Novel Expression of Apical Bile Acid Transport (ASBT) More Proximally Than Distal Ileum Contributing to Enhanced Intestinal Bile Acid Absorption in Obesity
Abstract
1. Introduction
2. Results
2.1. Altered Bile Acid Absorption along the Length of the Small Intestine in the Zucker Rat Model of Obesity
2.2. Altered Expression of ASBT and Its Regulatory Protein mRNA Along the Length of the Small Intestine in the Zucker Rat Model of Obesity
3. Discussion
4. Materials and Methods
4.1. In Vivo Model of Obesity
4.2. Intestinal Segments and Mucosa Preparation
4.3. BBM Vesicle Preparation and 3H-Taurocholate Uptake Studies
4.4. Bile Acid Measurement
4.5. Real Time-Quantitative PCR (RT-qPCR) Analysis
4.6. Protein Quantification
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Thompson, D.; Wolf, A.M. The medical-care cost burden of obesity. Obes. Rev. 2001, 2, 189–197. [Google Scholar] [CrossRef] [PubMed]
- Bengmark, S. Obesity, the deadly quartet and the contribution of the neglected daily organ rest—A new dimension of un-health and its prevention. Hepatobiliary Surg. Nutr. 2015, 4, 278–288. [Google Scholar] [CrossRef] [PubMed]
- Hofmann, J.; Ardelt-Gattinger, E.; Paulmichl, K.; Weghuber, D.; Blechert, J. Dietary restraint and impulsivity modulate neural responses to food in adolescents with obesity and healthy adolescents. Obesity 2015, 23, 2183–2189. [Google Scholar] [CrossRef] [PubMed]
- Krueger, P.M.; Reither, E.N. Mind the Gap: Race/Ethnic and Socioeconomic Disparities in Obesity. Curr. Diab Rep. 2015, 15, 95. [Google Scholar] [CrossRef]
- Angkurawaranon, C.; Wisetborisut, A.; Rerkasem, K.; Seubsman, S.A.; Sleigh, A.; Doyle, P.; Nitsch, D. Early life urban exposure as a risk factor for developing obesity and impaired fasting glucose in later adulthood: Results from two cohorts in Thailand. BMC Public Health 2015, 15, 902. [Google Scholar] [CrossRef]
- Bays, H.; Scinta, W. Adiposopathy and Epigenetics: An Introduction to Obesity as a Transgenerational Disease. Curr. Med. Res. Opin. 2015, 31, 2059–2069. [Google Scholar] [CrossRef]
- Mansego, M.L.; Milagro, F.I.; Zulet, M.A.; Moreno-Aliaga, M.J.; Martinez, J.A. Differential DNA Methylation in Relation to Age and Health Risks of Obesity. Int. J. Mol. Sci. 2015, 16, 16816–16832. [Google Scholar] [CrossRef]
- Simopoulos, A.P. Characteristics of obesity: An overview. Ann. N. Y. Acad. Sci. 1987, 499, 4–13. [Google Scholar] [CrossRef]
- Watanabe, M.; Houten, S.M.; Mataki, C.; Christoffolete, M.A.; Kim, B.W.; Sato, H.; Messaddeq, N.; Harney, J.W.; Ezaki, O.; Kodama, T.; et al. Bile acids induce energy expenditure by promoting intracellular thyroid hormone activation. Nature 2006, 439, 484–489. [Google Scholar] [CrossRef]
- Boesjes, M.; Brufau, G. Metabolic effects of bile acids in the gut in health and disease. Curr. Med. Chem. 2014, 21, 2822–2829. [Google Scholar] [CrossRef]
- Cariou, B.; van Harmelen, K.; Duran-Sandoval, D.; van Dijk, T.H.; Grefhorst, A.; Abdelkarim, M.; Caron, S.; Torpier, G.; Fruchart, J.C.; Gonzalez, F.J.; et al. The farnesoid X receptor modulates adiposity and peripheral insulin sensitivity in mice. J. Biol. Chem. 2006, 281, 11039–11049. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Lee, F.Y.; Barrera, G.; Lee, H.; Vales, C.; Gonzalez, F.J.; Willson, T.M.; Edwards, P.A. Activation of the nuclear receptor FXR improves hyperglycemia and hyperlipidemia in diabetic mice. Proc. Natl. Acad. Sci. USA 2006, 103, 1006–1011. [Google Scholar] [CrossRef] [PubMed]
- Ma, K.; Saha, P.K.; Chan, L.; Moore, D.D. Farnesoid X receptor is essential for normal glucose homeostasis. J. Clin. Investig. 2006, 116, 1102–1109. [Google Scholar] [CrossRef] [PubMed]
- Ge, H.; Zhang, J.; Gong, Y.; Gupte, J.; Ye, J.; Weiszmann, J.; Samayoa, K.; Coberly, S.; Gardner, J.; Wang, H.; et al. FGFR4 Deficiency Improves Insulin Resistance and Glucose Metabolism under Diet-induced Obesity Conditions. J. Biol. Chem. 2014. [Google Scholar] [CrossRef]
- Chen, L.; McNulty, J.; Anderson, D.; Liu, Y.; Nystrom, C.; Bullard, S.; Collins, J.; Handlon, A.L.; Klein, R.; Grimes, A.; et al. Cholestyramine reverses hyperglycemia and enhances glucose-stimulated glucagon-like peptide 1 release in Zucker diabetic fatty rats. J. Pharmacol. Exp. Ther. 2010, 334, 164–170. [Google Scholar] [CrossRef]
- Dominguez-Reyes, T.; Astudillo-Lopez, C.C.; Salgado-Goytia, L.; Munoz-Valle, J.F.; Salgado-Bernabe, A.B.; Guzman-Guzman, I.P.; Castro-Alarcon, N.; Moreno-Godinez, M.E.; Parra-Rojas, I. Interaction of dietary fat intake with APOA2, APOA5 and LEPR polymorphisms and its relationship with obesity and dyslipidemia in young subjects. Lipids Health Dis. 2015, 14, 106. [Google Scholar] [CrossRef]
- Ma, L.; Jüttner, M.; Kullak-Ublick, G.A.; Eloranta, J.J. Regulation of the gene encoding the intestinal bile acid transporter ASBT by the caudal-type homeobox proteins CDX1 and CDX2. Am. J. Physiol. Gastrointest. Liver Physiol. 2012, 302, G123–G133. [Google Scholar] [CrossRef]
- Thomas, C.; Landrier, J.-F.; Gaillard, D.; Grober, J.; Monnot, M.-C.; Athias, A.; Besnard, P. Cholesterol dependent downregulation of mouse and human apical sodium dependent bile acid transporter (ASBT) gene expression: Molecular mechanism and physiological consequences. Gut 2006, 55, 1321–1331. [Google Scholar] [CrossRef]
- Duane, W.C.; Xiong, W.; Lofgren, J. Transactivation of the human apical sodium-dependent bile acid transporter gene by human serum. J. Steroid Biochem. Mol. Biol. 2008, 108, 137–148. [Google Scholar] [CrossRef]
- Chen, F.; Ma, L.; Al-Ansari, N.; Shneider, B. The role of AP-1 in the transcriptional regulation of the rat apical sodium-dependent bile acid transporter. J. Biol. Chem. 2001, 276, 38703–38714. [Google Scholar] [CrossRef]
- Neimark, E.; Chen, F.; Li, X.; Shneider, B.L. Bile acid–induced negative feedback regulation of the human ileal bile acid transporter. Hepatology 2004, 40, 149–156. [Google Scholar] [CrossRef] [PubMed]
- Chow, E.C.; Sun, H.; Khan, A.A.; Groothuis, G.M.; Pang, K.S. Effects of 1α, 25-dihydroxyvitamin D3 on transporters and enzymes of the rat intestine and kidney in vivo. Biopharm. Drug Dispos. 2010, 31, 91–108. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Chen, F.; Liu, S.; Glaeser, H.; Dawson, P.A.; Hofmann, A.F.; Kim, R.B.; Shneider, B.L.; Pang, K.S. Transactivation of rat apical sodium-dependent bile acid transporter and increased bile acid transport by 1α, 25-dihydroxyvitamin D3 via the vitamin D receptor. Mol. Pharmacol. 2006, 69, 1913–1923. [Google Scholar] [CrossRef]
- Beuling, E.; Kerkhof, I.M.; Nicksa, G.A.; Giuffrida, M.J.; Haywood, J.; aan de Kerk, D.J.; Piaseckyj, C.M.; Pu, W.T.; Buchmiller, T.L.; Dawson, P.A.; et al. Conditional Gata4 deletion in mice induces bile acid absorption in the proximal small intestine. Gut 2010, 59, 888–895. [Google Scholar] [CrossRef] [PubMed]
- Dawson, P.A. Role of the intestinal bile acid transporters in bile acid and drug disposition. In Drug Transporters; Springer: Berlin/Heidelberg, Germany, 2011; pp. 169–203. [Google Scholar]
- Out, C.; Patankar, J.V.; Doktorova, M.; Boesjes, M.; Bos, T.; de Boer, S.; Havinga, R.; Wolters, H.; Boverhof, R.; van Dijk, T.H.; et al. Gut microbiota inhibit Asbt-dependent intestinal bile acid reabsorption via Gata4. J. Hepatol. 2015, 63, 697–704. [Google Scholar] [CrossRef]
- Annaba, F.; Sarwar, Z.; Gill, R.K.; Ghosh, A.; Saksena, S.; Borthakur, A.; Hecht, G.A.; Dudeja, P.K.; Alrefai, W.A. Enteropathogenic Escherichia coli inhibits ileal sodium-dependent bile acid transporter ASBT. Am. J. Physiol. Gastrointest. Liver Physiol. 2012, 302, G1216–G1222. [Google Scholar] [CrossRef]
- Chen, L.; Yao, X.; Young, A.; McNulty, J.; Anderson, D.; Liu, Y.; Nystrom, C.; Croom, D.; Ross, S.; Collins, J. Inhibition of apical sodium-dependent bile acid transporter as a novel treatment for diabetes. Am. J. Physiol. Endocrinol. Metab. 2012, 302, E68–E76. [Google Scholar] [CrossRef]
- Wojtal, K.A.; Eloranta, J.J.; Hruz, P.; Gutmann, H.; Drewe, J.; Staumann, A.; Beglinger, C.; Fried, M.; Kullak-Ublick, G.A.; Vavricka, S.R. Changes in mRNA expression levels of solute carrier transporters in inflammatory bowel disease patients. Drug Metab. Dispos. 2009, 37, 1871–1877. [Google Scholar] [CrossRef]
- Wu, Y.; Aquino, C.J.; Cowan, D.J.; Anderson, D.L.; Ambroso, J.L.; Bishop, M.J.; Boros, E.E.; Chen, L.; Cunningham, A.; Dobbins, R.L. Discovery of a highly potent, nonabsorbable apical sodium-dependent bile acid transporter inhibitor (GSK2330672) for treatment of type 2 diabetes. J. Med. Chem. 2013, 56, 5094–5114. [Google Scholar] [CrossRef]
- Slijepcevic, D.; van de Graaf, S.F. Bile acid uptake transporters as targets for therapy. Dig. Dis. 2017, 35, 251–258. [Google Scholar] [CrossRef]
- van de Peppel, I.P.; Bertolini, A.; van Dijk, T.H.; Groen, A.K.; Jonker, J.W.; Verkade, H.J. Efficient reabsorption of transintestinally excreted cholesterol is a strong determinant for cholesterol disposal in mice [S]. J. Lipid Res. 2019, 60, 1562–1572. [Google Scholar] [CrossRef] [PubMed]
- Dawson, P.A.; Haywood, J.; Craddock, A.L.; Wilson, M.; Tietjen, M.; Kluckman, K.; Maeda, N.; Parks, J.S. Targeted deletion of the ileal bile acid transporter eliminates enterohepatic cycling of bile acids in mice. J. Biol. Chem. 2003, 278, 33920–33927. [Google Scholar] [CrossRef] [PubMed]
- Ning, N.; He, K.; Wang, Y.; Zou, Z.; Wu, H.; Li, X.; Ye, X. Hypolipidemic effect and mechanism of palmatine from Coptis chinensis in hamsters fed high-fat diet. Phytother. Res. 2015, 29, 668–673. [Google Scholar] [CrossRef] [PubMed]
- Hou, R.-g.; Fan, L.; Liu, J.-j.; Cheng, Y.; Chang, Z.-p.; Wu, B.; Shao, Y.-y. Bile acid malabsorption is associated with diarrhea in acute phase of colitis. Can. J. Physiol. Pharmacol. 2018, 96, 1328–1336. [Google Scholar] [CrossRef]
- Yang, N.; Dong, Y.-Q.; Jia, G.-X.; Fan, S.-M.; Li, S.-Z.; Yang, S.-S.; Li, Y.-B. ASBT(SLC10A2): A promising target for treatment of diseases and drug discovery. Biomed. Pharmacother. 2020, 132, 110835. [Google Scholar] [CrossRef]
- Sundaram, S.; Palaniappan, B.; Nepal, N.; Chaffins, S.; Sundaram, U.; Arthur, S. Mechanism of Dyslipidemia in Obesity-Unique Regulation of Ileal Villus Cell Brush Border Membrane Sodium-Bile Acid Cotransport. Cells 2019, 8, 1197. [Google Scholar] [CrossRef]
- Palaniappan, B.; Arthur, S.; Sundaram, V.L.; Butts, M.; Sundaram, S.; Mani, K.; Singh, S.; Nepal, N.; Sundaram, U. Inhibition of intestinal villus cell Na/K-ATPase mediates altered glucose and NaCl absorption in obesity-associated diabetes and hypertension. FASEB J. 2019, 33, 9323–9333. [Google Scholar] [CrossRef]
- Hegyi, P.; Maléth, J.; Walters, J.R.; Hofmann, A.F.; Keely, S.J. Guts and Gall: Bile Acids in Regulation of Intestinal Epithelial Function in Health and Disease. Physiol. Rev. 2018, 98, 1983–2023. [Google Scholar] [CrossRef]
- Ovadia, C.; Perdones-Montero, A.; Spagou, K.; Smith, A.; Sarafian, M.H.; Gomez-Romero, M.; Bellafante, E.; Clarke, L.C.D.; Sadiq, F.; Nikolova, V.; et al. Enhanced Microbial Bile Acid Deconjugation and Impaired Ileal Uptake in Pregnancy Repress Intestinal Regulation of Bile Acid Synthesis. Hepatology 2019, 70, 276–293. [Google Scholar] [CrossRef]
- Li, M.; Wang, Q.; Li, Y.; Cao, S.; Zhang, Y.; Wang, Z.; Liu, G.; Li, J.; Gu, B. Apical sodium-dependent bile acid transporter, drug target for bile acid related diseases and delivery target for prodrugs: Current and future challenges. Pharmacol. Ther. 2020, 212, 107539. [Google Scholar] [CrossRef]
- Alrefai, W.A.; Gill, R.K. Bile acid transporters: Structure, function, regulation and pathophysiological implications. Pharm. Res. 2007, 24, 1803–1823. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.S.; O’Brien, T. CHAPTER 23—DYSLIPIDEMIAS. In Pharmacology and Therapeutics; Waldman, S.A., Terzic, A., Egan, L.J., Elghozi, J.-L., Jahangir, A., Kane, G.C., Kraft, W.K., Lewis, L.D., Morrow, J.D., Zingman, L.V., et al., Eds.; W.B. Saunders: Philadelphia, PA, USA, 2009; pp. 303–320. [Google Scholar]
- Caspary, W.F. Increase of active transport of conjugated bile salts in streptozotocin-diabetic rat small intestine. Gut 1973, 14, 949–955. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Annaba, F.; Ma, K.; Kumar, P.; Dudeja, A.K.; Kineman, R.D.; Shneider, B.L.; Saksena, S.; Gill, R.K.; Alrefai, W.A. Ileal apical Na+-dependent bile acid transporter ASBT is upregulated in rats with diabetes mellitus induced by low doses of streptozotocin. Am. J. Physiol. Gastrointest. Liver Physiol. 2010, 299, G898–G906. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Battle, M.A.; Bondow, B.J.; Iverson, M.A.; Adams, S.J.; Jandacek, R.J.; Tso, P.; Duncan, S.A. GATA4 is essential for jejunal function in mice. Gastroenterology 2008, 135, 1676–1686.e1. [Google Scholar] [CrossRef] [PubMed]
- Kohli, R.; Kirby, M.; Setchell, K.D.; Jha, P.; Klustaitis, K.; Woollett, L.A.; Pfluger, P.T.; Balistreri, W.F.; Tso, P.; Jandacek, R.J.; et al. Intestinal adaptation after ileal interposition surgery increases bile acid recycling and protects against obesity-related comorbidities. Am. J. Physiol. Gastrointest. Liver Physiol. 2010, 299, G652–G660. [Google Scholar] [CrossRef]
- Thompson, C.A.; Wojta, K.; Pulakanti, K.; Rao, S.; Dawson, P.; Battle, M.A. GATA4 Is Sufficient to Establish Jejunal Versus Ileal Identity in the Small Intestine. Cell Mol. Gastroenterol. Hepatol. 2017, 3, 422–446. [Google Scholar] [CrossRef]
- Bosse, T.; Piaseckyj, C.M.; Burghard, E.; Fialkovich, J.J.; Rajagopal, S.; Pu, W.T.; Krasinski, S.D. Gata4 is essential for the maintenance of jejunal-ileal identities in the adult mouse small intestine. Mol. Cell. Biol. 2006, 26, 9060–9070. [Google Scholar] [CrossRef]
- Lee, F.Y.; Lee, H.; Hubbert, M.L.; Edwards, P.A.; Zhang, Y. FXR, a multipurpose nuclear receptor. Trends Biochem. Sci. 2006, 31, 572–580. [Google Scholar] [CrossRef]
- Li, H.; Chen, F.; Shang, Q.; Pan, L.; Shneider, B.L.; Chiang, J.Y.; Forman, B.M.; Ananthanarayanan, M.; Tint, G.S.; Salen, G.; et al. FXR-activating ligands inhibit rabbit ASBT expression via FXR-SHP-FTF cascade. Am. J. Physiol. Gastrointest. Liver Physiol. 2005, 288, G60–G66. [Google Scholar] [CrossRef]
- Redinger, R.N. The role of the enterohepatic circulation of bile salts and nuclear hormone receptors in the regulation of cholesterol homeostasis: Bile salts as ligands for nuclear hormone receptors. Can. J. Gastroenterol. 2003, 17, 265–271. [Google Scholar] [CrossRef]
- Goodwin, B.; Jones, S.A.; Price, R.R.; Watson, M.A.; McKee, D.D.; Moore, L.B.; Galardi, C.; Wilson, J.G.; Lewis, M.C.; Roth, M.E.; et al. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol. Cell 2000, 6, 517–526. [Google Scholar] [CrossRef] [PubMed]
- Kim, I.; Ahn, S.H.; Inagaki, T.; Choi, M.; Ito, S.; Guo, G.L.; Kliewer, S.A.; Gonzalez, F.J. Differential regulation of bile acid homeostasis by the farnesoid X receptor in liver and intestine. J. Lipid Res. 2007, 48, 2664–2672. [Google Scholar] [CrossRef] [PubMed]
- Guo, C.; Chen, W.D.; Wang, Y.D. TGR5, Not Only a Metabolic Regulator. Front. Physiol. 2016, 7, 646. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Aoki, H.; Yang, J.; Peng, K.; Liu, R.; Li, X.; Qiang, X.; Sun, L.; Gurley, E.C.; Lai, G.; et al. The role of sphingosine 1-phosphate receptor 2 in bile-acid–induced cholangiocyte proliferation and cholestasis-induced liver injury in mice. Hepatology 2017, 65, 2005–2018. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Zhang, T.; Yue, Y.; Wu, X. Effects of Bile Acid Modulation by Dietary Fat, Cholecystectomy, and Bile Acid Sequestrant on Energy, Glucose, and Lipid Metabolism and Gut Microbiota in Mice. Int. J. Mol. Sci. 2022, 23, 5935. [Google Scholar] [CrossRef] [PubMed]
- Sundaram, U.; Coon, S.; Wisel, S.; West, A.B. Corticosteroids reverse the inhibition of Na-glucose cotransport in the chronically inflamed rabbit ileum. Am. J. Physiol. 1999, 276, G211–G218. [Google Scholar] [CrossRef]
- Sundaram, U.; Wisel, S.; Stengelin, S.; Kramer, W.; Rajendran, V. Mechanism of inhibition of Na+-bile acid cotransport during chronic ileal inflammation in rabbits. Am. J. Physiol. 1998, 275, G1259–G1265. [Google Scholar] [CrossRef]
Target | Forward Primer | Reverse Primer |
---|---|---|
ASBT | TCGCAGGTGCAATTCTCATTGT | CCAAGGCAACTGTTCGGCAC |
FXR | CAAGCCACGGACGAGTTTGC | CAGTCTTCCGGTTGTTGCGG |
GATA4 | CCTGCGAGACACCCCAATCT | GTCCTGTCCCATCTCGCCTC |
TGR5 | GCCCAAAGGTGGCTACAAGT | GCATTGGCTACTGGAGTGGT |
SIPR2 | TGCTGCCCCTCTATGCTAAG | GGCCACGATAGCCAGTAAGA |
Beta-Actin | ACGGTCAGGTCATCACTATCGG | TGTAGTTTCATGGATGCCACAGGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sundaram, S.; Jagadeesan, A.; Paulraj, R.S.; Sundaram, U.; Arthur, S. Novel Expression of Apical Bile Acid Transport (ASBT) More Proximally Than Distal Ileum Contributing to Enhanced Intestinal Bile Acid Absorption in Obesity. Int. J. Mol. Sci. 2024, 25, 11452. https://doi.org/10.3390/ijms252111452
Sundaram S, Jagadeesan A, Paulraj RS, Sundaram U, Arthur S. Novel Expression of Apical Bile Acid Transport (ASBT) More Proximally Than Distal Ileum Contributing to Enhanced Intestinal Bile Acid Absorption in Obesity. International Journal of Molecular Sciences. 2024; 25(21):11452. https://doi.org/10.3390/ijms252111452
Chicago/Turabian StyleSundaram, Shanmuga, Arunkumar Jagadeesan, Raja Singh Paulraj, Uma Sundaram, and Subha Arthur. 2024. "Novel Expression of Apical Bile Acid Transport (ASBT) More Proximally Than Distal Ileum Contributing to Enhanced Intestinal Bile Acid Absorption in Obesity" International Journal of Molecular Sciences 25, no. 21: 11452. https://doi.org/10.3390/ijms252111452
APA StyleSundaram, S., Jagadeesan, A., Paulraj, R. S., Sundaram, U., & Arthur, S. (2024). Novel Expression of Apical Bile Acid Transport (ASBT) More Proximally Than Distal Ileum Contributing to Enhanced Intestinal Bile Acid Absorption in Obesity. International Journal of Molecular Sciences, 25(21), 11452. https://doi.org/10.3390/ijms252111452