Limited Adipogenic Differentiation Potential of Human Dental Pulp Stem Cells Compared to Human Bone Marrow Stem Cells
Abstract
1. Introduction
2. Results
2.1. Reduced Adipogenic Differentiation of hDPSCs When Compared to hBMSCs
2.2. Comparison of the Lipid Vesicle Formation between the hBMSC- and hDPSC-Originated Adipocytes
2.3. Commitment of hBMSCs and hDPSCs towards the Adipogenic Fate and Their Progression into Mature Adipocytes
2.4. Comparison of the Expression of Stem Cell and Osteogenic Genes in hBMSCs and hDPSCs Cultured in Adipogenic Conditions
2.5. Comparison of the Expression of WNT and SWAT Cell-Related Genes in hBMSCs and hDPSCs Cultured in Adipogenic Conditions
2.6. Expression of Notch Pathway Genes in hBMSCs and hDPSCs Cultured in Adipogenic Conditions
3. Discussion
4. Materials and Methods
4.1. Collection of Human Teeth and Dental Pulp Cells
4.2. Cell Cultures and Differentiation Assays
4.3. Staining
4.4. Imaging
4.5. RNA Extraction, Reverse Transcription, and Quantitative Real-Time PCR (qRT-PCR)
4.6. Quantification of Staining and Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pittenger, M.F.; Mackay, A.M.; Beck, S.C.; Jaiswal, R.K.; Douglas, R.; Mosca, J.D.; Moorman, M.A.; Simonetti, D.W.; Craig, S.; Marshak, D.R. Multilineage Potential of Adult Human Mesenchymal Stem Cells. Science 1999, 284, 143–147. [Google Scholar] [CrossRef] [PubMed]
- Pittenger, M.F.; Discher, D.E.; Péault, B.M.; Phinney, D.G.; Hare, J.M.; Caplan, A.I. Mesenchymal Stem Cell Perspective: Cell Biology to Clinical Progress. NPJ Regen. Med. 2019, 4, 22. [Google Scholar] [CrossRef] [PubMed]
- Bagchi, D.P.; Nishii, A.; Li, Z.; DelProposto, J.B.; Corsa, C.A.; Mori, H.; Hardij, J.; Learman, B.S.; Lumeng, C.N.; MacDougald, O.A. Wnt/β-Catenin Signaling Regulates Adipose Tissue Lipogenesis and Adipocyte-Specific Loss Is Rigorously Defended by Neighboring Stromal-Vascular Cells. Mol. Metab. 2020, 42, 101078. [Google Scholar] [CrossRef] [PubMed]
- Christodoulides, C.; Lagathu, C.; Sethi, J.K.; Vidal-Puig, A. Adipogenesis and WNT Signalling. Trends Endocrinol. Metab. 2009, 20, 16–24. [Google Scholar] [CrossRef] [PubMed]
- Garin-Shkolnik, T.; Rudich, A.; Hotamisligil, G.S.; Rubinstein, M. FABP4 Attenuates PPARγ and Adipogenesis and Is Inversely Correlated with PPARγ in Adipose Tissues. Diabetes 2014, 63, 900–911. [Google Scholar] [CrossRef]
- Rauch, A.; Haakonsson, A.K.; Madsen, J.G.S.; Larsen, M.; Forss, I.; Madsen, M.R.; Van Hauwaert, E.L.; Wiwie, C.; Jespersen, N.Z.; Tencerova, M.; et al. Osteogenesis Depends on Commissioning of a Network of Stem Cell Transcription Factors That Act as Repressors of Adipogenesis. Nat. Genet. 2019, 51, 716–727. [Google Scholar] [CrossRef]
- Lai, C.F.; Shen, J.; Balic, A.; Pagella, P.; Schwab, M.E.; Mitsiadis, T.A. Nogo-A Regulates the Fate of Human Dental Pulp Stem Cells toward Osteogenic, Adipogenic, and Neurogenic Differentiation. Cells 2022, 11, 3415. [Google Scholar] [CrossRef]
- Pierce, J.; Begun, D.; Westendorf, J.; McGee-Lawrence, M. Defining Osteoblast and Adipocyte Lineages in the Bone Marrow. Bone 2019, 118, 2–7. [Google Scholar] [CrossRef]
- Yang Loureiro, Z.; Joyce, S.; DeSouza, T.; Solivan-Rivera, J.; Desai, A.; Skritakis, P.; Yang, Q.; Ziegler, R.; Zhong, D.; Nguyen, T.T.; et al. Wnt Signaling Preserves Progenitor Cell Multipotency during Adipose Tissue Development. Nat. Metab. 2023, 5, 1014–1028. [Google Scholar] [CrossRef]
- Bianco, P.; Robey, P.G.; Simmons, P.J. Mesenchymal Stem Cells: Revisiting History, Concepts, and Assays. Cell Stem Cell 2008, 2, 313–319. [Google Scholar] [CrossRef]
- Margiana, R.; Markov, A.; Zekiy, A.O.; Hamza, M.U.; Al-Dabbagh, K.A.; Al-Zubaidi, S.H.; Hameed, N.M.; Ahmad, I.; Sivaraman, R.; Kzar, H.H.; et al. Clinical Application of Mesenchymal Stem Cell in Regenerative Medicine: A Narrative Review. Stem Cell Res. Ther. 2022, 13, 366. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Ghazanfari, R.; Zacharaki, D.; Lim, H.C.; Scheding, S. Isolation and Characterization of Primary Bone Marrow Mesenchymal Stromal Cells. Ann. N. Y. Acad. Sci. 2016, 1370, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Bianco, P.; Riminucci, M.; Gronthos, S.; Robey, P.G. Bone Marrow Stromal Stem Cells: Nature, Biology, and Potential Applications. Stem Cells 2001, 19, 180–192. [Google Scholar] [CrossRef] [PubMed]
- Piotrowska, K.; Tarnowski, M. Bone Marrow Adipocytes—Role in Physiology and Various Nutritional Conditions in Human and Animal Models. Nutrients 2021, 13, 1412. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhang, H.; Wang, S.; Chen, X.; Su, J. Bone Marrow Adipocytes: A Critical Player in the Bone Marrow Microenvironment. Front. Cell Dev. Biol. 2021, 9, 770705. [Google Scholar] [CrossRef]
- Tencerova, M.; Kassem, M. The Bone Marrow-Derived Stromal Cells: Commitment and Regulation of Adipogenesis. Front. Endocrinol. (Lausanne) 2016, 7, 127. [Google Scholar] [CrossRef]
- Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal Human Dental Pulp Stem Cells (DPSCs) in Vitro and in Vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 13625–13630. [Google Scholar] [CrossRef]
- Ikeda, E.; Yagi, K.; Kojima, M.; Yagyuu, T.; Ohshima, A.; Sobajima, S.; Tadokoro, M.; Katsube, Y.; Isoda, K.; Kondoh, M.; et al. Multipotent Cells from the Human Third Molar: Feasibility of Cell-Based Therapy for Liver Disease. Differentiation 2008, 76, 495–505. [Google Scholar] [CrossRef]
- Rosa, V.; Dubey, N.; Islam, I.; Min, K.-S.; Nör, J.E. Pluripotency of Stem Cells from Human Exfoliated Deciduous Teeth for Tissue Engineering. Stem Cells Int. 2016, 2016, e5957806. [Google Scholar] [CrossRef]
- Seo, B.-M.; Miura, M.; Gronthos, S.; Bartold, P.M.; Batouli, S.; Brahim, J.; Young, M.; Robey, P.G.; Wang, C.-Y.; Shi, S. Investigation of Multipotent Postnatal Stem Cells from Human Periodontal Ligament. Lancet 2004, 364, 149–155. [Google Scholar] [CrossRef]
- Sonoyama, W.; Liu, Y.; Fang, D.; Yamaza, T.; Seo, B.-M.; Zhang, C.; Liu, H.; Gronthos, S.; Wang, C.-Y.; Wang, S.; et al. Mesenchymal Stem Cell-Mediated Functional Tooth Regeneration in Swine. PLoS ONE 2006, 1, e79. [Google Scholar] [CrossRef] [PubMed]
- Honda, M.J.; Imaizumi, M.; Tsuchiya, S.; Morsczeck, C. Dental Follicle Stem Cells and Tissue Engineering. J. Oral. Sci. 2010, 52, 541–552. [Google Scholar] [CrossRef] [PubMed]
- Monterubbianesi, R.; Bencun, M.; Pagella, P.; Woloszyk, A.; Orsini, G.; Mitsiadis, T.A. A Comparative in Vitro Study of the Osteogenic and Adipogenic Potential of Human Dental Pulp Stem Cells, Gingival Fibroblasts and Foreskin Fibroblasts. Sci. Rep. 2019, 9, 1761. [Google Scholar] [CrossRef] [PubMed]
- Mercado-Rubio, M.D.; Pérez-Argueta, E.; Zepeda-Pedreguera, A.; Aguilar-Ayala, F.J.; Peñaloza-Cuevas, R.; Kú-González, A.; Rojas-Herrera, R.A.; Rodas-Junco, B.A.; Nic-Can, G.I. Similar Features, Different Behaviors: A Comparative In Vitro Study of the Adipogenic Potential of Stem Cells from Human Follicle, Dental Pulp, and Periodontal Ligament. J. Pers. Med. 2021, 11, 738. [Google Scholar] [CrossRef] [PubMed]
- Min, Q.; Yang, L.; Tian, H.; Tang, L.; Xiao, Z.; Shen, J. Immunomodulatory Mechanism and Potential Application of Dental Pulp-Derived Stem Cells in Immune-Mediated Diseases. Int. J. Mol. Sci. 2023, 24, 8068. [Google Scholar] [CrossRef]
- Hollands, P.; Aboyeji, D.; Orcharton, M. Dental Pulp Stem Cells in Regenerative Medicine. Br. Dent. J. 2018, 224, 747–750. [Google Scholar] [CrossRef]
- Iohara, K.; Zayed, M.; Takei, Y.; Watanabe, H.; Nakashima, M. Treatment of Pulpectomized Teeth With Trypsin Prior to Transplantation of Mobilized Dental Pulp Stem Cells Enhances Pulp Regeneration in Aged Dogs. Front. Bioeng. Biotechnol. 2020, 8, 983. [Google Scholar] [CrossRef]
- Zheng, C.; Chen, J.; Liu, S.; Jin, Y. Stem Cell-Based Bone and Dental Regeneration: A View of Microenvironmental Modulation. Int. J. Oral. Sci. 2019, 11, 23. [Google Scholar] [CrossRef]
- d’Aquino, R.; De Rosa, A.; Lanza, V.; Tirino, V.; Laino, L.; Graziano, A.; Desiderio, V.; Laino, G.; Papaccio, G. Human Mandible Bone Defect Repair by the Grafting of Dental Pulp Stem/Progenitor Cells and Collagen Sponge Biocomplexes. Eur. Cell Mater. 2009, 18, 75–83. [Google Scholar] [CrossRef]
- Angelova Volponi, A.; Zaugg, L.K.; Neves, V.; Liu, Y.; Sharpe, P.T. Tooth Repair and Regeneration. Curr. Oral. Health Rep. 2018, 5, 295–303. [Google Scholar] [CrossRef]
- Pagella, P.; de Vargas Roditi, L.; Stadlinger, B.; Moor, A.E.; Mitsiadis, T.A. A Single-Cell Atlas of Human Teeth. iScience 2021, 24, 102405. [Google Scholar] [CrossRef] [PubMed]
- Ulloa-Montoya, F.; Kidder, B.L.; Pauwelyn, K.A.; Chase, L.G.; Luttun, A.; Crabbe, A.; Geraerts, M.; Sharov, A.A.; Piao, Y.; Ko, M.S.; et al. Comparative Transcriptome Analysis of Embryonic and Adult Stem Cells with Extended and Limited Differentiation Capacity. Genome Biol. 2007, 8, R163. [Google Scholar] [CrossRef] [PubMed]
- Thomas, S.; Thomas, M.; Wincker, P.; Babarit, C.; Xu, P.; Speer, M.C.; Munnich, A.; Lyonnet, S.; Vekemans, M.; Etchevers, H.C. Human Neural Crest Cells Display Molecular and Phenotypic Hallmarks of Stem Cells. Hum. Mol. Genet. 2008, 17, 3411–3425. [Google Scholar] [CrossRef] [PubMed]
- Rosen, E.D.; Hsu, C.-H.; Wang, X.; Sakai, S.; Freeman, M.W.; Gonzalez, F.J.; Spiegelman, B.M. C/EBPα Induces Adipogenesis through PPARγ: A Unified Pathway. Genes Dev. 2002, 16, 22–26. [Google Scholar] [CrossRef]
- Zhang, J.; Fu, M.; Cui, T.; Xiong, C.; Xu, K.; Zhong, W.; Xiao, Y.; Floyd, D.; Liang, J.; Li, E.; et al. Selective Disruption of PPARγ2 Impairs the Development of Adipose Tissue and Insulin Sensitivity. Proc. Natl. Acad. Sci. USA 2004, 101, 10703–10708. [Google Scholar] [CrossRef]
- Clabaut, A.; Delplace, S.; Chauveau, C.; Hardouin, P.; Broux, O. Human Osteoblasts Derived from Mesenchymal Stem Cells Express Adipogenic Markers upon Coculture with Bone Marrow Adipocytes. Differentiation 2010, 80, 40–45. [Google Scholar] [CrossRef]
- Fu, Y.; Luo, N.; Klein, R.L.; Garvey, W.T. Adiponectin Promotes Adipocyte Differentiation, Insulin Sensitivity, and Lipid Accumulation. J. Lipid Res. 2005, 46, 1369–1379. [Google Scholar] [CrossRef]
- Moraes, D.A.; Sibov, T.T.; Pavon, L.F.; Alvim, P.Q.; Bonadio, R.S.; Da Silva, J.R.; Pic-Taylor, A.; Toledo, O.A.; Marti, L.C.; Azevedo, R.B.; et al. A Reduction in CD90 (THY-1) Expression Results in Increased Differentiation of Mesenchymal Stromal Cells. Stem Cell Res. Ther. 2016, 7, 97. [Google Scholar] [CrossRef]
- Palani, N.P.; Horvath, C.; Timshel, P.N.; Folkertsma, P.; Grønning, A.G.B.; Henriksen, T.I.; Peijs, L.; Jensen, V.H.; Sun, W.; Jespersen, N.Z.; et al. Adipogenic and SWAT Cells Separate from a Common Progenitor in Human Brown and White Adipose Depots. Nat. Metab. 2023, 5, 996–1013. [Google Scholar] [CrossRef]
- Song, L.; Tuan, R.S. Transdifferentiation Potential of Human Mesenchymal Stem Cells Derived from Bone Marrow. FASEB J. 2004, 18, 980–982. [Google Scholar] [CrossRef]
- Zechner, R.; Strauss, J.; Frank, S.; Wagner, E.; Hofmann, W.; Kratky, D.; Hiden, M.; Levak-Frank, S. The Role of Lipoprotein Lipase in Adipose Tissue Development and Metabolism. Int. J. Obes. 2000, 24, S53–S56. [Google Scholar] [CrossRef] [PubMed]
- Ambele, M.A.; Dessels, C.; Durandt, C.; Pepper, M.S. Genome-Wide Analysis of Gene Expression during Adipogenesis in Human Adipose-Derived Stromal Cells Reveals Novel Patterns of Gene Expression during Adipocyte Differentiation. Stem Cell Res. 2016, 16, 725–734. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.-E.; Schmidt, H.; Lai, B.; Ge, K. Transcriptional and Epigenomic Regulation of Adipogenesis. Mol. Cell Biol. 2019, 39, e00601-18. [Google Scholar] [CrossRef] [PubMed]
- Fracaro, L.; Senegaglia, A.C.; Herai, R.H.; Leitolis, A.; Boldrini-Leite, L.M.; Rebelatto, C.L.K.; Travers, P.J.; Brofman, P.R.S.; Correa, A. The Expression Profile of Dental Pulp-Derived Stromal Cells Supports Their Limited Capacity to Differentiate into Adipogenic Cells. Int. J. Mol. Sci. 2020, 21, 2753. [Google Scholar] [CrossRef]
- Scintu, F.; Reali, C.; Pillai, R.; Badiali, M.; Sanna, M.A.; Argiolu, F.; Ristaldi, M.S.; Sogos, V. Differentiation of Human Bone Marrow Stem Cells into Cells with a Neural Phenotype: Diverse Effects of Two Specific Treatments. BMC Neurosci. 2006, 7, 14. [Google Scholar] [CrossRef]
- Prockop, D.J. Marrow Stromal Cells as Stem Cells for Nonhematopoietic Tissues. Science 1997, 276, 71–74. [Google Scholar] [CrossRef]
- Cavalcanti, B.N.; Zeitlin, B.D.; Nör, J.E. A Hydrogel Scaffold That Maintains Viability and Supports Differentiation of Dental Pulp Stem Cells. Dent. Mater. 2013, 29, 97–102. [Google Scholar] [CrossRef]
- Kislev, N.; Eidelheit, S.; Perlmutter, S.; Benayahu, D. How to Follow Lipid Droplets Dynamics during Adipocyte Metabolism. J. Cell. Physiol. 2022, 237, 4157–4168. [Google Scholar] [CrossRef]
- Nagayama, M.; Uchida, T.; Gohara, K. Temporal and Spatial Variations of Lipid Droplets during Adipocyte Division and Differentiations. J. Lipid Res. 2007, 48, 9–18. [Google Scholar] [CrossRef]
- Xu, J.; Li, Z.; Hou, Y.; Fang, W. Potential Mechanisms Underlying the Runx2 Induced Osteogenesis of Bone Marrow Mesenchymal Stem Cells. Am. J. Transl. Res. 2015, 7, 2527–2535. [Google Scholar]
- Artavanis-Tsakonas, S.; Rand, M.D.; Lake, R.J. Notch Signaling: Cell Fate Control and Signal Integration in Development. Science 1999, 284, 770–776. [Google Scholar] [CrossRef] [PubMed]
- Mitsiadis, T.A.; Pagella, P.; Gomes Rodrigues, H.; Tsouknidas, A.; Ramenzoni, L.L.; Radtke, F.; Mehl, A.; Viriot, L. Notch Signaling Pathway in Tooth Shape Variations throughout Evolution. Cells 2023, 12, 761. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.-C.; Logan, H.; Newman, J.J. Distinct Roles for Notch1 and Notch3 in Human Adipose-Derived Stem/Stromal Cell Adipogenesis. Mol. Biol. Rep. 2020, 47, 8439–8450. [Google Scholar] [CrossRef] [PubMed]
- Vujovic, F.; Hunter, N.; Farahani, R.M. Notch Pathway: A Bistable Inducer of Biological Noise? Cell Commun. Signal 2019, 17, 133. [Google Scholar] [CrossRef] [PubMed]
- Song, B.; Chi, Y.; Li, X.; Du, W.; Han, Z.-B.; Tian, J.; Li, J.; Chen, F.; Wu, H.; Han, L.; et al. Inhibition of Notch Signaling Promotes the Adipogenic Differentiation of Mesenchymal Stem Cells Through Autophagy Activation and PTEN-PI3K/AKT/mTOR Pathway. Cell. Physiol. Biochem. 2015, 36, 1991–2002. [Google Scholar] [CrossRef]
- Ugarte, F.; Ryser, M.; Thieme, S.; Fierro, F.A.; Navratiel, K.; Bornhäuser, M.; Brenner, S. Notch Signaling Enhances Osteogenic Differentiation While Inhibiting Adipogenesis in Primary Human Bone Marrow Stromal Cells. Exp. Hematol. 2009, 37, 867–875.e1. [Google Scholar] [CrossRef]
- Garcés, C.; Ruiz-Hidalgo, M.J.; de Mora, J.F.; Park, C.; Miele, L.; Goldstein, J.; Bonvini, E.; Porrás, A.; Laborda, J. Notch-1 Controls the Expression of Fatty Acid-Activated Transcription Factors and Is Required for Adipogenesis. J. Biol. Chem. 1997, 272, 29729–29734. [Google Scholar] [CrossRef]
- Nueda, M.-L.; González-Gómez, M.-J.; Rodríguez-Cano, M.-M.; Monsalve, E.-M.; Díaz-Guerra, M.J.M.; Sánchez-Solana, B.; Laborda, J.; Baladrón, V. DLK Proteins Modulate NOTCH Signaling to Influence a Brown or White 3T3-L1 Adipocyte Fate. Sci. Rep. 2018, 8, 16923. [Google Scholar] [CrossRef]
- Pagella, P.; Stadlinger, B.; Mitsiadis, T.A. Isolation of Dental Pulp and Periodontal Cells from Human Teeth for Single-Cell RNA Sequencing. STAR Protoc. 2021, 2, 100953. [Google Scholar] [CrossRef]
- Genicot, G.; Leroy, J.L.M.R.; Soom, A.V.; Donnay, I. The Use of a Fluorescent Dye, Nile Red, to Evaluate the Lipid Content of Single Mammalian Oocytes. Theriogenology 2005, 63, 1181–1194. [Google Scholar] [CrossRef]
- Greenspan, P.; Mayer, E.P.; Fowler, S.D. Nile Red: A Selective Fluorescent Stain for Intracellular Lipid Droplets. J. Cell Biol. 1985, 100, 965–973. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession No. | Forward Primer 5′–3′ | Reverse Primer 5′–3′ |
---|---|---|---|
GAPDH | NM_002046.5 | AGGGCTGCTTTTAACTCTGGT | CCCCACTTGATTTTGGAGGGA |
CD90 | NM_006288.3 | GAAGGTCCTCTACTTATCCGCC | TGATGCCCTCACACTTGACCAG |
WNT2 | NM_003391.3 | AGGATGCCAGAGCCCTGATGAA | AGCCAGCATGTCCTGAGAGTAC |
WNT10B | NM_003394.2 | CTCGGGATTTCTTGGATTCCAGG | GCCATGACACTTGCATTTCCGC |
RUNX2 | NG_008020.1 | GCCAGGGTCTAGGAGTTGTT | ACCCACCACCCTATTTCCTG |
COL1A1 | NM_000088.1 | CCAGAAGAACTGGTACATCAGCAA | CGCCATACTCGAACTGGAATC |
COL3 | NM_000090 | TGGTCTGCAAGGAATGCCTGGA | TCTTTCCCTGGGACACCATCAG |
PPAR-γ2 | NM_138712.3 | GAACGACCAAGTAACTCTCC | CGCAGGCTCTTTAGAAACTCC |
ADIPOQ | NM_004797 | CAGGCCGTGATGGCAGAGATG | GGTTTCACCGATGTCTCCCTTAG |
FABP4 | NM_001442 | ACGAGAGGATGATAAACTGGTGG | GCGAACTTCAGTCCAGGTCAAC |
LPL | NM_000237.2 | ACGGCATGTGAATTCTGTGA | GGATGTGCTATTTGGCCACT |
C/EBPα | NM_024988.1 | GGAGGAGACAAACTTAACTCTGG | ACACCCTCGCTCCCGCCGTT |
PLIN1 | NM_002666.1 | GCGGAATTTGCTGCCAACACTC | AGACTTCTGGGCTTGCTGGTGT |
ALPL | NM_000478.1 | GCTGTAAGGACATCGCCTACCA | CCTGGCTTTCTCGTCACTCTCA |
DCN | NM_001920.1 | GCTCTCCTACATCCGCATTGCT | GTCCTTTCAGGCTAGCTGCATC |
MFAP4 | NM_002404.2 | GGCTCAGTAAGTTTCTTCCGCG | CCAAGTCCACTCGCAGCTCATA |
NOTCH1 | NM_017617.2 | GGTGAACTGCTCTGAGGAGATC | GGATTGCAGTCGTCCACGTTGA |
NOTCH2 | NM_024408.1 | TTCTGGAAATTGACAACCGC | CAAGAGGGTATGACAGGGTCC |
NOTCH3 | NM_000435.1 | GGGACTACAAGAAGAGGAGC | GGAATTCAGCTACACAGGGA |
JAGGED1 | NM_000214 | CGACCCCCTGTGAAGTGATT | ACTCTTGCACTTCCCGTGAG |
HES1 | NM_005524.1 | GCTCTGAAGAAAGATAGCTCGC | GTTCCGGAGGTGCTTCACT |
HEY1 | NM_012258.1 | TAATTGAGAAGCGCCGACGA | GCTTAGCAGATCCTTGCTCCA |
HEY2 | NM_012259.1 | TGAGAAGACTTGTGCCAACTGCT | CCCTGTTGCCTGAAGCATCTTC |
HES5 | NM_001010926.1 | TCCTGGAGATGGCTGTCAGCTA | CGTGGAGCGTCAGGAACTGCA |
DLL4 | NM_019074.1 | CCAGGGACTCCATGTACCAG | CCTGCCTTATACCTCCGTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bugueno, I.M.; Alastra, G.; Balic, A.; Stadlinger, B.; Mitsiadis, T.A. Limited Adipogenic Differentiation Potential of Human Dental Pulp Stem Cells Compared to Human Bone Marrow Stem Cells. Int. J. Mol. Sci. 2024, 25, 11105. https://doi.org/10.3390/ijms252011105
Bugueno IM, Alastra G, Balic A, Stadlinger B, Mitsiadis TA. Limited Adipogenic Differentiation Potential of Human Dental Pulp Stem Cells Compared to Human Bone Marrow Stem Cells. International Journal of Molecular Sciences. 2024; 25(20):11105. https://doi.org/10.3390/ijms252011105
Chicago/Turabian StyleBugueno, Isaac Maximiliano, Giuseppe Alastra, Anamaria Balic, Bernd Stadlinger, and Thimios A. Mitsiadis. 2024. "Limited Adipogenic Differentiation Potential of Human Dental Pulp Stem Cells Compared to Human Bone Marrow Stem Cells" International Journal of Molecular Sciences 25, no. 20: 11105. https://doi.org/10.3390/ijms252011105
APA StyleBugueno, I. M., Alastra, G., Balic, A., Stadlinger, B., & Mitsiadis, T. A. (2024). Limited Adipogenic Differentiation Potential of Human Dental Pulp Stem Cells Compared to Human Bone Marrow Stem Cells. International Journal of Molecular Sciences, 25(20), 11105. https://doi.org/10.3390/ijms252011105