Dennd2c Negatively Controls Multinucleation and Differentiation in Osteoclasts by Regulating Actin Polymerization and Protrusion Formation
Abstract
:1. Introduction
2. Results
2.1. Expression of Dennd2c Alters During Osteoclast Differentiation
2.2. Knockdown of Dennd2c Enhances Multinucleation and Differentiation in Osteoclasts
2.3. Dennd2c Knockdown Markedly Increases Marker Gene Expression in Osteoclasts
2.4. Dennd2c Knockdown Enhances the Resorption Activity of Osteoclasts
2.5. Dennd2c Knockdown Induces Larger Osteoclast Formation with Several Protrusions Containing LAMP2-Positive Compartments
2.6. Overexpression of Dennd2c Inhibits the Multinucleated Formation and Differentiation in Osteoclasts
2.7. Dennd2c Overexpression Markedly Reduces Marker Gene Expression in Osteoclasts
2.8. Dennd2c-Overexpressing Cells Form Spindle-Shape and Long and Thin Protrusions
2.9. Effects of Cytoskeleton-Related Inhibitors on the Multinucleation and Protrusion Formation of Dennd2c-Overexpressing Cells
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Cell Culture
4.3. Retrovirus Construction and Overexpression of Dennd2c
4.4. Gene Knockdown by siRNA
4.5. Osteoclast Differentiation and Tartrate-Resistant Acid Phosphatase (TRAP) Staining
4.6. Western Blotting and Denstmetric Analysis
4.7. Quantitative (q) Real-Time PCR (qRT-PCR) Analysis
Dennd2c | forward: CACCCCACCGGGAACATGGATGTT reverse: TCACTTCTTGTGAAGAAATTTCATTTTACTTC |
Atp6v0a3 | forward: GCCTCAGGGGAAGGCCAGATCG reverse: GGCCACCTCTTCACTCCGGAA |
Ctsk | forward: CAGCTTCCCCAAGATGTGAT reverse: AGCACCAACGAGAGGAGAAA |
C-fos | forward: CCA GTC AAG AGC ATC AGC AA reverse: AAG TAG TGC AGC CCG GAG TA |
Dcstamp | forward: CTAGCTGGCTGGACTTCATCC reverse: TCATGCTGTCTAGGAGACCTC |
Ocstamp | forward: TGGGCCTCCATATGACCTCGAGTAG reverse: TCAAAGGCTTGTAAATTGGAGGAGT |
RelA | forward: GCGTACACATTCTGGGGAGT reverse: GTTAATGCTCCTGCGAAAGC |
Src | forward: AGAGTGCTGAGCGACCTGTGT reverse: GCAGAGATGCTGCCTT-GGTT |
4.8. Immunofluorescence Microscopy
4.9. Bone Resorption Assay
4.10. Phase Contrast Microscopy
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kylmaoja, E.; Nakamura, M.; Tuukkanen, J. Osteoclasts and Remodeling Based Bone Formation. Curr. Stem Cell Res. Ther. 2016, 11, 626–633. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Kim, N. Signaling Pathways in Osteoclast Differentiation. Chonnam Med. J. 2016, 52, 12–17. [Google Scholar] [CrossRef] [PubMed]
- Touaitahuata, H.; Blangy, A.; Vives, V. Modulation of osteoclast differentiation and bone resorption by Rho GTPases. Small GTPases 2014, 5, e28119. [Google Scholar] [CrossRef] [PubMed]
- Bement, W.M.; Goryachev, A.B.; Miller, A.L.; von Dassow, G. Patterning of the cell cortex by Rho GTPases. Nat. Rev. Mol. Cell Biol. 2024, 25, 290–308. [Google Scholar] [CrossRef]
- Roy, M.; Roux, S. Rab GTPases in Osteoclastic Endomembrane. Systems Biomed. Res. Int. 2018, 4541538. [Google Scholar] [CrossRef]
- Ng, P.Y.; Brigitte Patricia Ribet, A.; Pavlos, N.J. Membrane trafficking in osteoclasts and implications for osteoporosis. Biochem. Soc. Trans. 2019, 47, 639–650. [Google Scholar] [CrossRef]
- Pavlos, N.J.; Xu, J.; Riedel, D.; Yeoh, J.S.; Teitelbaum, S.L.; Papadimitriou, J.M.; Jahn, R.; Ross, F.P.; Zheng, M.H. Rab3D regulates a novel vesicular trafficking pathway that is required for osteoclastic bone resorption. Mol. Cell. Biol. 2005, 25, 5253–5269. [Google Scholar] [CrossRef]
- Zhu, S.; Chim, S.M.; Cheng, T.; Ang, E.; Ng, B.; Lim, B.; Chen, K.; Qiu, H.; Tickner, J.; Xu, H.; et al. Calmodulin interacts with Rab3D and modulates osteoclastic bone resorption. Sci. Rep. 2016, 6, 37963. [Google Scholar] [CrossRef]
- Okusha, Y.; Tran, M.T.; Itagaki, M.; Sogawa, C.; Eguchi, T.; Okui, T.; Kadowaki, T.; Sakai, E.; Tsukuba, T.; Okamoto, K. Rab11A Functions as a Negative Regulator of Osteoclastogenesis through Dictating Lysosome-Induced Proteolysis of c-fms and RANK Surface Receptors. Cells 2020, 9, 2384. [Google Scholar] [CrossRef]
- Tran, M.T.; Okusha, Y.; Feng, Y.; Morimatsu, M.; Wei, P.; Sogawa, C.; Eguchi, T.; Kadowaki, T.; Sakai, E.; Okamura, H.; et al. The Inhibitory Role of Rab11b in Osteoclastogenesis through Triggering Lysosome-Induced Degradation of c-Fms and RANK Surface Receptors. Int. J. Mol. Sci. 2020, 21, 9352. [Google Scholar] [CrossRef]
- Shimada-Sugawara, M.; Sakai, E.; Okamoto, K.; Fukuda, M.; Izumi, T.; Yoshida, N.; Tsukuba, T. Rab27A regulates transport of cell surface receptors modulating multinucleation and lysosome-related organelles in osteoclasts. Sci. Rep. 2015, 5, 9620. [Google Scholar] [CrossRef] [PubMed]
- Noda, K.; Lu, S.L.; Chen, S.; Tokuda, K.; Li, Y.; Hao, F.; Wada, Y.; Sun-Wada, G.H.; Murakami, S.; Fukuda, M.; et al. Characterization of Rab32- and Rab38-positive lysosome-related organelles in osteoclasts and macrophages. J. Biol. Chem. 2023, 299, 105191. [Google Scholar] [CrossRef] [PubMed]
- Tokuda, K.; Lu, S.L.; Zhang, Z.; Kato, Y.; Chen, S.; Noda, K.; Hirose, K.; Usami, Y.; Uzawa, N.; Murakami, S.; et al. Rab32 and Rab38 maintain bone homeostasis by regulating intracellular traffic in osteoclasts. Cell Struct. Funct. 2023, 48, 223–239. [Google Scholar] [CrossRef]
- Feng, Y.; Tran, M.T.; Lu, Y.; Htike, K.; Okusha, Y.; Sogawa, C.; Eguchi, T.; Kadowaki, T.; Sakai, E.; Tsukuba, T.; et al. Rab34 plays a critical role as a bidirectional regulator of osteoclastogenesis. Cell Biochem. Funct. 2022, 40, 263–277. [Google Scholar] [CrossRef]
- Yamaguchi, Y.; Sakai, E.; Okamoto, K.; Kajiya, H.; Okabe, K.; Naito, M.; Kadowaki, T.; Tsukuba, T. Rab44, a novel large Rab GTPase, negatively regulates osteoclast differentiation by modulating intracellular calcium levels followed by NFATc1 activation. Cell. Mol. Life Sci. CMLS 2018, 75, 33–48. [Google Scholar] [CrossRef] [PubMed]
- Wada, M.; Nakanishi, H.; Satoh, A.; Hirano, H.; Obaishi, H.; Matsuura, Y.; Takai, Y. Isolation and characterization of a GDP/GTP exchange protein specific for the Rab3 subfamily small G proteins. J. Biol. Chem. 1997, 272, 3875–3878. [Google Scholar] [CrossRef] [PubMed]
- Marat, A.L.; Dokainish, H.; McPherson, P.S. DENN domain proteins: Regulators of Rab GTPases. J. Biol. Chem. 2011, 286, 13791–13800. [Google Scholar] [CrossRef]
- Ishida, M.; Oguch, M.E.; Fukuda, M. Multiple Types of Guanine Nucleotide Exchange Factors (GEFs) for Rab Small GTPases. Cell Struct. Funct. 2016, 41, 61–79. [Google Scholar] [CrossRef]
- Yoshimura, S.; Gerondopoulos, A.; Linford, A.; Rigden, D.J.; Barr, F.A. Family-wide characterization of the DENN domain Rab GDP-GTP exchange factors. J. Cell Biol. 2010, 191, 367–381. [Google Scholar] [CrossRef]
- Wu, X.; Bradley, M.J.; Cai, Y.; Kümmel, D.; De La Cruz, E.M.; Barr, F.A.; Reinisch, K.M. Insights regarding guanine nucleotide exchange from the structure of a DENN-domain protein complexed with its Rab GTPase substrate. Proc. Natl. Acad. Sci. USA 2011, 108, 18672–18677. [Google Scholar] [CrossRef]
- Motta Gda, R.; Amaral, M.V.; Rezende, E.; Pitta, R.; Vieira, T.C.; Duarte, M.E.; Vieira, A.R.; Casado, P.L. Evidence of genetic variations associated with rotator cuff disease. J. Shoulder Elb. Surg. 2014, 23, 227–235. [Google Scholar] [CrossRef] [PubMed]
- Teerlink, C.C.; Cannon-Albright, L.A.; Tashjian, R.Z. Significant association of full-thickness rotator cuff tears and estrogen-related receptor-β (ESRRB). J. Shoulder Elb. Surg. 2015, 24, e31–e35. [Google Scholar] [CrossRef] [PubMed]
- Gayle, S.; Pan, Y.; Landrette, S.; Xu, T. piggyBac insertional mutagenesis screen identifies a role for nuclear RHOA in human ES cell differentiation. Stem Cell Rep. 2015, 4, 926–938. [Google Scholar] [CrossRef]
- Kumar, R.; Francis, V.; Kulasekaran, G.; Khan, M.; Armstrong, G.A.B.; McPherson, P.S. A cell-based GEF assay reveals new substrates for DENN domains and a role for DENND2B in primary ciliogenesis. Sci. Adv. 2022, 8, eabk3088. [Google Scholar] [CrossRef]
- Klinkert, K.; Echard, A. Rab35 GTPase: A Central Regulator of Phosphoinositides and F-actin in Endocytic Recycling and Beyond. Traffic 2016, 17, 1063–1077. [Google Scholar] [CrossRef]
- Chevallier, J.; Koop, C.; Srivastava, A.; Petrie, R.J.; Lamarche-Vane, N.; Presley, J.F. Rab35 regulates neurite outgrowth and cell shape. FEBS Lett. 2009, 583, 1096–1101. [Google Scholar] [CrossRef]
- Nakase, T.; Takeuchi, E.; Sugamoto, K.; Kaneko, M.; Tomita, T.; Myoui, A.; Uchiyama, Y.; Ochi, T.; Yoshikawa, H. Involvement of multinucleated giant cells synthesizing cathepsin K in calcified tendinitis of the rotator cuff tendons. Rheumatology 2000, 39, 1074–1077. [Google Scholar] [CrossRef] [PubMed]
- Sakai, E.; Shimada-Sugawara, M.; Nishishita, K.; Fukuma, Y.; Naito, M.; Okamoto, K.; Nakayama, K.; Tsukuba, T. Suppression of RANKL-dependent heme oxygenase-1 is required for high mobility group box 1 release and osteoclastogenesis. J. Cell Biochem. 2012, 113, 486–498. [Google Scholar] [CrossRef]
- Kukita, T.; Wada, N.; Kukita, A.; Kakimoto, T.; Sandra, F.; Toh, K.; Nagata, K.; Iijima, T.; Horiuchi, M.; Matsusaki, H.; et al. RANKL-induced DC-STAMP is essential for osteoclastogenesis. J. Exp. Med. 2004, 200, 941–946. [Google Scholar] [CrossRef]
- Watanabe, T.; Kukita, T.; Kukita, A.; Wada, N.; Toh, K.; Nagata, K.; Nomiyama, H.; Iijima, T. Direct stimulation of osteoclastogenesis by MIP-1alpha: Evidence obtained from studies using RAW264 cell clone highly responsive to RANKL. J. Endocrinol. 2004, 180, 193–201. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Koyanagi, Y.; Sakai, E.; Yamaguchi, Y.; Farhana, F.; Taira, Y.; Okamoto, K.; Murata, H.; Tsukuba, T. Dennd2c Negatively Controls Multinucleation and Differentiation in Osteoclasts by Regulating Actin Polymerization and Protrusion Formation. Int. J. Mol. Sci. 2024, 25, 11479. https://doi.org/10.3390/ijms252111479
Koyanagi Y, Sakai E, Yamaguchi Y, Farhana F, Taira Y, Okamoto K, Murata H, Tsukuba T. Dennd2c Negatively Controls Multinucleation and Differentiation in Osteoclasts by Regulating Actin Polymerization and Protrusion Formation. International Journal of Molecular Sciences. 2024; 25(21):11479. https://doi.org/10.3390/ijms252111479
Chicago/Turabian StyleKoyanagi, Yu, Eiko Sakai, Yu Yamaguchi, Fatima Farhana, Yohsuke Taira, Kuniaki Okamoto, Hiroshi Murata, and Takayuki Tsukuba. 2024. "Dennd2c Negatively Controls Multinucleation and Differentiation in Osteoclasts by Regulating Actin Polymerization and Protrusion Formation" International Journal of Molecular Sciences 25, no. 21: 11479. https://doi.org/10.3390/ijms252111479
APA StyleKoyanagi, Y., Sakai, E., Yamaguchi, Y., Farhana, F., Taira, Y., Okamoto, K., Murata, H., & Tsukuba, T. (2024). Dennd2c Negatively Controls Multinucleation and Differentiation in Osteoclasts by Regulating Actin Polymerization and Protrusion Formation. International Journal of Molecular Sciences, 25(21), 11479. https://doi.org/10.3390/ijms252111479