pre-treated with PI3K inhibitor (LY294002) at a concentration of 12 µM for 24 h |
LY294002 + LPS | Pre-treated with LY294002 and treated with Pg-LPS |
LY294002 + LPS + NC | Pre-treated with LY294002 and treated with NC siRNA and Pg-LPS |
LY294002 + LPS + KD | Pre-treated with LY294002 and treated with DDR1 siRNA and Pg-LPS |
SIS3 + LPS | Pre-treated with SIS3 at a concentration of 10 μM and treated with Pg-LPS |
SIS3 + LPS + NC | Pre-treated with SIS3 and treated with NC siRNA and Pg-LPS |
SIS3 + LPS + KD | Pre-treated with SIS3 and treated with DDR1 siRNA and Pg-LPS |
SB431542 + LPS | Pre-treated with SB431542 at a concentration of 10 μM and treated with Pg-LPS |
SB431542 + LPS + NC | Pre-treated with SB431542 and treated with NC siRNA and Pg-LPS |
SB431542 + LPS + KD | Pre-treated with SB431542 and treated with DDR1 siRNA and Pg-LPS |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Size of Amplified Products |
---|---|---|---|
DDR1 | AAGGGACATTTTGATCCTGCC | CCTTGGGAAACACCGACCC | 181 bp |
MMP-1 | AAAATTACACGCCAGATTTGCC | GGTGTGACATTACTCCAGAGTTG | 82 bp |
MMP-2 | TACAGGATCATTGGCTACACACC | GGTCACATCGCTCCAGACT | 90 bp |
MMP-13 | ACTGAGAGGCTCCGAGAAATG | GAACCCCGCATCTTGGCTT | 103 bp |
PI3K | TATTTGGACTTTGCGACAAGACT | TCGAACGTACTGGTCTGGATAG | 190 bp |
Akt | AGCGACGTGGCTATTGTGAAG | GCCATCATTCTTGAGGAGGAAGT | 96 bp |
CCN2 | AAAAGTGCATCCGTACTCCCA | CCGTCGGTACATACTCCACAG | 109 bp |
Smad2 | CCGACACACCGAGATCCTAAC | GAGGTGGCGTTTCTGGAATATAA | 125 bp |
Smad3 | GCGTGCGGCTCTACTACATC | GCACATTCGGGTCAACTGGTA | 233 bp |
GAPDH | GAAGGTGAAGGTCGGAGTC | GAAGATGGTGATGGGATTTC | 226 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Han, B.; Tian, H.; Liu, K.; Wang, X. Role of DDR1 in Regulating MMPs in External Root Resorption. Int. J. Mol. Sci. 2024, 25, 12111. https://doi.org/10.3390/ijms252212111
Wang Y, Han B, Tian H, Liu K, Wang X. Role of DDR1 in Regulating MMPs in External Root Resorption. International Journal of Molecular Sciences. 2024; 25(22):12111. https://doi.org/10.3390/ijms252212111
Chicago/Turabian StyleWang, Yuhan, Bing Han, Hongyan Tian, Kaining Liu, and Xiaoyan Wang. 2024. "Role of DDR1 in Regulating MMPs in External Root Resorption" International Journal of Molecular Sciences 25, no. 22: 12111. https://doi.org/10.3390/ijms252212111
APA StyleWang, Y., Han, B., Tian, H., Liu, K., & Wang, X. (2024). Role of DDR1 in Regulating MMPs in External Root Resorption. International Journal of Molecular Sciences, 25(22), 12111. https://doi.org/10.3390/ijms252212111