Interplay of Cellular Nrf2/NF-κB Signalling after Plasma Stimulation of Malignant vs. Non-Malignant Dermal Cells
Abstract
1. Introduction
2. Results
2.1. Characterisation of Unstimulated Malignant vs. Non-Malignant Dermal Cells
2.2. Comparison of CAP Effect between Dermal Tumour and Non-Malignant Cells
2.3. Differences in Antioxidant Levels
2.4. Translocation of Nrf2/Keap1 upon CAP Treatment
2.5. Translocation of NF-κB/IκBα upon CAP Treatment

2.6. Gene Expression
3. Discussion
3.1. Diverging Antioxidative Capacity in Malignant vs. Non-Malignant Cells
3.2. Nrf2/Keap1 in CAP-Induced Oxidative Stress Defence
3.3. The Role of NF-κB in Response to CAP Treatment
3.4. Interplay of Nrf2 and NF-κB Pathways
3.5. Gene Expression in Response to CAP Exposure
4. Materials and Methods
4.1. Cell Cultivation
4.2. Plasma Setup and Treatment
4.3. Hydrogen Peroxide Quantification in the Media
4.4. MTS Viability Assay
4.5. Intracellular Reactive Oxygen Species Quantification
4.6. Quantitative Microscopy
4.7. Protein Quantification
4.8. Quantification of Intracellular Antioxidative Capacity
4.9. Gene Expression Analysis
4.10. Assessment of Cellular Oxygen Consumption
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Leiter, U.; Eigentler, T.; Garbe, C. Epidemiology of skin cancer. Adv. Exp. Med. Biol. 2014, 810, 120–140. [Google Scholar] [CrossRef] [PubMed]
- Gordon, R. Skin cancer: An overview of epidemiology and risk factors. Semin. Oncol. Nurs. 2013, 29, 160–169. [Google Scholar] [CrossRef] [PubMed]
- Simões, M.C.F.; Sousa, J.J.S.; Pais, A.A.C.C. Skin cancer and new treatment perspectives: A review. Cancer Lett. 2015, 357, 8–42. [Google Scholar] [CrossRef] [PubMed]
- Rhee, J.S.; Matthews, B.A.; Neuburg, M.; Logan, B.R.; Burzynski, M.; Nattinger, A.B. The skin cancer index: Clinical responsiveness and predictors of quality of life. Laryngoscope 2007, 117, 399–405. [Google Scholar] [CrossRef] [PubMed]
- Fridman, G.; Shereshevsky, A.; Jost, M.M.; Brooks, A.D.; Fridman, A.; Gutsol, A.; Vasilets, V.; Friedman, G. Floating Electrode Dielectric Barrier Discharge Plasma in Air Promoting Apoptotic Behavior in Melanoma Skin Cancer Cell Lines. Plasma Chem. Plasma Process. 2007, 27, 163–176. [Google Scholar] [CrossRef]
- Arndt, S.; Wacker, E.; Li, Y.-F.; Shimizu, T.; Thomas, H.M.; Morfill, G.E.; Karrer, S.; Zimmermann, J.L.; Bosserhoff, A.-K. Cold atmospheric plasma, a new strategy to induce senescence in melanoma cells. Exp. Dermatol. 2013, 22, 284–289. [Google Scholar] [CrossRef]
- Kim, J.Y.; Wei, Y.; Li, J.; Foy, P.; Hawkins, T.; Ballato, J.; Kim, S.-O. Single-cell-level microplasma cancer therapy. Small 2011, 7, 2291–2295. [Google Scholar] [CrossRef]
- Kim, G.C.; Kim, G.J.; Park, S.R.; Jeon, S.M.; Seo, H.J.; Iza, F.; Lee, J.K. Air plasma coupled with antibody-conjugated nanoparticles: A new weapon against cancer. J. Phys. D Appl. Phys. 2009, 42, 32005. [Google Scholar] [CrossRef]
- Keidar, M.; Walk, R.; Shashurin, A.; Srinivasan, P.; Sandler, A.; Dasgupta, S.; Ravi, R.; Guerrero-Preston, R.; Trink, B. Cold plasma selectivity and the possibility of a paradigm shift in cancer therapy. Br. J. Cancer 2011, 105, 1295–1301. [Google Scholar] [CrossRef]
- Van Loenhout, J.; Peeters, M.; Bogaerts, A.; Smits, E.; Deben, C. Oxidative Stress-Inducing Anticancer Therapies: Taking a Closer Look at Their Immunomodulating Effects. Antioxidants 2020, 9, 1188. [Google Scholar] [CrossRef]
- Boeckmann, L.; Berner, J.; Kordt, M.; Lenz, E.; Schäfer, M.; Semmler, M.; Frey, A.; Sagwal, S.K.; Rebl, H.; Miebach, L.; et al. Synergistic effect of cold gas plasma and experimental drug exposure exhibits skin cancer toxicity in vitro and in vivo. J. Adv. Res. 2024, 57, 181–196. [Google Scholar] [CrossRef] [PubMed]
- Rebl, H.; Sawade, M.; Hein, M.; Bergemann, C.; Wende, M.; Lalk, M.; Langer, P.; Emmert, S.; Nebe, B. Synergistic effect of plasma-activated medium and novel indirubin derivatives on human skin cancer cells by activation of the AhR pathway. Sci. Rep. 2022, 12, 2528. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Zha, J.; Sun, T.; Kong, L.; Zhang, X.; Wang, D.; Ni, G. Cold atmospheric plasma attenuates skin cancer via ROS induced apoptosis. Mol. Biol. Rep. 2024, 51, 518. [Google Scholar] [CrossRef] [PubMed]
- Fridman, G.; Friedman, G.; Gutsol, A.; Shekhter, A.B.; Vasilets, V.N.; Fridman, A. Applied Plasma Medicine. Plasma Process. Polym. 2008, 5, 503–533. [Google Scholar] [CrossRef]
- Liu, D.; Zhang, Y.; Xu, M.; Chen, H.; Lu, X.; Ostrikov, K. Cold atmospheric pressure plasmas in dermatology: Sources, reactive agents, and therapeutic effects. Plasma Process. Polym. 2020, 17, 1900218. [Google Scholar] [CrossRef]
- Isbary, G.; Zimmermann, J.; Shimizu, T.; Li, Y.-F.; Morfill, G.; Thomas, H.; Steffes, B.; Heinlin, J.; Karrer, S.; Stolz, W. Non-thermal plasma—More than five years of clinical experience. Clin. Plasma Med. 2013, 1, 19–23. [Google Scholar] [CrossRef]
- Hoentsch, M.; Bussiahn, R.; Rebl, H.; Bergemann, C.; Eggert, M.; Frank, M.; von Woedtke, T.; Nebe, B. Persistent effectivity of gas plasma-treated, long time-stored liquid on epithelial cell adhesion capacity and membrane morphology. PLoS ONE 2014, 9, e104559. [Google Scholar] [CrossRef]
- Xiang, L.; Xu, X.; Zhang, S.; Cai, D.; Dai, X. Cold atmospheric plasma conveys selectivity on triple negative breast cancer cells both in vitro and in vivo. Free Radic. Biol. Med. 2018, 124, 205–213. [Google Scholar] [CrossRef]
- Nastuta, A.V.; Topala, I.; Grigoras, C.; Pohoata, V.; Popa, G. Stimulation of wound healing by helium atmospheric pressure plasma treatment. J. Phys. D Appl. Phys. 2011, 44, 105204. [Google Scholar] [CrossRef]
- Plewa, J.-M.; Yousfi, M.; Frongia, C.; Eichwald, O.; Ducommun, B.; Merbahi, N.; Lobjois, V. Low-temperature plasma-induced antiproliferative effects on multi-cellular tumor spheroids. New J. Phys. 2014, 16, 43027. [Google Scholar] [CrossRef]
- Weiss, M.; Gümbel, D.; Hanschmann, E.-M.; Mandelkow, R.; Gelbrich, N.; Zimmermann, U.; Walther, R.; Ekkernkamp, A.; Sckell, A.; Kramer, A.; et al. Cold Atmospheric Plasma Treatment Induces Anti-Proliferative Effects in Prostate Cancer Cells by Redox and Apoptotic Signaling Pathways. PLoS ONE 2015, 10, e0130350. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Zhou, R.; Thomas, P.; Zhao, L.; Zhou, R.; Mandal, S.; Jolly, M.K.; Richard, D.J.; Rehm, B.H.A.; Ostrikov, K.; et al. Epithelial-to-Mesenchymal Transition Enhances Cancer Cell Sensitivity to Cytotoxic Effects of Cold Atmospheric Plasmas in Breast and Bladder Cancer Systems. Cancers 2021, 13, 2889. [Google Scholar] [CrossRef] [PubMed]
- Metelmann, H.-R.; Nedrelow, D.S.; Seebauer, C.; Schuster, M.; von Woedtke, T.; Weltmann, K.-D.; Kindler, S.; Metelmann, P.H.; Finkelstein, S.E.; Von Hoff, D.D.; et al. Head and neck cancer treatment and physical plasma. Clin. Plasma Med. 2015, 3, 17–23. [Google Scholar] [CrossRef]
- Toyokuni, S.; Okamoto, K.; Yodoi, J.; Hiai, H. Persistent oxidative stress in cancer. FEBS Lett. 1995, 358, 1–3. [Google Scholar] [CrossRef] [PubMed]
- Trachootham, D.; Alexandre, J.; Huang, P. Targeting cancer cells by ROS-mediated mechanisms: A radical therapeutic approach? Nat. Rev. Drug Discov. 2009, 8, 579–591. [Google Scholar] [CrossRef]
- Finkel, T.; Holbrook, N.J. Oxidants, oxidative stress and the biology of ageing. Nature 2000, 408, 239–247. [Google Scholar] [CrossRef]
- Schieber, M.; Chandel, N.S. ROS function in redox signaling and oxidative stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef]
- Barnham, K.J.; Masters, C.L.; Bush, A.I. Neurodegenerative diseases and oxidative stress. Nat. Rev. Drug Discov. 2004, 3, 205–214. [Google Scholar] [CrossRef]
- Buttke, T.M.; Sandstrom, P.A. Oxidative stress as a mediator of apoptosis. Immunol. Today 1994, 15, 7–10. [Google Scholar] [CrossRef]
- Marengo, B.; Nitti, M.; Furfaro, A.L.; Colla, R.; De Ciucis, C.; Marinari, U.M.; Pronzato, M.A.; Traverso, N.; Domenicotti, C. Redox Homeostasis and Cellular Antioxidant Systems: Crucial Players in Cancer Growth and Therapy. Oxidative Med. Cell. Longev. 2016, 2016, 6235641. [Google Scholar] [CrossRef]
- Oberley, T.D.; Oberley, L.W. Antioxidant enzyme levels in cancer. Histol. Histopathol. 1997, 12, 525–535. [Google Scholar] [PubMed]
- Szatrowski, T.P.; Nathan, C.F. Production of large amounts of hydrogen peroxide by human tumor cells. Cancer Res. 1991, 51, 794–798. [Google Scholar] [PubMed]
- Yan, D.; Talbot, A.; Nourmohammadi, N.; Sherman, J.H.; Cheng, X.; Keidar, M. Toward understanding the selective anticancer capacity of cold atmospheric plasma—A model based on aquaporins. Biointerphases 2015, 10, 40801. [Google Scholar] [CrossRef]
- van der Paal, J.; Neyts, E.C.; Verlackt, C.C.W.; Bogaerts, A. Effect of lipid peroxidation on membrane permeability of cancer and normal cells subjected to oxidative stress. Chem. Sci. 2016, 7, 489–498. [Google Scholar] [CrossRef]
- Zhao, S.; Xiong, Z.; Mao, X.; Meng, D.; Lei, Q.; Li, Y.; Deng, P.; Chen, M.; Tu, M.; Lu, X.; et al. Atmospheric pressure room temperature plasma jets facilitate oxidative and nitrative stress and lead to endoplasmic reticulum stress dependent apoptosis in HepG2 cells. PLoS ONE 2013, 8, e73665. [Google Scholar] [CrossRef] [PubMed]
- Kaushik, N.K.; Kaushik, N.; Park, D.; Choi, E.H. Altered antioxidant system stimulates dielectric barrier discharge plasma-induced cell death for solid tumor cell treatment. PLoS ONE 2014, 9, e103349. [Google Scholar] [CrossRef]
- Turrini, E.; Laurita, R.; Stancampiano, A.; Catanzaro, E.; Calcabrini, C.; Maffei, F.; Gherardi, M.; Colombo, V.; Fimognari, C. Cold Atmospheric Plasma Induces Apoptosis and Oxidative Stress Pathway Regulation in T-Lymphoblastoid Leukemia Cells. Oxidative Med. Cell. Longev. 2017, 2017, 4271065. [Google Scholar] [CrossRef]
- Vaux, D.L.; Strasser, A. The molecular biology of apoptosis. Proc. Natl. Acad. Sci. USA 1996, 93, 2239–2244. [Google Scholar] [CrossRef]
- Mitchell, S.; Vargas, J.; Hoffmann, A. Signaling via the NF-κB system. Wiley Interdiscip. Rev. Syst. Biol. Med. 2016, 8, 227–241. [Google Scholar] [CrossRef]
- Vomund, S.; Schäfer, A.; Parnham, M.J.; Brüne, B.; Von Knethen, A. Nrf2, the Master Regulator of Anti-Oxidative Responses. Int. J. Mol. Sci. 2017, 18, 2772. [Google Scholar] [CrossRef]
- Moi, P.; Chan, K.; Asunis, I.; Cao, A.; Kan, Y.W. Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region. Proc. Natl. Acad. Sci. USA 1994, 91, 9926–9930. [Google Scholar] [CrossRef]
- Suzuki, T.; Yamamoto, M. Molecular basis of the Keap1-Nrf2 system. Free Radic. Biol. Med. 2015, 88, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar] [CrossRef]
- Lee, J.-M.; Calkins, M.J.; Chan, K.; Kan, Y.W.; Johnson, J.A. Identification of the NF-E2-related factor-2-dependent genes conferring protection against oxidative stress in primary cortical astrocytes using oligonucleotide microarray analysis. J. Biol. Chem. 2003, 278, 12029–12038. [Google Scholar] [CrossRef] [PubMed]
- Malhotra, D.; Portales-Casamar, E.; Singh, A.; Srivastava, S.; Arenillas, D.; Happel, C.; Shyr, C.; Wakabayashi, N.; Kensler, T.W.; Wasserman, W.W.; et al. Global mapping of binding sites for Nrf2 identifies novel targets in cell survival response through ChIP-Seq profiling and network analysis. Nucleic Acids Res. 2010, 38, 5718–5734. [Google Scholar] [CrossRef]
- Dolcet, X.; Llobet, D.; Pallares, J.; Matias-Guiu, X. NF-kB in development and progression of human cancer. Virchows Arch. 2005, 446, 475–482. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.; May, M.J.; Kopp, E.B. NF-kappa B and Rel proteins: Evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 1998, 16, 225–260. [Google Scholar] [CrossRef] [PubMed]
- Bonizzi, G.; Karin, M. The two NF-kappaB activation pathways and their role in innate and adaptive immunity. Trends Immunol. 2004, 25, 280–288. [Google Scholar] [CrossRef]
- Sakurai, H.; Suzuki, S.; Kawasaki, N.; Nakano, H.; Okazaki, T.; Chino, A.; Doi, T.; Saiki, I. Tumor necrosis factor-alpha-induced IKK phosphorylation of NF-kappaB p65 on serine 536 is mediated through the TRAF2, TRAF5, and TAK1 signaling pathway. J. Biol. Chem. 2003, 278, 36916–36923. [Google Scholar] [CrossRef]
- Biswas, R.; Bagchi, A. NF-κB pathway and inhibition: An overview. CMB 2016, 6, 1–20. [Google Scholar] [CrossRef]
- Razani, B.; Reichardt, A.D.; Cheng, G. Non-canonical NF-κB signaling activation and regulation: Principles and perspectives. Immunol. Rev. 2011, 244, 44–54. [Google Scholar] [CrossRef]
- Patel, P.; Drayman, N.; Liu, P.; Bilgic, M.; Tay, S. Computer vision reveals hidden variables underlying NF-κB activation in single cells. Sci. Adv. 2021, 7, eabg4135. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, A.; Levchenko, A.; Scott, M.L.; Baltimore, D. The IkappaB-NF-kappaB signaling module: Temporal control and selective gene activation. Science 2002, 298, 1241–1245. [Google Scholar] [CrossRef] [PubMed]
- Werner, S.L.; Kearns, J.D.; Zadorozhnaya, V.; Lynch, C.; O’dea, E.; Boldin, M.P.; Ma, A.; Baltimore, D.; Hoffmann, A. Encoding NF-kappaB temporal control in response to TNF: Distinct roles for the negative regulators IkappaBalpha and A20. Genes Dev. 2008, 22, 2093–2101. [Google Scholar] [CrossRef] [PubMed]
- Zirnheld, J.L.; Zucker, S.N.; DiSanto, T.M.; Berezney, R.; Etemadi, K. Nonthermal Plasma Needle: Development and Targeting of Melanoma Cells. IEEE Trans. Plasma Sci. 2010, 38, 948–952. [Google Scholar] [CrossRef]
- Guerrero-Preston, R.; Ogawa, T.; Uemura, M.; Shumulinsky, G.; Valle, B.L.; Pirini, F.; Ravi, R.; Sidransky, D.; Keidar, M.; Trink, B. Cold atmospheric plasma treatment selectively targets head and neck squamous cell carcinoma cells. Int. J. Mol. Med. 2014, 34, 941–946. [Google Scholar] [CrossRef]
- Barekzi, N.; Laroussi, M. Dose-dependent killing of leukemia cells by low-temperature plasma. J. Phys. D Appl. Phys. 2012, 45, 422002. [Google Scholar] [CrossRef]
- Ishaq, M.; Evans, M.D.M.; Ostrikov, K.K. Atmospheric pressure gas plasma-induced colorectal cancer cell death is mediated by Nox2-ASK1 apoptosis pathways and oxidative stress is mitigated by Srx-Nrf2 anti-oxidant system. Biochim. Biophys. Acta 2014, 1843, 2827–2837. [Google Scholar] [CrossRef]
- Kim, J.Y.; Ballato, J.; Foy, P.; Hawkins, T.; Wei, Y.; Li, J.; Kim, S.-O. Apoptosis of lung carcinoma cells induced by a flexible optical fiber-based cold microplasma. Biosens. Bioelectron. 2011, 28, 333–338. [Google Scholar] [CrossRef]
- Wang, M.; Holmes, B.; Cheng, X.; Zhu, W.; Keidar, M.; Zhang, L.G. Cold atmospheric plasma for selectively ablating metastatic breast cancer cells. PLoS ONE 2013, 8, e73741. [Google Scholar] [CrossRef]
- Bengtson, C.; Bogaerts, A. On the Anti-Cancer Effect of Cold Atmospheric Plasma and the Possible Role of Catalase-Dependent Apoptotic Pathways. Cells 2020, 9, 2330. [Google Scholar] [CrossRef]
- Pasqual-Melo, G.; Nascimento, T.; Sanches, L.J.; Blegniski, F.P.; Bianchi, J.K.; Sagwal, S.K.; Berner, J.; Schmidt, A.; Emmert, S.; Weltmann, K.-D.; et al. Plasma Treatment Limits Cutaneous Squamous Cell Carcinoma Development In Vitro and In Vivo. Cancers 2020, 12, 1993. [Google Scholar] [CrossRef]
- Pelicano, H.; Carney, D.; Huang, P. ROS stress in cancer cells and therapeutic implications. Drug Resist. Updat. 2004, 7, 97–110. [Google Scholar] [CrossRef] [PubMed]
- Sander, C.S.; Hamm, F.; Elsner, P.; Thiele, J.J. Oxidative stress in malignant melanoma and non-melanoma skin cancer. Br. J. Dermatol. 2003, 148, 913–922. [Google Scholar] [CrossRef] [PubMed]
- Kong, Q.; Beel, J.A.; Lillehei, K.O. A threshold concept for cancer therapy. Med. Hypotheses 2000, 55, 29–35. [Google Scholar] [CrossRef]
- Golz, A.C.; Bergemann, C.; Hildebrandt, F.; Emmert, S.; Nebe, B.; Rebl, H. Selective adhesion inhibition and hyaluronan envelope reduction of dermal tumor cells by cold plasma-activated medium. Cell Adhes. Migr. 2023, 17, 1–19. [Google Scholar] [CrossRef]
- Jung, B.J.; Yoo, H.S.; Shin, S.; Park, Y.J.; Jeon, S.M. Dysregulation of NRF2 in Cancer: From Molecular Mechanisms to Therapeutic Opportunities. Biomol. Ther. 2018, 26, 57–68. [Google Scholar] [CrossRef]
- Ramisetti, S.V.; Patra, T.; Munirathnam, V.; Sainath, J.V.; Veeraiyan, D.; Namani, A. NRF2 Signaling Pathway in Chemo/Radio/Immuno-Therapy Resistance of Lung Cancer: Looking Beyond the Tip of the Iceberg. Arch. Bronconeumol. 2024; in press. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Dong, M.; Li, J.; Sun, Y.; Gao, Y.; Wang, Y.; Du, L.; Liu, Y.; Ji, K.; He, N.; et al. NRF2 promotes radiation resistance by cooperating with TOPBP1 to activate the ATR-CHK1 signaling pathway. Theranostics 2024, 14, 681–698. [Google Scholar] [CrossRef]
- Wang, X.-J.; Sun, Z.; Villeneuve, N.F.; Zhang, S.; Zhao, F.; Li, Y.; Chen, W.; Yi, X.; Zheng, W.; Wondrak, G.T.; et al. Nrf2 enhances resistance of cancer cells to chemotherapeutic drugs, the dark side of Nrf2. Carcinogenesis 2008, 29, 1235–1243. [Google Scholar] [CrossRef]
- Schmidt, A.; Dietrich, S.; Steuer, A.; Weltmann, K.-D.; von Woedtke, T.; Masur, K.; Wende, K. Non-thermal plasma activates human keratinocytes by stimulation of antioxidant and phase II pathways. J. Biol. Chem. 2015, 290, 6731–6750. [Google Scholar] [CrossRef]
- Bekeschus, S.; Clemen, R.; Nießner, F.; Sagwal, S.K.; Freund, E.; Schmidt, A. Medical Gas Plasma Jet Technology Targets Murine Melanoma in an Immunogenic Fashion. Adv. Sci. 2020, 7, 1903438. [Google Scholar] [CrossRef]
- Sun, Z.; Wu, T.; Zhao, F.; Lau, A.; Birch, C.M.; Zhang, D.D. KPNA6 (Importin α7)-mediated nuclear import of Keap1 represses the Nrf2-dependent antioxidant response. Mol. Cell. Biol. 2011, 31, 1800–1811. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.; Zhang, S.; Chan, J.Y.; Zhang, D.D. Keap1 controls postinduction repression of the Nrf2-mediated antioxidant response by escorting nuclear export of Nrf2. Mol. Cell. Biol. 2007, 27, 6334–6349. [Google Scholar] [CrossRef]
- Velichkova, M.; Hasson, T. Keap1 regulates the oxidation-sensitive shuttling of Nrf2 into and out of the nucleus via a Crm1-dependent nuclear export mechanism. Mol. Cell. Biol. 2005, 25, 4501–4513. [Google Scholar] [CrossRef]
- Stewart, D.; Killeen, E.; Naquin, R.; Alam, S.; Alam, J. Degradation of transcription factor Nrf2 via the ubiquitin-proteasome pathway and stabilization by cadmium. J. Biol. Chem. 2003, 278, 2396–2402. [Google Scholar] [CrossRef]
- Itoh, K.; Wakabayashi, N.; Katoh, Y.; Ishii, T.; O’Connor, T.; Yamamoto, M. Keap1 regulates both cytoplasmic-nuclear shuttling and degradation of Nrf2 in response to electrophiles. Genes Cells 2003, 8, 379–391. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, A.; Kang, M.-I.; Okawa, H.; Ohtsuji, M.; Zenke, Y.; Chiba, T.; Igarashi, K.; Yamamoto, M. Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol. Cell. Biol. 2004, 24, 7130–7139. [Google Scholar] [CrossRef] [PubMed]
- Hanahan, D.; Weinberg, R.A. The hallmarks of cancer. Cell 2000, 100, 57–70. [Google Scholar] [CrossRef]
- Adams, J.M.; Cory, S. The Bcl-2 apoptotic switch in cancer development and therapy. Oncogene 2007, 26, 1324–1337. [Google Scholar] [CrossRef]
- Kaltschmidt, B.; Kaltschmidt, C.; Hofmann, T.G.; Hehner, S.P.; Dröge, W.; Schmitz, M.L. The pro- or anti-apoptotic function of NF-kappaB is determined by the nature of the apoptotic stimulus. Eur. J. Biochem. 2000, 267, 3828–3835. [Google Scholar] [CrossRef]
- Yan, X.; Zou, F.; Zhao, S.; Lu, X.; He, G.; Xiong, Z.; Xiong, Q.; Zhao, Q.; Deng, P.; Huang, J.; et al. On the Mechanism of Plasma Inducing Cell Apoptosis. IEEE Trans. Plasma Sci. 2010, 38, 2451–2457. [Google Scholar] [CrossRef]
- Eliseev, R.A.; Zuscik, M.J.; Schwarz, E.M.; O’Keefe, R.J.; Drissi, H.; Rosier, R.N. Increased radiation-induced apoptosis of Saos2 cells via inhibition of NFkappaB: A role for c-Jun N-terminal kinase. J. Cell. Biochem. 2005, 96, 1262–1273. [Google Scholar] [CrossRef]
- Nakaya, A.; Sagawa, M.; Muto, A.; Uchida, H.; Ikeda, Y.; Kizaki, M. The gold compound auranofin induces apoptosis of human multiple myeloma cells through both down-regulation of STAT3 and inhibition of NF-kappaB activity. Leuk. Res. 2011, 35, 243–249. [Google Scholar] [CrossRef] [PubMed]
- Peng, L.; Linghu, R.; Chen, D.; Yang, J.; Kou, X.; Wang, X.Z.; Hu, Y.; Jiang, Y.Z.; Yang, J. Inhibition of glutathione metabolism attenuates esophageal cancer progression. Exp. Mol. Med. 2017, 49, e318. [Google Scholar] [CrossRef] [PubMed]
- Teng, J.-F.; Mei, Q.-B.; Zhou, X.-G.; Tang, Y.; Xiong, R.; Qiu, W.-Q.; Pan, R.; Law, B.Y.-K.; Wong, V.K.-W.; Yu, C.-L.; et al. Polyphyllin VI Induces Caspase-1-Mediated Pyroptosis via the Induction of ROS/NF-κB/NLRP3/GSDMD Signal Axis in Non-Small Cell Lung Cancer. Cancers 2020, 12, 193. [Google Scholar] [CrossRef]
- Zheng, Z.; Bian, Y.; Zhang, Y.; Ren, G.; Li, G. Metformin activates AMPK/SIRT1/NF-κB pathway and induces mitochondrial dysfunction to drive caspase3/GSDME-mediated cancer cell pyroptosis. Cell Cycle 2020, 19, 1089–1104. [Google Scholar] [CrossRef]
- Lee, D.-F.; Hung, M.-C. Advances in Targeting IKK and IKK-Related Kinases for Cancer Therapy. Clin. Cancer Res. 2008, 14, 5656–5662. [Google Scholar] [CrossRef]
- Durand, J.K.; Zhang, Q.; Baldwin, A.S. Roles for the IKK-Related Kinases TBK1 and IKKε in Cancer. Cells 2018, 7, 139. [Google Scholar] [CrossRef]
- Greten, F.R.; Karin, M. The IKK/NF-kappaB activation pathway-a target for prevention and treatment of cancer. Cancer Lett. 2004, 206, 193–199. [Google Scholar] [CrossRef]
- Baumgartner, B.; Weber, M.; Quirling, M.; Fischer, C.; Page, S.; Adam, M.; von Schilling, C.; Waterhouse, C.; Schmid, C.; Neumeier, D.; et al. Increased IκB kinase activity is associated with activated NF-κB in acute myeloid blasts. Leukemia 2002, 16, 2062–2071. [Google Scholar] [CrossRef]
- Kang, K.H.; Lee, K.H.; Kim, M.Y.; Choi, K.H. Caspase-3-mediated cleavage of the NF-kappa B subunit p65 at the NH2 terminus potentiates naphthoquinone analog-induced apoptosis. J. Biol. Chem. 2001, 276, 24638–24644. [Google Scholar] [CrossRef] [PubMed]
- Neuzil, J.; Schröder, A.; von Hundelshausen, P.; Zernecke, A.; Weber, T.; Gellert, N.; Weber, C. Inhibition of inflammatory endothelial responses by a pathway involving caspase activation and p65 cleavage. Biochemistry 2001, 40, 4686–4692. [Google Scholar] [CrossRef] [PubMed]
- Ozcan, L.; Tabas, I. Role of endoplasmic reticulum stress in metabolic disease and other disorders. Annu. Rev. Med. 2012, 63, 317–328. [Google Scholar] [CrossRef]
- Schröder, M. Endoplasmic reticulum stress responses. Cell. Mol. Life Sci. 2008, 65, 862–894. [Google Scholar] [CrossRef] [PubMed]
- Bravo, R.; Parra, V.; Gatica, D.; Rodriguez, A.E.; Torrealba, N.; Paredes, F.; Wang, Z.V.; Zorzano, A.; Hill, J.A.; Jaimovich, E.; et al. Endoplasmic reticulum and the unfolded protein response: Dynamics and metabolic integration. Int. Rev. Cell Mol. Biol. 2013, 301, 215–290. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Ke, Z.; Luo, J. Thiamine Deficiency and Neurodegeneration: The Interplay Among Oxidative Stress, Endoplasmic Reticulum Stress, and Autophagy. Mol. Neurobiol. 2017, 54, 5440–5448. [Google Scholar] [CrossRef]
- Kumara, M.H.S.R.; Piao, M.J.; Kang, K.A.; Ryu, Y.S.; Park, J.E.; Shilnikova, K.; Jo, J.O.; Mok, Y.S.; Shin, J.H.; Park, Y.; et al. Non-thermal gas plasma-induced endoplasmic reticulum stress mediates apoptosis in human colon cancer cells. Oncol. Rep. 2016, 36, 2268–2274. [Google Scholar] [CrossRef]
- Naon, D.; Scorrano, L. At the right distance: ER-mitochondria juxtaposition in cell life and death. Biochim. Biophys. Acta 2014, 1843, 2184–2194. [Google Scholar] [CrossRef]
- Raturi, A.; Simmen, T. Where the endoplasmic reticulum and the mitochondrion tie the knot: The mitochondria-associated membrane (MAM). Biochim. Biophys. Acta 2013, 1833, 213–224. [Google Scholar] [CrossRef]
- Andreyev, A.; Fiskum, G. Calcium induced release of mitochondrial cytochrome c by different mechanisms selective for brain versus liver. Cell Death Differ. 1999, 6, 825–832. [Google Scholar] [CrossRef]
- Green, D.R.; Reed, J.C. Mitochondria and apoptosis. Science 1998, 281, 1309–1312. [Google Scholar] [CrossRef] [PubMed]
- Bekeschus, S.; von Woedtke, T.; Kramer, A.; Weltmann, K.-D.; Masur, K. Cold Physical Plasma Treatment Alters Redox Balance in Human Immune Cells. Plasma Med. 2013, 3, 267–278. [Google Scholar] [CrossRef]
- Semmler, M.L.; Bekeschus, S.; Schäfer, M.; Bernhardt, T.; Fischer, T.; Witzke, K.; Seebauer, C.; Rebl, H.; Grambow, E.; Vollmar, B.; et al. Molecular Mechanisms of the Efficacy of Cold Atmospheric Pressure Plasma (CAP) in Cancer Treatment. Cancers 2020, 12, 269. [Google Scholar] [CrossRef]
- Ahn, H.J.; Kim, K.I.; Kim, G.; Moon, E.; Yang, S.S.; Lee, J.-S. Atmospheric-pressure plasma jet induces apoptosis involving mitochondria via generation of free radicals. PLoS ONE 2011, 6, e28154. [Google Scholar] [CrossRef]
- Wardyn, J.D.; Ponsford, A.H.; Sanderson, C.M. Dissecting molecular cross-talk between Nrf2 and NF-κB response pathways. Biochem. Soc. Trans. 2015, 43, 621–626. [Google Scholar] [CrossRef]
- Gloire, G.; Legrand-Poels, S.; Piette, J. NF-kappaB activation by reactive oxygen species: Fifteen years later. Biochem. Pharmacol. 2006, 72, 1493–1505. [Google Scholar] [CrossRef]
- Mohora, M.; Greabu, M.; Totan, A.; Mitrea, N.; Battino, M. Redox-sensitive signaling factors and antioxidants. Farmacia 2009, 57, 399–411. [Google Scholar]
- Nishi, T.; Shimizu, N.; Hiramoto, M.; Sato, I.; Yamaguchi, Y.; Hasegawa, M.; Aizawa, S.; Tanaka, H.; Kataoka, K.; Watanabe, H.; et al. Spatial redox regulation of a critical cysteine residue of NF-kappa B in vivo. J. Biol. Chem. 2002, 277, 44548–44556. [Google Scholar] [CrossRef] [PubMed]
- Hirota, K.; Murata, M.; Sachi, Y.; Nakamura, H.; Takeuchi, J.; Mori, K.; Yodoi, J. Distinct roles of thioredoxin in the cytoplasm and in the nucleus. A two-step mechanism of redox regulation of transcription factor NF-kappaB. J. Biol. Chem. 1999, 274, 27891–27897. [Google Scholar] [CrossRef]
- Liu, G.-H.; Qu, J.; Shen, X. NF-kappaB/p65 antagonizes Nrf2-ARE pathway by depriving CBP from Nrf2 and facilitating recruitment of HDAC3 to MafK. Biochim. Biophys. Acta 2008, 1783, 713–727. [Google Scholar] [CrossRef]
- Yu, M.; Li, H.; Liu, Q.; Liu, F.; Tang, L.; Li, C.; Yuan, Y.; Zhan, Y.; Xu, W.; Li, W.; et al. Nuclear factor p65 interacts with Keap1 to repress the Nrf2-ARE pathway. Cell. Signal. 2011, 23, 883–892. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-E.; You, D.-J.; Lee, C.; Ahn, C.; Seong, J.Y.; Hwang, J.-I. Suppression of NF-kappaB signaling by KEAP1 regulation of IKKbeta activity through autophagic degradation and inhibition of phosphorylation. Cell. Signal. 2010, 22, 1645–1654. [Google Scholar] [CrossRef] [PubMed]
- Levrand, S.; Pesse, B.; Feihl, F.; Waeber, B.; Pacher, P.; Rolli, J.; Schaller, M.D.; Liaudet, L. Peroxynitrite is a potent inhibitor of NF-kappa B activation triggered by inflammatory stimuli in cardiac and endothelial cell lines. J. Biol. Chem. 2005, 280, 34878–34887. [Google Scholar] [CrossRef] [PubMed]
- Ulasov, A.V.; Rosenkranz, A.A.; Georgiev, G.P.; Sobolev, A.S. Nrf2/Keap1/ARE signaling: Towards specific regulation. Life Sci. 2022, 291, 120111. [Google Scholar] [CrossRef] [PubMed]
- Kopacz, A.; Kloska, D.; Forman, H.J.; Jozkowicz, A.; Grochot-Przeczek, A. Beyond repression of Nrf2: An update on Keap1. Free Radic. Biol. Med. 2020, 157, 63–74. [Google Scholar] [CrossRef] [PubMed]
- Townsend, B.E.; Johnson, R.W. Sulforaphane induces Nrf2 target genes and attenuates inflammatory gene expression in microglia from brain of young adult and aged mice. Exp. Gerontol. 2016, 73, 42–48. [Google Scholar] [CrossRef]
- Kobayashi, E.H.; Suzuki, T.; Funayama, R.; Nagashima, T.; Hayashi, M.; Sekine, H.; Tanaka, N.; Moriguchi, T.; Motohashi, H.; Nakayama, K.; et al. Nrf2 suppresses macrophage inflammatory response by blocking proinflammatory cytokine transcription. Nat. Commun. 2016, 7, 11624. [Google Scholar] [CrossRef]
- Kalyanaraman, B. Teaching the basics of redox biology to medical and graduate students: Oxidants, antioxidants and disease mechanisms. Redox Biol. 2013, 1, 244–257. [Google Scholar] [CrossRef]
- Chen, X.-L.; Kunsch, C. Induction of cytoprotective genes through Nrf2/antioxidant response element pathway: A new therapeutic approach for the treatment of inflammatory diseases. Curr. Pharm. Des. 2004, 10, 879–891. [Google Scholar] [CrossRef]
- Lin, A.; Truong, B.; Patel, S.; Kaushik, N.; Choi, E.H.; Fridman, G.; Fridman, A.; Miller, V. Nanosecond-Pulsed DBD Plasma-Generated Reactive Oxygen Species Trigger Immunogenic Cell Death in A549 Lung Carcinoma Cells through Intracellular Oxidative Stress. Int. J. Mol. Sci. 2017, 18, 966. [Google Scholar] [CrossRef]
- Bekeschus, S.; Eisenmann, S.; Sagwal, S.K.; Bodnar, Y.; Moritz, J.; Poschkamp, B.; Stoffels, I.; Emmert, S.; Madesh, M.; Weltmann, K.-D.; et al. xCT (SLC7A11) expression confers intrinsic resistance to physical plasma treatment in tumor cells. Redox Biol. 2020, 30, 101423. [Google Scholar] [CrossRef] [PubMed]
- Matata, B.M.; Galinanes, M. Peroxynitrite is an essential component of cytokines production mechanism in human monocytes through modulation of nuclear factor-kappa B DNA binding activity. J. Biol. Chem. 2002, 277, 2330–2335. [Google Scholar] [CrossRef] [PubMed]
- Park, S.W.; Huq, M.D.; Hu, X.; Wei, L.N. Tyrosine nitration on p65: A novel mechanism to rapidly inactivate nuclear factor-kappaB. Mol. Cell. Proteom. 2005, 4, 300–309. [Google Scholar] [CrossRef] [PubMed]
- Pacher, P.; Beckman, J.S.; Liaudet, L. Nitric oxide and peroxynitrite in health and disease. Physiol. Rev. 2007, 87, 315–424. [Google Scholar] [CrossRef] [PubMed]
- Boukamp, P.; Petrussevska, R.T.; Breitkreutz, D.; Hornung, J.; Markham, A.; Fusenig, N.E. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J. Cell Biol. 1988, 106, 761–771. [Google Scholar] [CrossRef]
- Weltmann, K.; Kindel, E.; Brandenburg, R.; Meyer, C.; Bussiahn, R.; Wilke, C.; von Woedtke, T. Atmospheric Pressure Plasma Jet for Medical Therapy: Plasma Parameters and Risk Estimation. Contrib. Plasma Phys. 2009, 49, 631–640. [Google Scholar] [CrossRef]
- Bergemann, C.; Gerling, T.; Hoppe, C.; Karmazyna, M.; Höntsch, M.; Eggert, M.; Nebe, B. Physicochemical Analysis of Argon Plasma-Treated Cell Culture Medium. In Plasma Science and Technology—Progress in Physical States and Chemical Reactions; Mieno, T., Ed.; InTech: Rijeka, Croatia, 2016. [Google Scholar] [CrossRef]
- Budde-Sagert, K. readCzi: readCzi: R Package to Read CZI Image Files, Convert Them to tifs, and Save Metadata; v0.4.1; Zenodo: Geneva, Switzerland, 2024. [Google Scholar] [CrossRef]
- Budde-Sagert, K. cellPixels: Identify and Analyze Nuclei and Cytosol Regions; v0.2.11; Zenodo: Geneva, Switzerland, 2024. [Google Scholar] [CrossRef]
- Perez, L.J.; Rios, L.; Trivedi, P.; D’souza, K.; Cowie, A.; Nzirorera, C.; Webster, D.; Brunt, K.; Legare, J.-F.; Hassan, A.; et al. Validation of optimal reference genes for quantitative real time PCR in muscle and adipose tissue for obesity and diabetes research. Sci. Rep. 2017, 7, 3612. [Google Scholar] [CrossRef]
- Brunner, T.F.; Probst, F.A.; Troeltzsch, M.; Schwenk-Zieger, S.; Zimmermann, J.L.; Morfill, G.; Becker, S.; Harréus, U.; Welz, C. Primary cold atmospheric plasma combined with low dose cisplatin as a possible adjuvant combination therapy for HNSCC cells—An in-vitro study. Head Face Med. 2022, 18, 21. [Google Scholar] [CrossRef]
- Dezhpour, A.; Ghafouri, H.; Jafari, S.; Nilkar, M. Effects of cold atmospheric-pressure plasma in combination with doxorubicin drug against breast cancer cells in vitro and invivo. Free Radic. Biol. Med. 2023, 209 Pt 2, 202–210. [Google Scholar] [CrossRef]
- Girard, P.-M.; Arbabian, A.; Fleury, M.; Bauville, G.; Puech, V.; Dutreix, M.; Sousa, J.S. Synergistic Effect of H2O2 and NO2 in Cell Death Induced by Cold Atmospheric He Plasma. Sci. Rep. 2016, 6, 29098. [Google Scholar] [CrossRef]
- Kurake, N.; Tanaka, H.; Ishikawa, K.; Kondo, T.; Sekine, M.; Nakamura, K.; Kajiyama, H.; Kikkawa, F.; Mizuno, M.; Hori, M. Cell survival of glioblastoma grown in medium containing hydrogen peroxide and/or nitrite, or in plasma-activated medium. Arch. Biochem. Biophys. 2016, 605, 102–108. [Google Scholar] [CrossRef] [PubMed]
- Wink, D.A.; Hanbauer, I.; Krishna, M.C.; DeGraff, W.; Gamson, J.; Mitchell, J.B. Nitric oxide protects against cellular damage and cytotoxicity from reactive oxygen species. Proc. Natl. Acad. Sci. USA 1993, 90, 9813–9817. [Google Scholar] [CrossRef] [PubMed]
- Metelmann, H.-R.; Seebauer, C.; Miller, V.; Fridman, A.; Bauer, G.; Graves, D.B.; Pouvesle, J.-M.; Rutkowski, R.; Schuster, M.; Bekeschus, S.; et al. Clinical experience with cold plasma in the treatment of locally advanced head and neck cancer. Clin. Plasma Med. 2018, 9, 6–13. [Google Scholar] [CrossRef]
- Chen, S.; Sang, N. Hypoxia-Inducible Factor-1: A Critical Player in the Survival Strategy of Stressed Cells. J. Cell. Biochem. 2016, 117, 267–278. [Google Scholar] [CrossRef]






| Gene Symbol | Gene Product | Function | NCBI Accession Code | Sense and Antisense Primer (5′-3′) | Primer Efficiency [%] | Amplicon Length [bp] |
|---|---|---|---|---|---|---|
| Target genes: | ||||||
| CALR | Calreticulin | Calcium homeostasis | NM_004343 | CAGGTCAAGTCTGGCACCATC, GCGTAACAAAGGCAGCAGAGAA | 89.5 | 107 |
| CXCL8 | C-X-C motif chemokine ligand 8 (interleukin-8) | Chemotaxis and immunoregulation | NM_000584 | AGATGTCAGTGCATAAAGACATAC, TCTGTCTGGACCCCAAGGAAAA | 101.7 | 152 |
| GPX1 | Glutathione peroxidase 1 | Protecting from oxidative damage | NM_000581 | ATCAGGAGAACGCCAAGAACGA, TCATGCTCTTCGAGAAGTGCGA | 102.3 | 100 |
| HMOX1 | Heme oxygenase 1 | Protection from oxidative damage | NM_002133 | CGTTCCTGCTCAACATCCAGCT, GATTCTGCCCCCGTGGAGAC | 97.1 | 139 |
| IL1B | Interleukin-1 beta | Inflammation | NM_000576 | GTACAAGGAGAAGAAAGTAATGAC, CAAAGAAGAAGATGGAAAAGCGAT | 112.1 | 157 |
| IL6 | Interleukin-6 | Inflammation | NM_000600 | AGTAACATGTGTGAAAGCAGCAAA, TGGTCTTTTGGAGTTTGAGGTATA | 102.0 | 152 |
| SLC7A11 | Solute carrier family 7 member 11 | Glutathione production | NM_014331 | CAAGGTGCCACTGTTCATCCC, TACAGGGATTGGCTTCGTCATC | 102.2 | 106 |
| TGFB1 | Transforming growth factor beta 1 | Control of cell growth, proliferation and differentiation | NM_000660 | AGCACGTGGAGCTGTACCAGA, CCTTAGCGCCCACTGCTCCT | 98.7 | 177 |
| TNF | Tumour necrosis factor alpha | Inflammation | NM_000594 | GGCCCCCAGAGGGAAGAGTT, AGTCAGATCATCTTCTCGAACCC | 99.0 | 82 |
| Reference genes: | ||||||
| KRT14 | Keratin 14 | Cytoskeleton formation | NM_000526 | GAGGAGATGAATGCCCTGAGAG, AAGGATGCCGAGGAATGGTTCT | N/A | 157 |
| RPL13A | Ribosomal protein L13a | Protein synthesis | NM_012423 | CAAGCGGATGAACACCAACCC, CCACAAAACCAAGCGAGGCCA | N/A | 111 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Manzhula, K.; Rebl, A.; Budde-Sagert, K.; Rebl, H. Interplay of Cellular Nrf2/NF-κB Signalling after Plasma Stimulation of Malignant vs. Non-Malignant Dermal Cells. Int. J. Mol. Sci. 2024, 25, 10967. https://doi.org/10.3390/ijms252010967
Manzhula K, Rebl A, Budde-Sagert K, Rebl H. Interplay of Cellular Nrf2/NF-κB Signalling after Plasma Stimulation of Malignant vs. Non-Malignant Dermal Cells. International Journal of Molecular Sciences. 2024; 25(20):10967. https://doi.org/10.3390/ijms252010967
Chicago/Turabian StyleManzhula, Kristina, Alexander Rebl, Kai Budde-Sagert, and Henrike Rebl. 2024. "Interplay of Cellular Nrf2/NF-κB Signalling after Plasma Stimulation of Malignant vs. Non-Malignant Dermal Cells" International Journal of Molecular Sciences 25, no. 20: 10967. https://doi.org/10.3390/ijms252010967
APA StyleManzhula, K., Rebl, A., Budde-Sagert, K., & Rebl, H. (2024). Interplay of Cellular Nrf2/NF-κB Signalling after Plasma Stimulation of Malignant vs. Non-Malignant Dermal Cells. International Journal of Molecular Sciences, 25(20), 10967. https://doi.org/10.3390/ijms252010967

