Differential Modulation of Mouse Intestinal Organoids with Fecal Luminal Factors from Obese, Allergic, Asthmatic Children
by
, , , , and
Samir Córdova
1
,
Mireia Tena-Garitaonaindia
1,
Ana Isabel Álvarez-Mercado
1,2,
Reyes Gámez-Belmonte
3,
Mª Amelia Gómez-Llorente
2,4,
Fermín Sánchez de Medina
2,3,5
,
Ana Martínez-Cañavate
4,
Olga Martínez-Augustin
1,2,5,* and
Carolina Gómez-Llorente
1,2,6,7 1
Departamento de Bioquímica y Biología Molecular II, Facultad de Farmacia, Campus de Cartuja s/n, Universidad de Granada, 18071 Granada, Spain
2
Ibs.GRANADA, 18012 Granada, Spain
3
Departamento de Farmacología, Facultad de Farmacia, Universidad de Granada, 18071 Granada, Spain
4
Unidad de Pediatría, Hospital Materno-Infantil, 18071 Granada, Spain
5
Centro de Investigación Biomédica en Red-Enfermedades Hepáticas y Digestivas (CIBERehd), Spain
6
Instituto de Nutrición y Tecnología de los Alimento José Mataix, 18071 Granada, Spain
7
Centro de Investigación Biomédica en Red-Obesidad (CIBERobn), Spain
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(2), 866; https://doi.org/10.3390/ijms25020866
Submission received: 18 December 2023
/
Revised: 29 December 2023
/
Accepted: 3 January 2024
/
Published: 10 January 2024
(This article belongs to the Special Issue Diet and Metabolism: Molecular Mechanisms of Health and Disease 2.0)
Abstract
:Asthma is a multifactorial condition that can be associated with obesity. The phenotypes of asthma in lean and obese patients are different, with proinflammatory signatures being further elevated in the latter. Both obesity and asthma are associated with alterations in intestinal barrier function and immunity, and with the composition of the intestinal microbiota and food consumption. In this study, we aimed to establish an organoid model to test the hypothesis that the intestinal content of lean and obese, allergic, asthmatic children differentially regulates epithelial intestinal gene expression. A model of mouse jejunum intestinal organoids was used. A group of healthy, normal-weight children was used as a control. The intestinal content of asthmatic obese children differentially induced the expression of inflammatory and mitochondrial response genes (Tnf-tumor necrosis factor, Cd14, Muc13-mucin 13, Tff2-Trefoil factor 2 and Tff3, Cldn1-claudin 1 and 5, Reg3g-regenerating family member 3 gamma, mt-Nd1-NADH dehydrogenase 1 and 6, and mt-Cyb-mitochondrial cytochrome b) via the RAGE-advanced glycosylation end product-specific receptor, NF-κB-nuclear factor kappa b and AKT kinase signal transduction pathways. Fecal homogenates from asthmatic normal-weight and obese children induce a differential phenotype in intestinal organoids, in which the presence of obesity plays a major role.
1. Introduction
Asthma is a chronic inflammatory disorder characterized by a reversible airflow obstruction, with airway inflammation playing a central role in its pathogenesis [1,2]. Different underlying molecular mechanisms define asthma endotypes, which are linked to different phenotypes. In this regard, obesity has been found to be a distinguishing variable in the classification of asthma subtypes [3,4]. Obese asthmatic patients are prone to corticoid resistance and have a higher risk of being hospitalized [5,6]. Asthma and obesity are both considered chronic inflammatory disorders, and the features of inflammation in these conditions are enhanced when combined [4]. The risk and severity of asthma and obesity have been associated with alterations in immunity and the intestinal microbiome, and therefore, with alterations in the mucosal barrier’s function [7]. In fact, we have previously characterized the molecular heterogeneity of the allergic asthma phenotype in children (BIOASMA cohort) using a multi-omic approach combining clinical data, plasma and fecal inflammatory biomarkers, metagenomics and metabolomics [8]. In a similar way, Michalovich et al. showed changes in intestinal microbiota composition in asthmatic and obese patients that were increased in patients with both conditions and correlated with inflammatory markers in serum [4]. Additional effects on mucosal barrier disruption have also been observed in animal models that combine both conditions [9].
It is increasingly believed that diet and an altered gut microbiota may play an important role in the pathology of asthma and obesity. The intestinal epithelium is a cell monolayer with an essential role in the mucosal barrier’s function, being the first line of defense against pathogenic bacteria [10]. It also interacts with luminal food components and commensal bacteria that, in turn, shape intestinal function, including the intestinal epithelium itself. Thus, the intestinal epithelial’s immune response, together with its epithelial permeability or proliferation and differentiation rates, are regulated by luminal contents. Gut metabolites jointly reflect diet intake, modified human metabolites, microbial metabolism and environmental chemical compounds, all of which shape the barrier’s function [11].
As the long-term culture of intestinal epithelial is generally not possible, up until a few years ago intestinal cell Iines were the only in vitro intestinal models available for testing the effects of molecules, including nutrients. Nevertheless, cultured cell lines, as a model, are very limited because of their immortalized nature and the lack of different cell types present in the intestinal epithelium [12]. Organoids, obtained from intestinal stem cells, contain all epithelial cell lines and overcome these limitations, being a much more physiological model. They can be obtained from any intestinal segment and from several species. As an available human tissue is needed to establish human organoids, it is quite difficult to obtain small intestinal organoids of human origin. Hence, we planned to use a model of mouse organoids, avoiding the use of invasive techniques in human beings, as a physiologically relevant model to study disease-dependent dysfunction in the intestinal epithelial barrier. Therefore, in the present study, we aim to ascertain whether the intestinal content of children with asthma alone or in combination with obesity (BIOASMA cohort) differentially regulates the intestinal epithelium using a model of mouse jejunum organoids.
Fecal homogenates from normal weight and obese asthmatic children were added to a cell culture medium and the expression of intestinal barrier, immune and mitochondrial respiratory chain genes were studied. Fecal homogenates from normal weight healthy children were used as a control.
2. Results
2.1. Cohort Description
Normal weight and obese asthmatic prepubertal children from the BIOASMA cohort [8] were included in our study. The clinical characteristics of these children are shown in Table 1, together with plasma determinations and fecal D-lactate concentrations, for reference. Simultaneous T-test analysis followed by a correction of multiple comparisons using the Holm–Sidak method showed that, as expected, BMI (Body mass index) and BMIZ (Age and sex standardized body mass index) scores were higher in asthmatic obese (AO) children. Leptin concentration in the plasma of obese children was also higher than in that of normal weight participants. No differences were observed in other measured parameters (Table 1).
2.2. Fecal Waters from Overweight but Not Normal-Weight Allergic–Asthmatic Children Induce the Expression of Proinflammatory and Intestinal Barrier Function Genes
Changes in the intestinal barrier’s function and inflammation have been described in asthma and obesity. Our first goal was to study whether the intestinal content of A and AO children was able to modulate the expression of genes that regulate these functions. To this end, we added fecal homogenates to the cell culture medium of mouse jejunum organoids. For this analysis we also included feces from a group of prepubertal healthy children (H). Our data indicate that Tnf (Tumor necrosis factor) and Nos2 (Nitric oxide synthase 2), traditional markers of inflammation, were induced in mouse jejunum organoids after the addition of homogenates from AO children when compared to the addition of A homogenates (Figure 1A). The same effect was observed for Nt5e, which codifies an ectonucleotidase, and CD73, which plays a major role in the local production of anti-inflammatory adenosine. Cd14, a co-receptor of TLR4 which recognizes pathogen-associated molecular patterns, was also significantly stimulated by AO homogenates when compared to all the other groups assayed. Cxcl9 and Cxcl10 are chemokines which are important in antibacterial defense. The ANOVA p value for Cxcl9, with a fold change of 4.33 compared with the H group, indicated a tendency for significance (p = 0.061). In turn, A homogenates only produced a decrease in Tnf expression when compared to H homogenates, and no effect of H homogenates was observed (Figure 1A).
Mucins are a key component in intestinal mucus, protecting the epithelium from bacterial invasion. Together with trefoil factors (TFFs), which are mucin-associated secretory molecules, mucins contribute to the intestinal barrier’s function and are mainly produced by goblet cells. The expression of Muc13 and genes encoding TFF2 and 3 (Tff2 and Tff3) was induced by the addition of fecal waters from AO children to the culture media of mouse jejunum organoids (Figure 1B). A similar pattern was observed for Reg3g (Regenerating family member 3 gamma), whose expression was statistically induced when compared to that of the control (C) organoids. This gene codifies a lectin that is an important component of the intestinal barrier, maintaining the segregation of bacteria from the host. Although there are other Reg3 gamma proteins, Reg3γ is the homolog for human REG3A, which is the one expressed at the highest levels in the human small intestine [13]. No effects of A or H homogenates were observed, except for an inhibition of Tff3 in the A group when compared to the H group (Figure 1B).
The maintenance of physiological intestinal permeability is essential for intestinal barrier function. Alterations in this permeability have been related to both asthma and obesity. Claudin 1, 4 and 5, and zonulae occludens-1 (ZO-1), are part of the tight junctions proteins that regulate intestinal permeability. A study of the expression of genes that codify these proteins indicated that Cldn1 and Cldn5 were increased in the AO group when compared to the A group (Figure 1C). In turn, a decrease in Cldn1 expression in A vs. H was observed. ANOVA analysis of Cldn4 and Tjp1 (which codifies ZO-1) indicated no specific differences between the groups, although the ANOVA p value was 0.011 in the first case, and pairwise T-tests between C and AO and H and AO were significant.
Cnr1 encodes the cannabinoid receptor 1, whose expression has been shown to be induced in inflammatory conditions and seems to be related to the regulation of intestinal permeability when a high-fat diet is administered [14]. The expression of Cnr1 was induced by the homogenate of feces from AO children when compared to the other study groups (Figure 2).
Correlations between measured parameters in intestinal organoids were studied to further characterize the differential effect of the intestinal content from A and AO children (Table 2 and Table 3). Multiple correlations were found for both groups in this analysis, showing the strong relationship between the parameters studied. All significant correlations found between parameters in the AO group were positive (Table 3), while some negative correlations were found in the A group (Table 2). Thus, Tff2 and Tff3 were negatively correlated with Muc13. Tff3 also was negatively correlated with Cldn4, Cldn5 and Cxcl10. Finally, a negative correlation in the A group was also found between Tlr4 and Cldn5 and between Tnf and Tlr4. Tnf is one of the most relevant molecules involved in intestinal inflammation. Figure 3A shows radial charts for the correlations found for Tnf in order to illustrate the differences between the A and AO groups. Both Cldn5 and Cxcl10 were positively and strongly correlated with Tnf in both groups, while the barrier function parameters (Muc2, Muc3 and Tff2) were only positively correlated with Tnf in the AO group. Correlations with Tlr4 (negative) and Nt5e (positive) were found in the A group and not in the AO group. No correlations were found with any parameters in the A group (Figure 3D).
Fecal D-lactate originates from intestinal bacteria in the intestine. Although the levels measured in both groups were very similar, the correlations found with parameters determined in organoids were very different. A highly significant positive correlation was found for Cldn4 and Cldn5, and Cxcl10 and Nt5e in the AO group, while negative correlations were found for Cldn5, Muc3 and Tnf in the A group (Figure 3B).
To further establish the relationship between allergic asthma associated with obesity and the parameters of intestinal barrier function and inflammation, we used correlation analyses. Correlations of Tnf with systemic parameters further indicated differences between both groups. Thus, while in group A, Tnf was positively correlated with the asthma degree, in the AO group, it positively correlated with the HOMA (Homeostasis model assessment) index and resistin, indicating that, in the case of AO, changes in feces induced by obesity are more important than those promoted by allergies (Figure 3A). This hypothesis was reinforced by the fact that asthma degree and BMI were correlated with distinct parameters in the A and the AO groups, respectively (Figure 3C,D). Thus, a positive correlation of asthma with systemic IL-10 and organoid expression of Tnf, Cxcl10, Cldn5, Cldn4 in the A group was found (Figure 3C). In contrast, no significant correlations were observed between asthma degree and any of these parameters in the AO group. In turn, BMI correlated positively with Tff1 and Tff2 and negatively with Tjp1 in the AO group, while no correlations were found with any parameters in the A group (Figure 3D).
2.3. RAGE, IP3K and NFκB Mediate the Induction of the Expression of Intestinal Barrier Function-Related Genes by Fecal Waters of Obese Allergic Children
The involvement of three main signal transduction elements (NFκB, IP3K and RAGE) in the effect of the fecal waters from AO children on intestinal gene expression was assessed next. Our results indicate that the studied elements are important in the observed effects, with RAGE apparently being a common mediator in the response of the assessed genes (Figure 4). In fact, the addition of the RAGE inhibitor N-benzyl-4-chloro-N-cycohexylbenzamid (FPS-ZM1) to the culture media of organoids before the AO fecal homogenates abrogated their effect on the expression of all the genes studied (Tnf, Cxcl10, Cldn5, Tff2, Tff1 and Reg3g). The NFκB inhibitor BAY11-7082 also strongly abrogated the response elicited by AO fecal homogenates in all these genes, except Tff2. Finally, wortmannin, the IP3K kinase inhibitor, prevented Tnf, Cxcl10 and Cldn5 responses.
2.4. Fecal Waters from Obese Allergic Children Induce the Expression of Mitochondrial Respiratory Chain Genes
Obesity, and its associated inflammatory process, may lead to an increased production of reactive oxygen species and cause oxidative stress. Moreover, excess nutrient supply can overwhelm the Krebs cycle and the mitochondrial respiratory chain, causing mitochondrial dysfunction that, in turn, increases the production of reactive oxygen species (ROS) and exacerbates the inflammatory process. Since a proinflammatory effect was observed for AO fecal waters, we aimed to study their effect on the expression of genes in the mitochondrial respiratory chain (Figure 5). The expression of respiratory chain genes from complexes I (mt-Nd1 and 6), III (mt-Cyb) and IV (mt-Co1 and 2) was assessed. In addition, mt-Atp6 and mitochondrial 12S and 16 rRNA genes (mt-Rnr1 and mt-Rnr2) were studied. AO fecal waters induced the expression of genes from complexes I and III and of mt-Co2. mt-Atp6 was not significantly induced (the ANOVA p-value was 0.07). Neither were the mitochondrial rRNA genes. No effects of A or H fecal waters were observed, except for the inhibition of the expression of mt-Rnr in the H group.
3. Discussion
Asthma and obesity are both related to an altered microbiota and intestinal barrier, thus, the combination of obesity and allergic asthma has been associated with more severe symptoms, a higher frequency of exacerbation episodes and a lower response to therapy [15]. Although the implication of the intestinal microbiota in both pathologies is well known, the pathophysiological relationship between the fecal content and intestinal function is not fully understood. In this study we have determined how the intestinal content of obese and normal-weight prepubertal allergic-asthmatic children can alter intestinal function. For that, we have used a model with mouse jejunal organoids that were cultured with fecal homogenates from these children, in order to characterize differences in the expression of genes which are relevant to immunological and intestinal barrier function. It is interesting to note that fecal homogenates were obtained after sonication and filtration, therefore no bacteria were present, only bacterial components and metabolites were included.
As previously described, the clinical characterization of our cohort revealed that obese asthmatic children presented not only a higher BMI, but also increased plasma leptin levels [8]. This hormone, produced by white adipose tissue, has been observed to be augmented in obese individuals, who develop resistance to the hormone, and as a consequence, a reduction in the feeling of satiety, leading to greater energy consumption. It has been described that, in obese asthmatic individuals, increased leptin levels could modify airway function and result in greater inflammation [16,17]. However, no other differences were found in plasma parameters in our cohort, indicating generally similar levels of asthma and systemic inflammation in both groups. We are aware that the sample size could be a limitation of our study, but this is mitigated by the substantial phenotypic differences originally observed in the cohort, which have also resulted in a differential profile of organoids.
Immunity, the mucus layer and the production of antibacterial peptides are important elements in the maintenance of intestinal barrier function [10]. In addition, adequate control of intestinal permeability is essential for the correct functioning of this barrier. Our results indicate that the feces of AO children, but not those of A children, induce the expression of inflammatory and intestinal barrier function genes. Specifically, in AO children-derived fecal waters, an increase in genes related to inflammation was observed, such as Tnf, Nos2, Cd14, Nt5e or Cnr1. Of note, the induction of inflammatory markers was accompanied by changes in genes associated with barrier function that, in general, tend to increase, perhaps to possibly counteract inflammatory effects. Thus, Tnf induction was, for example, positively related to the expression of genes related to intestinal barrier function (Cldn5, Muc3, Muc3 or Tff2) globally. Notably, barely any effect on gene expression was noted for fecal waters of healthy or nonobese asthmatic patients. In this regard, it is worth noting that our model made use of intact spheric organoids in which the luminal side of the epithelium faces the inner cavity. Therefore, in our study the homogenates were in contact with the basal side. It should be noted that the passage of 4 kDa, and even 10 kDa, molecules from the outside to the luminal side of organoids has been shown [18]. Therefore, at least small molecules would be in contact with this side of the organoids. In addition, even if large molecules are in contact only with the basal side, we consider this model valid since intestinal permeability has been shown to be altered in both obesity and asthma, and therefore the contact of bigger molecules with the basal side of the epithelium would take place in these diseases. This said, it is possible that this lack of effect of the bacterial homogenates of asthmatic, normal-weight and of non-asthmatic children could be due to the fact that large molecules do not have access to the luminal side.
At any rate, our results delineate a differential effect related to the microbiota or the fecal metabolites of these patients. Minimal differences in microbiota composition were previously found in our cohort, pointing to the probable pivotal role of the metabolite profile, which is currently under characterization. Accordingly, in future research we plan to delineate the effect of bacterial homogenates using open organoids (monolayers). Nevertheless, although obtaining open organoids is possible, in our experience it is a quite inefficient procedure that so far makes their use difficult in studies with many samples.
D-lactate is produced by intestinal bacteria and has been proposed as a marker of microbiota imbalance. Although no differences were found in the levels of this metabolite in the feces of obese and normal-weight asthmatic patients, our data indicate that, in asthma patients, they are directly correlated with the expression of inflammatory markers (Cxcl10, Nt5e, Cldn4 and Cldn5). In contrast, D-lactate negatively correlated with Muc3, Tnf and Cldn5 in obese asthmatic children. The above-mentioned data, together with the fact that the inhibition of RAGE, NFκB and AKT prevented the overexpression of genes in obese asthmatic fecal waters, indicate that different molecular pathways are activated in normal weight vs. obese children with asthma. RAGE was apparently a common mediator in the response of the assessed genes. This receptor is a mediator of intestinal inflammation. In fact, Rage−/− mice are less susceptible to developing intestinal and colonic inflammation than WT mice [13]. In addition, this is a receptor with a wide range of inflammation-related ligands, including, besides advanced glycation products, bacterial lipopolysaccharide or S100Ca2+-binding protein B (S100B) and calprotectin (S100A8/S100A9). The ablation of the inflammatory response after the addition of a RAGE inhibitor would be consistent with the proinflammatory effect of the molecules present in the feces of obese children.
Obesity leads to various changes in the body. Among them, the existing inflammatory process may increase the production of ROS and cause oxidative stress. Oxidative stress, in turn, can trigger mitochondrial dysfunction. It has been shown that high-fat diet consumption provokes a metabolic shift toward fatty acid β-oxidation in the small intestinal epithelial cells and impairs colonocyte mitochondrial function, possibly through the downstream consequences of excessive fatty acid β-oxidation and/or the presence of deleterious metabolites produced by the gut microbiota [13]. Our data indicate an induction of the expression of mitochondrial oxidative phosphorylation pathway genes in organoids after the addition of fecal homogenates from AO children, but again, not those from lean asthmatic children. These alterations may constitute an adaptation in the mitochondria to allow a higher energy intake that would lead to their increased proliferation but also to an elevated ATP synthesis and, as a consequence, to a higher production of ROS [19].
Our data indicate that obesity is a more important factor than asthma in inducing intestinal inflammation and alterations in intestinal barrier function. This hypothesis is supported by the above-mentioned data and by the fact that the correlations between parameters assessed in organoids differentially correlate with the degree of asthma and with the BMI in the group of normal-weight and overweight asthmatics. In the case of normal-weight children, where inflammation markers were not found to be elevated, positive correlations were observed between asthma severity and inflammation parameters (Tnf, Cxcl10, Cldn4 and Cldn5), while no correlations were found for obese children. In whom, in turn, BMI was positively correlated with Tff1 and Tff2 and negatively with Tjp1. Tjp1 encodes ZO-1, which is a scaffold protein which cross-links and anchors tight junction strand proteins regulating intestinal permeability and has been shown to be altered in obesity [20]. Further research will be needed, but these data suggest that barrier function may be modulated by luminal contents in obesity.
The model of intestinal organoids, as with every model, presents limitations, in this case working with closed 3D structures with limited access to the luminal side, but it has proven to be adequate for our purpose, since valuable information has been obtained.
4. Material and Methods
4.1. Patients
Our cohort included normal-weight, healthy children (group H, n = 4), and asthmatic–allergic children (n = 28) with several degrees of asthma and different body mass indexes (BMIs). Among the asthmatic–allergic children, 9 were classified as normal-weight (group A) and 19 as obese children (group AO) according to Cole et al. [6]. Regarding the severity of asthma, 5 were classified as occasional, 13 as frequent and 10 as persistent according to the Spanish Guidelines for Asthma Management (GEMA). The main clinical and anthropometric parameters, fecal and serum inflammatory biomarkers, metabolomic and metagenomic data of the asthmatic cohort are described in Gómez-Llorente MA et al. [8]. This former cohort (BIOASMA) included a higher number of children, but here we have studied those with available feces. Heathy children were recruited for this study. Criteria for inclusion were healthy prepubertal children with no asthma or other chronic conditions.
4.2. Organoid Experiments
4.2.1. Fecal Water Preparation
Stool from children (groups H, A and AO) was weighed and mixed (1 g/mL) in a buffer containing phosphate-buffered saline (PBS), 20% fetal bovine serum (FBS) (Sigma-Aldrich, San Luis, MO, USA) (v/v) and 2 mM ethylenediaminetetraacetic acid (EDTA, Sigma-Aldrich). Fecal samples were centrifuged (24,100× g, 10 min). Then, the supernatant was sonicated at 50% amplitude for 10 s in an UP200S ultrasonic device (Hielscher, Berlin, Germany), centrifuged (24,100× g, 5 min) and filter sterilized (0.22 μm). This preparation was referred to as fecal water.
4.2.2. Crypt Isolation and Organoid Culture from Mouse
Jejunum intestinal organoids were obtained as previously described [21]. Briefly, jejunum intestinal organoids from wild-type (WT) mice were dissected and incubated for 30 min at 4 °C in PBS with 2 mM EDTA. After shaking, dissociated fragments were passed through 70 µm filter and crypts were counted and centrifuged for seeding. The pellet was resuspended in Corning-Matrigel® (Fisher Scientific, Madrid, Spain) and IntestiCultTM (StemCell, Grenoble, France) with a 1:1 ratio. Domes were cultured in 24 well plates with IntestiCultTM supplemented with penicillin–streptomycin (Sigma-Aldrich). Intestinal organoids were stimulated with 1% (v/v) of fecal water overnight and then processed for RNA extraction. For experiments with inhibitors, 10 µM of BAY11-7082, 10 µM FPS-ZM1 or 1 µM wortmannin (Sigma Aldrich) were added for 24 h and then RNA was extracted as previously described [22,23].
4.2.3. Analysis of Gene Expression by RT-qPCR
Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Barcelona, Spain). One mg was retro-transcribed, and specific RNA sequences were amplified with a Bio-Rad CFX Connect real-time PCR device (Bio-Rad Hercules, CA, USA). The 2−ΔΔCT method was used for relative quantification using 18s and Hprt (Hypoxantine phosphoribosyltransferase) as reference genes. Table 4 and Table 5 detail the primers used for qPCR analysis.
4.3. Data and Statistical Analysis
Results are expressed as mean ± SEM. Differences among means were tested for statistical significance using a one-way ANOVA followed by a Tukey or a Dunnett’s multiple comparisons test. Pearson correlation coefficient and the Holm–Sidak method were used to study correlations and to correct for multiple comparisons. All analyses were carried out with the GraphPad Prism 6 (La Jolla, CA, USA). Differences were considered significant at p < 0.05.
5. Conclusions
Taken together, our data indicate that feces from obese asthmatic children induce changes in intestinal epithelial cells, including mitochondrial dysfunction, increased inflammation and alterations in the intestinal barrier function, which are mediated by different signal transduction pathways. Our results also indicate that the model used is valid for detecting differences in gene expression brought about by fecal homogenates.
Fecal homogenates from asthmatic, normal-weight and obese children induced a different phenotype in intestinal organoids, in which the presence of obesity plays a major role. These effects may underlie the well-established increased severity of symptoms observed in obese asthmatic children.
Author Contributions
Conceptualization, O.M.-A., C.G.-L. and F.S.d.M.; methodology, S.C., M.T.-G., R.G.-B., A.M.-C. and M.A.G.-L.; formal analysis, S.C., M.T.-G., R.G.-B., A.I.Á.-M. and M.A.G.-L.; data curation, S.C., M.T.-G. and M.A.G.-L.; writing—original draft preparation, O.M.-A.; writing—review and editing, O.M.-A., C.G.-L., F.S.d.M., M.T.-G., A.I.Á.-M., R.G.-B. and S.C.; funding acquisition, C.G.-L., O.M.-A. and F.S.d.M. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by the Fundacion Progreso y Salud Project number PI-0373-2014 and Agencia Andaluza del Conocimiento, Regional Government of Andalucía and European Regional Development Fund through project A-CTS-263-UGR18 to C.G.-L. It has also been supported by grant PID2020-112768RB-I00 to O.M.A funded by MICINN, by a grant from Fondo de Investigaciones Sanitarias, Instituto de Salud Carlos III, Spain (PI21/00952) to F.S.d.M and by grants A-AGR-468-UGR20 and P20-00695 funded by Junta de Andalucía and FEDER to O.M.A and F.S.d.M. M.T.G. was supported by The Spanish Government through an FPU grant. Centro de Investigación Biomédica en Red (CIBER) is funded by Instituto de Salud Carlos III, Spain.
Institutional Review Board Statement
The study protocol was approved by the local Ethics Committee of Granada (Reference 8/15) and was conducted according to the standards given in the Declaration of Helsinki (Edinburg 2000 revised), the Good Clinical Practice of the European Union (document 111/3976/88 July 1990) and legal in-forced Spanish regulations, which regulated the clinical investigation in human beings.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data are available on request.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Lang, J.E. Obesity and childhood asthma. Curr. Opin. Pulm. Med. 2019, 25, 34–43. [Google Scholar] [CrossRef] [PubMed]
- Eder, W.; Ege, M.J.; von Mutius, E. The Asthma Epidemic. N. Engl. J. Med. 2006, 355, 2226–2235. [Google Scholar] [CrossRef] [PubMed]
- Wenzel, S.E. Asthma phenotypes: The evolution from clinical to molecular approaches. Nat. Med. 2012, 18, 716–725. [Google Scholar] [CrossRef] [PubMed]
- Michalovich, D.; Rodriguez-Perez, N.; Smolinska, S.; Pirozynski, M.; Mayhew, D.; Uddin, S.; Van Horn, S.; Sokolowska, M.; Altunbulakli, C.; Eljaszewicz, A.; et al. Obesity and disease severity magnify disturbed microbiome-immune interactions in asthma patients. Nat. Commun. 2019, 10, 5711. [Google Scholar] [CrossRef]
- Thorburn, A.N.; McKenzie, C.I.; Shen, S.; Stanley, D.; Macia, L.; Mason, L.J.; Roberts, L.K.; Wong, C.H.Y.; Shim, R.; Robert, R.; et al. Evidence that asthma is a developmental origin disease influenced by maternal diet and bacterial metabolites. Nat. Commun. 2015, 6, 7320. [Google Scholar] [CrossRef] [PubMed]
- Cole, T.J.; Bellizzi, M.C.; Flegal, K.M.; Dietz, W.H. Establishing a standard definition for child overweight and obesity worldwide: International survey. BMJ 2000, 320, 1240. [Google Scholar] [CrossRef]
- Wang, Z.; Lai, Z.; Zhang, X.; Huang, P.; Xie, J.; Jiang, Q.; Zhang, Q.; Chung, K.F. Altered gut microbiome compositions are associated with the severity of asthma. J. Thorac. Dis. 2021, 13, 4322–4338. [Google Scholar] [CrossRef]
- Gomez-Llorente, M.A.; Martínez-Cañavate, A.; Chueca, N.; Rico, M.D.; Romero, R.; Anguita-Ruiz, A.; Aguilera, C.M.; Gil-Campos, M.; Mesa, M.D.; Khakimov, B.; et al. A Multi-Omics Approach Reveals New Signatures in Obese Allergic Asthmatic Children. Biomedicines 2020, 8, 359. [Google Scholar] [CrossRef]
- Gu, Y.; Guo, X.; Sun, S.; Che, H. High-Fat Diet-Induced Obesity Aggravates Food Allergy by Intestinal Barrier Destruction and Inflammation. Int. Arch. Allergy Immunol. 2021, 183, 80–92. [Google Scholar] [CrossRef]
- Sanchez de Medina, F.; Romero-Calvo, I.; Mascaraque, C.; Martinez-Augustin, O. Intestinal inflammation and mucosal barrier function. Inflamm. Bowel. Dis. 2014, 20, 2394–2404. [Google Scholar] [CrossRef]
- Dorrestein, P.C.; Mazmanian, S.K.; Knight, R. Finding the missing links among metabolites, microbes, and the host. Immunity 2014, 40, 824–832. [Google Scholar] [CrossRef] [PubMed]
- Stanton, J.E.; Grabrucker, A.M. The use of organoids in food research. Curr. Opin. Food Sci. 2023, 49, 100977. [Google Scholar] [CrossRef]
- Body-Malapel, M.; Djouina, M.; Waxin, C.; Langlois, A.; Gower-Rousseau, C.; Zerbib, P.; Schmidt, A.M.; Desreumaux, P.; Boulanger, E.; Vignal, C. The RAGE signaling pathway is involved in intestinal inflammation and represents a promising therapeutic target for Inflammatory Bowel Diseases. Mucosal Immunol. 2019, 12, 468–478. [Google Scholar] [CrossRef] [PubMed]
- Cuddihey, H.; Cavin, J.B.; Keenan, C.M.; Wallace, L.E.; Vemuri, K.; Makriyannis, A.; MacNaughton, W.K.; Sharkey, K.A. Role of CB(1) receptors in the acute regulation of small intestinal permeability: Effects of high-fat diet. Am. J. Physiol. Gastrointest. Liver Physiol. 2022, 323, G219–G238. [Google Scholar] [CrossRef] [PubMed]
- Menegati, L.M.; de Oliveira, E.E.; Oliveira, B.d.C.; Macedo, G.C.; de Castro e Silva, F.M. Asthma, obesity, and microbiota: A complex immunological interaction. Immunol. Lett. 2023, 255, 10–20. [Google Scholar] [CrossRef] [PubMed]
- Ali, Z.; Ulrik, C.S. Obesity and asthma: A coincidence or a causal relationship? A systematic review. Respir. Med. 2013, 107, 1287–1300. [Google Scholar] [CrossRef] [PubMed]
- Youssef, D.M.; Elbehidy, R.M.; Shokry, D.M.; Elbehidy, E.M. The influence of leptin on Th1/Th2 balance in obese children with asthma. J. Bras. Pneumol. 2013, 39, 562–568. [Google Scholar] [CrossRef]
- Pearce, S.C.; Al-Jawadi, A.; Kishida, K.; Yu, S.; Hu, M.; Fritzky, L.F.; Edelblum, K.L.; Gao, N.; Ferraris, R.P. Marked differences in tight junction composition and macromolecular permeability among different intestinal cell types. BMC Biol. 2018, 16, 19. [Google Scholar] [CrossRef]
- Guerbette, T.; Boudry, G.; Lan, A. Mitochondrial function in intestinal epithelium homeostasis and modulation in diet-induced obesity. Mol. Metab. 2022, 63, 101546. [Google Scholar] [CrossRef]
- Mishra, S.P.; Wang, B.; Jain, S.; Ding, J.; Rejeski, J.; Furdui, C.M.; Kitzman, D.W.; Taraphder, S.; Brechot, C.; Kumar, A.; et al. A mechanism by which gut microbiota elevates permeability and inflammation in obese/diabetic mice and human gut. Gut 2023, 72, 1848–1865. [Google Scholar] [CrossRef]
- Aranda, C.J.; Arredondo-Amador, M.; Ocon, B.; Lavin, J.L.; Aransay, A.M.; Martinez-Augustin, O.; Sanchez de Medina, F. Intestinal epithelial deletion of the glucocorticoid receptor NR3C1 alters expression of inflammatory mediators and barrier function. FASEB J. 2019, 33, 14067–14082. [Google Scholar] [CrossRef] [PubMed]
- Sato, T.; Vries, R.G.; Snippert, H.J.; van de Wetering, M.; Barker, N.; Stange, D.E.; van Es, J.H.; Abo, A.; Kujala, P.; Peters, P.J.; et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 2009, 459, 262–265. [Google Scholar] [CrossRef] [PubMed]
- Dekkers, J.F.; Wiegerinck, C.L.; de Jonge, H.R.; Bronsveld, I.; Janssens, H.M.; de Winter-de Groot, K.M.; Brandsma, A.M.; de Jong, N.W.; Bijvelds, M.J.; Scholte, B.J.; et al. A functional CFTR assay using primary cystic fibrosis intestinal organoids. Nat. Med. 2013, 19, 939–945. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
Effect of fecal homogenates of children on the expression of intestinal barrier function-related genes. (A) Inflammation-related genes. (B) Mucins, Trefoil factors and Reg3g. (C) Permeability-related genes. Fecal homogenates from healthy (H), normal-weight asthmatic (A) and obese asthmatic (AO) children were added to the cell culture medium of mouse jejunum organoids. qRT-PCR was performed. All the samples were separately assayed. Results are expressed as mean ± SEM fold change vs. control medium (C). One-way ANOVA followed by Tukey test were applied. +: p < 0.05 vs. A; #: p < 0.05 vs. H; *: p < 0.05 vs. C.
Figure 1.
Effect of fecal homogenates of children on the expression of intestinal barrier function-related genes. (A) Inflammation-related genes. (B) Mucins, Trefoil factors and Reg3g. (C) Permeability-related genes. Fecal homogenates from healthy (H), normal-weight asthmatic (A) and obese asthmatic (AO) children were added to the cell culture medium of mouse jejunum organoids. qRT-PCR was performed. All the samples were separately assayed. Results are expressed as mean ± SEM fold change vs. control medium (C). One-way ANOVA followed by Tukey test were applied. +: p < 0.05 vs. A; #: p < 0.05 vs. H; *: p < 0.05 vs. C.
Figure 2.
Effect of fecal homogenates of children on the expression of Cnr1. Fecal homogenates from healthy (H), normal-weight asthmatic (A) and obese asthmatic (AO) children were added to the cell culture medium of mouse jejunum organoids. Three pools of n = 3 and n = 6–7 samples were assayed for the A and AO groups, respectively. qRT-PCR was performed. Results are expressed as mean ± SEM fold change vs. control medium (C). One-way ANOVA followed by Tukey test were applied. +: p < 0.05 vs. A; #: p < 0.05 vs. H; *: p < 0.05 vs. C.
Figure 2.
Effect of fecal homogenates of children on the expression of Cnr1. Fecal homogenates from healthy (H), normal-weight asthmatic (A) and obese asthmatic (AO) children were added to the cell culture medium of mouse jejunum organoids. Three pools of n = 3 and n = 6–7 samples were assayed for the A and AO groups, respectively. qRT-PCR was performed. Results are expressed as mean ± SEM fold change vs. control medium (C). One-way ANOVA followed by Tukey test were applied. +: p < 0.05 vs. A; #: p < 0.05 vs. H; *: p < 0.05 vs. C.
Figure 3.
Radial charts for statistically significant correlations between TNF (A), fecal D-lactate (B), Asthma (C) and BMI (D) and parameters assayed in normal-weight asthmatic (A) and obese asthmatic (AO) prepubertal children. Pearson correlation coefficients with correction for multiple comparisons using the Holm–Sidak method are shown. +: p < 0.05 for correlation coefficients in the A group *: p < 0.05 for correlations coefficients in the AO gruop.
Figure 3.
Radial charts for statistically significant correlations between TNF (A), fecal D-lactate (B), Asthma (C) and BMI (D) and parameters assayed in normal-weight asthmatic (A) and obese asthmatic (AO) prepubertal children. Pearson correlation coefficients with correction for multiple comparisons using the Holm–Sidak method are shown. +: p < 0.05 for correlation coefficients in the A group *: p < 0.05 for correlations coefficients in the AO gruop.
Figure 4.
Effect of signal transduction inhibitors. Fecal homogenates from obese asthmatic (AO) children were added to the cell culture medium of mouse jejunum organoids together with inhibitors of AKT (wortmannin), NFκB (BAY11-7082) and RAGE (FPS-ZM1) signal transduction pathways. qRT-PCR was performed. Results are expressed as mean ± SEM fold change vs. control medium (C). One-way ANOVA followed by Dunnett’s multiple comparisons tests was applied to study differences with the AO group. *: p < 0.05 vs. all; #: p < 0.05 vs. all except AO + wortmannin; +: p < 0.05 vs C and AO + FPS.
Figure 4.
Effect of signal transduction inhibitors. Fecal homogenates from obese asthmatic (AO) children were added to the cell culture medium of mouse jejunum organoids together with inhibitors of AKT (wortmannin), NFκB (BAY11-7082) and RAGE (FPS-ZM1) signal transduction pathways. qRT-PCR was performed. Results are expressed as mean ± SEM fold change vs. control medium (C). One-way ANOVA followed by Dunnett’s multiple comparisons tests was applied to study differences with the AO group. *: p < 0.05 vs. all; #: p < 0.05 vs. all except AO + wortmannin; +: p < 0.05 vs C and AO + FPS.
Figure 5.
Effect of fecal homogenates of children on the expression of mitochondria-related genes. Fecal homogenates from healthy (H), normal-weight asthmatic (A) and obese asthmatic (AO) children were added to the cell culture medium of mouse jejunum organoids. Three pools of n = 3 and n = 6–7 samples were assayed for the A and AO groups, respectively. qRT-PCR was performed. Results are expressed as mean ± SEM of fold change vs. control medium (C). One-way ANOVA followed by Tukey test was applied. +: p < 0.05 vs. A; #: p < 0.05 vs. H; *: p < 0.05 vs. C.
Figure 5.
Effect of fecal homogenates of children on the expression of mitochondria-related genes. Fecal homogenates from healthy (H), normal-weight asthmatic (A) and obese asthmatic (AO) children were added to the cell culture medium of mouse jejunum organoids. Three pools of n = 3 and n = 6–7 samples were assayed for the A and AO groups, respectively. qRT-PCR was performed. Results are expressed as mean ± SEM of fold change vs. control medium (C). One-way ANOVA followed by Tukey test was applied. +: p < 0.05 vs. A; #: p < 0.05 vs. H; *: p < 0.05 vs. C.
Table 1.
Fecal D-Lactate, macroscopic parameters and plasma parameters in normal-weight asthmatic (A) and asthmatic–obese (AO) children. Mean ± SEM. A simultaneous T-test was performed, and p values are shown. *: significant after correction for multiple comparisons using the Holm–Sidak method. Data have been obtained from Gomez-Llorente MA et al. [8].
Table 1.
Fecal D-Lactate, macroscopic parameters and plasma parameters in normal-weight asthmatic (A) and asthmatic–obese (AO) children. Mean ± SEM. A simultaneous T-test was performed, and p values are shown. *: significant after correction for multiple comparisons using the Holm–Sidak method. Data have been obtained from Gomez-Llorente MA et al. [8].
| A | AO | p Value | |
|---|---|---|---|
| Asthma | 1.889 ± 0.200 | 2.316 ± 0.172 | 0.148 |
| Age | 9.444 ± 0.884 | 8.474 ± 0.486 | 0.306 |
| Weight (Kg) | 31.122 ± 1.980 | 44.887 ± 2.886 | 0.005 |
| Height (m) | 1.383 ± 0.036 | 1.345 ± 0.028 | 0.426 |
| BMI | 16.156 ± 0.452 | 24.363 ± 0.601 * | <0.0001 |
| BMIZscore | −0.489 ± 0.153 | 2.858 ± 0.160 * | <0.0001 |
| Hip perimeter (cm) | 70.714 ± 2.998 | 83.194 ± 2.482 | 0.010 |
| Waist–hip ratio | 0.837 ± 0.019 | 0.862 ± 0.023 | 0.487 |
| Fecal D-Lactate (mM) | 9.100 ± 1.329 | 10.327 ± 1.508 | 0.609 |
| Glucose (mmol/L) | 4.722 ± 0.224 | 4.629 ± 0.087 | 0.4439 |
| Insulin (µUL/mL) | 6.847 ± 1.886 | 8.606 ± 1.137 | 0.1759 |
| HOMA index | 1.144 ± 0.323 | 1.654 ± 0.169 | 0.585 |
| LBP (µg/mL) | 3.171 ± 0.604 | 3.600 ± 0.461 | 0.606 |
| Adiponectin (mg/L) | 7.071 ± 1.718 | 5.631 ± 0.726 | 0.378 |
| Resistin (µg/mL) | 13.671 ± 1.765 | 13.671 ± 1.133 | >0.9999 |
| Adiponectin/resistin ratio | 0.400 ± 0.086 | 0.446 ± 0.071 | 0.706 |
| Leptin (µg/L) | 2.586 ± 0.440 | 8.156 ± 0.555 * | <0.0001 |
| TNF (pg/mL) | 3.800 ± 0.479 | 3.383 ± 0.229 | 0.385 |
| IL-10 (pg/mL) | 3.371 ± 0.341 | 4.114 ± 0.426 | 0.270 |
| IL-13 (pg/mL) | 2.517 ± 0.681 | 1.927 ± 3.373 | 0.419 |
| IL-4 (pg/mL) | 13.917 ± 3.200 | 12.846 ± 2.075 | 0.777 |
| IL-5 (pg/mL) | 1.200 ± 0.145 | 1.421 ± 0.114 | 0.263 |
| IL-6 (pg/mL) | 0.950 ± 0.228 | 1.099 ± 0.220 | 0.683 |
| IL-8 (pg/mL) | 1.957 ± 0.188 | 1.793 ± 0.212 | 0.624 |
Table 2.
Correlations between parameters measured in intestinal organoids after the addition of feces from normal-weight asthmatic children. A higher-stringency Pearson correlation coefficient, calculated with all parameters in the study, is shown. *: p < 0.05.
Table 2.
Correlations between parameters measured in intestinal organoids after the addition of feces from normal-weight asthmatic children. A higher-stringency Pearson correlation coefficient, calculated with all parameters in the study, is shown. *: p < 0.05.
| Cd14 | Cldn1 | Cldn4 | Cldn5 | Cxcl10 | Cxcl9 | Muc2 | Muc3 | Muc13 | Nos2 | Nt5e | Tff1 | Tff2 | Tff3 | Tjp1 | Tnf | Tlr4 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Cd14 | 0.573 | 0.758 * | 0.495 | 0.560 | 0.422 | 0.096 | −0.132 | 0.867 * | −0.335 | 0.650 | 0.101 | −0.556 | −0.706 | 0.372 | 0.330 | −0.474 | |
| Cldn1 | 0.573 | 0.922 * | 0.466 | 0.738 | 0.609 | 0.234 | 0.408 | 0.213 | −0.590 | 0.446 | 0.511 | 0.084 | −0.621 | 0.527 | 0.525 | −0.140 | |
| Cldn4 | 0.758 * | 0.922 * | 0.707 | 0.880 * | 0.876 * | −0.139 | 0.004 | 0.511 | −0.634 | 0.854 * | 0.311 | −0.153 | −0.763 * | 0.202 | 0.658 | −0.412 | |
| Cldn5 | 0.495 | 0.466 | 0.707 | 0.942 * | −0.434 | −0.660 | −0.546 | 0.532 | −0.386 | 0.879 * | 0.381 | −0.707 | −0.818 * | −0.395 | 0.949 * | −0.817 * | |
| Cxcl10 | 0.560 | 0.738 | 0.880 * | 0.942 * | −0.464 | −0.542 | −0.416 | 0.511 | −0.509 | 0.943 * | 0.460 | −0.449 | −0.879 * | −0.255 | 0.914 * | −0.690 | |
| Cxcl9 | 0.422 | 0.609 | 0.876 * | −0.434 | −0.464 | 0.894 * | 0.778 * | −0.144 | −0.621 | −0.542 | 0.197 | 0.204 | 0.390 | 0.932 * | −0.468 | 0.050 | |
| Muc2 | 0.096 | 0.234 | −0.139 | −0.660 | −0.542 | 0.894 * | 0.838 * | −0.283 | −0.098 | −0.550 | 0.063 | 0.422 | 0.288 | 0.938 * | −0.722 | 0.288 | |
| Muc3 | −0.132 | 0.408 | 0.004 | −0.546 | −0.416 | 0.778 * | 0.838 * | −0.540 | −0.190 | −0.534 | 0.264 | 0.792 * | 0.545 | 0.802 * | −0.618 | 0.646 | |
| Muc13 | 0.867 * | 0.213 | 0.511 | 0.532 | 0.511 | −0.144 | −0.283 | −0.540 | −0.050 | 0.695 * | −0.127 | −0.711 * | −0.747 * | −0.055 | 0.425 | −0.503 | |
| Nos2 | −0.335 | −0.590 | −0.634 | −0.386 | −0.509 | −0.621 | −0.098 | −0.190 | −0.050 | −0.431 | −0.295 | 0.125 | 0.092 | −0.318 | −0.541 | 0.536 | |
| Nt5e | 0.650 | 0.446 | 0.854 * | 0.879 * | 0.943 * | −0.542 | −0.550 | −0.534 | 0.695 * | −0.431 | 0.023 | −0.510 | −0.808 * | −0.277 | 0.838 * | −0.592 | |
| Tff1 | 0.101 | 0.511 | 0.311 | 0.381 | 0.460 | 0.197 | 0.063 | 0.264 | −0.127 | −0.295 | 0.023 | −0.167 | 0.170 | 0.208 | 0.514 | −0.113 | |
| Tff2 | −0.556 | 0.084 | −0.153 | −0.707 | −0.449 | 0.204 | 0.422 | 0.792 * | −0.711 * | 0.125 | −0.510 | −0.167 | 0.562 | 0.276 | −0.636 | 0.842 * | |
| Tff3 | −0.706 | −0.621 | −0.763 * | −0.818 * | −0.879 * | 0.390 | 0.288 | 0.545 | −0.747 * | 0.092 | −0.808 * | 0.170 | 0.562 | 0.071 | −0.708 | 0.627 | |
| Tjp1 | 0.372 | 0.527 | 0.202 | −0.395 | −0.255 | 0.932 * | 0.938 * | 0.802 * | −0.055 | −0.318 | −0.277 | 0.208 | 0.276 | 0.071 | −0.494 | 0.155 | |
| Tnf | 0.330 | 0.525 | 0.658 | 0.949 * | 0.914 * | −0.468 | −0.722 | −0.618 | 0.425 | −0.541 | 0.838 * | 0.514 | −0.636 | −0.708 | −0.494 | −0.821 * | |
| Tlr4 | −0.474 | −0.140 | −0.412 | −0.817 * | −0.690 | 0.050 | 0.288 | 0.646 | −0.503 | 0.536 | −0.592 | −0.113 | 0.842 * | 0.627 | 0.155 | −0.821 * |
Table 3.
Correlations between parameters measured in intestinal organoids after the addition of feces from obese asthmatic children. A higher-stringency Pearson correlation coefficient, calculated with all parameters in the study, is shown. *: p < 0.05.
Table 3.
Correlations between parameters measured in intestinal organoids after the addition of feces from obese asthmatic children. A higher-stringency Pearson correlation coefficient, calculated with all parameters in the study, is shown. *: p < 0.05.
| Cd14 | Cldn1 | Cldn4 | Cldn5 | Cxcl10 | Cxcl9 | Muc2 | Muc3 | Muc13 | Nos2 | Nt5e | Tff1 | Tff2 | Tff3 | Tjp1 | Tnf | Tlr4 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Cd14 | 0.284 | 0.260 | 0.446 | 0.177 | 0.197 | 0.615 * | 0.672 * | 0.509 * | 0.085 | 0.177 | −0.212 | −0.191 | −0.151 | 0.312 | 0.474 | 0.001 | |
| Cldn1 | 0.284 | 0.661 * | 0.658 * | 0.638 * | 0.845 * | 0.007 | 0.452 | 0.243 | 0.248 | 0.810 * | −0.054 | −0.197 | 0.071 | 0.603 * | 0.432 | 0.540 | |
| Cldn4 | 0.260 | 0.661 * | 0.359 | 0.733 * | 0.587 * | 0.120 | 0.539 * | 0.486 * | 0.020 | 0.492 * | 0.443 | 0.374 | 0.498 * | 0.504 * | 0.383 | 0.053 | |
| Cldn5 | 0.446 | 0.658 * | 0.359 | 0.789 * | 0.453 | 0.191 | 0.743 * | 0.156 | 0.576 | 0.370 | 0.108 | −0.219 | 0.045 | 0.028 | 0.737 * | 0.192 | |
| Cxcl10 | 0.177 | 0.638 * | 0.733 * | 0.789 * | 0.549 * | 0.321 | 0.703 * | 0.500 * | 0.330 | 0.436 | 0.475 | 0.475 * | 0.678 * | 0.184 | 0.902 * | −0.075 | |
| Cxcl9 | 0.197 | 0.845 * | 0.587 * | 0.453 | 0.549 * | −0.065 | 0.391 | 0.395 | 0.091 | 0.770 * | −0.113 | 0.220 | 0.306 | 0.570 | 0.351 | 0.357 | |
| Muc2 | 0.615 * | 0.007 | 0.120 | 0.191 | 0.321 | −0.065 | 0.522 * | 0.340 | −0.035 | 0.059 | −0.097 | −0.003 | 0.074 | 0.104 | 0.718 * | −0.186 | |
| Muc3 | 0.672 * | 0.452 | 0.539 * | 0.743 * | 0.703 * | 0.391 | 0.522 * | 0.661 * | 0.432 | 0.398 | 0.395 | 0.365 | 0.401 | 0.097 | 0.770 * | 0.024 | |
| Muc13 | 0.509 * | 0.243 | 0.486 * | 0.156 | 0.500 * | 0.395 | 0.340 | 0.661 * | 0.263 | 0.573 * | 0.222 | 0.093 | 0.616 * | 0.636 * | 0.329 | 0.360 | |
| Nos2 | 0.085 | 0.248 | 0.020 | 0.576 * | 0.330 | 0.091 | −0.035 | 0.432 | 0.263 | 0.022 | 0.206 | −0.030 | 0.370 | −0.005 | 0.149 | 0.576 * | |
| Nt5e | 0.177 | 0.810 * | 0.492 * | 0.370 | 0.436 | 0.770 * | 0.059 | 0.398 | 0.573 * | 0.022 | 0.102 | 0.086 | 0.398 | 0.731 * | 0.357 | 0.413 | |
| Tff1 | −0.212 | −0.054 | 0.443 | 0.108 | 0.475 | −0.113 | −0.097 | 0.395 | 0.222 | 0.206 | 0.102 | 0.675 * | 0.694 * | −0.060 | 0.386 | −0.012 | |
| Tff2 | −0.191 | −0.197 | 0.374 | −0.219 | 0.475 * | 0.220 | −0.003 | 0.365 | 0.093 | −0.030 | 0.086 | 0.675 * | 0.450 | −0.146 | 0.549 * | −0.064 | |
| Tff3 | −0.151 | 0.071 | 0.498 * | 0.045 | 0.678 * | 0.306 | 0.074 | 0.401 | 0.616 * | 0.370 | 0.398 | 0.694 * | 0.450 | 0.242 | 0.357 | 0.277 | |
| Tjp1 | 0.312 | 0.603 * | 0.504 * | 0.028 | 0.184 | 0.570 * | 0.104 | 0.097 | 0.636 * | −0.005 | 0.731 * | −0.060 | −0.146 | 0.242 | −0.043 | 0.578 * | |
| Tnf | 0.474 | 0.432 | 0.383 | 0.737 * | 0.902 * | 0.351 | 0.718 * | 0.770 * | 0.329 | 0.149 | 0.357 | 0.386 | 0.549 * | 0.357 | −0.043 | −0.213 | |
| Tlr4 | 0.001 | 0.540 | 0.053 | 0.192 | −0.075 | 0.357 | −0.186 | 0.024 | 0.360 | 0.576 | 0.413 | −0.012 | −0.064 | 0.277 | 0.578 * | −0.213 |
Table 4.
Primers used for RT-qPCR analysis purchased from Sigma Aldrich (San Luis, MO, USA. EE. UU).
Table 4.
Primers used for RT-qPCR analysis purchased from Sigma Aldrich (San Luis, MO, USA. EE. UU).
| Gene | Forward Sequence | Reverse Sequence |
|---|---|---|
| 18S | ACACGGACAGGATTGACAGATTG | GCCAGAGTCTCGTTCGTTATCG |
| Hprt | AGGGATTTGAATCACGTTTG | TTTACTGGCAACATCAACAG |
| Tnf | CGTGGAACTGGCAGAAGAGG | CAGGAATGAGAAGAGGCTGAGAC |
| Nos2 | CATCAACCAGTATTATGGCTC | TTTCCTTTGTTACAGCTTCC |
| Cd14 | GAATCTACCGACCATGGAG | AAGTTGCAGGAACAACTTTC |
| Nt5e | CTATGAGCCTCTTGAAATGG | CTGATATCTTGATCACCAGAG |
| Cxcl9 | GAGGAACCCTAGTGATAAGG | GTTTGATCTCCGTTCTTCAG |
| Cxcl10 | AAAAAGGTCTAAAAGGGCTC | AATTAGGACTAGCCATCCAC |
| Muc13 | CTTTTTGTGTTGCTGTAACG | CAAATGGACACTCTTCACAC |
| Tff2 | CTGTGGAAGATTGTCACTAC | AGATTGATGAAGTCTGGTTG |
| Tff3 | CCTGGTTGCTGGGTCCTCTG | GCCACGGTTGTTACACTGCTC |
| Reg3g | CAGAGGTGGATGGGAGTGGAG | CACAGTGATTGCCTGAGGAAGAG |
| Claudin1 | CAATGCCAGGTATGAATTTG | TCACACATAGTCTTTCCCAC |
| Claudin4 | GACTGTGCAAAGTTACTAGC | ACCAGCAATTTGGATGTAAG |
| Claudin5 | AACAGTTCCTACTGAGATCC | CTTTTTAACACGTCCCTCTG |
| Tjp1 | GGGGCCTACACTGATCAAGA | TGGAGATGAGGCTTCTGCTT |
| Cnr1 | AATGCCATTTAGGTGTTCTG | ATAGGTCTTAGAACCAACCC |
| Tlr4 | GATCAGAAACTCAGCAAAGTC | TGTTTCAATTTCACACCTGG |
| Muc 2 | CCCAGAAGGGACTGTGTATG | TTGTGTTCGCTCTTGGTCAG |
| Muc 3 | AAAGATTACCTCCCATCTCC | TAAAACTAAGCATGCCCTTG |
| Muc 4 | GGATTCCTTCTACGTTACAG | GTAGAGAAATCAGCATCAG |
| mt-Rnr1 | GACACCTTGCCTAGCCACAC | TGGCTGGCACGAAATTTACC |
| mt-Rnr2 | ACTAGCATGAACGGCTAAACG | AAGCTCCATAGGGTCTTCTCG |
Table 5.
Primers used for RT-qPCR purchased from Bio-Rad (Hercules, California, EE. UU).
| Gene | UniqueAssay ID |
|---|---|
| mt-Atp6 | qMmuCED0051651 |
| mt-Co1 | qMmuCED0061464 |
| mt-Co2 | qMmuCED0027 |
| mt-Cyb | qMmuCED0001514 |
| mtNd6 | qMmuCED0061740 |
| mtNd1 | qMmuCED0003246 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Córdova, S.; Tena-Garitaonaindia, M.; Álvarez-Mercado, A.I.; Gámez-Belmonte, R.; Gómez-Llorente, M.A.; Sánchez de Medina, F.; Martínez-Cañavate, A.; Martínez-Augustin, O.; Gómez-Llorente, C. Differential Modulation of Mouse Intestinal Organoids with Fecal Luminal Factors from Obese, Allergic, Asthmatic Children. Int. J. Mol. Sci. 2024, 25, 866. https://doi.org/10.3390/ijms25020866
AMA Style
Córdova S, Tena-Garitaonaindia M, Álvarez-Mercado AI, Gámez-Belmonte R, Gómez-Llorente MA, Sánchez de Medina F, Martínez-Cañavate A, Martínez-Augustin O, Gómez-Llorente C. Differential Modulation of Mouse Intestinal Organoids with Fecal Luminal Factors from Obese, Allergic, Asthmatic Children. International Journal of Molecular Sciences. 2024; 25(2):866. https://doi.org/10.3390/ijms25020866
Chicago/Turabian StyleCórdova, Samir, Mireia Tena-Garitaonaindia, Ana Isabel Álvarez-Mercado, Reyes Gámez-Belmonte, Mª Amelia Gómez-Llorente, Fermín Sánchez de Medina, Ana Martínez-Cañavate, Olga Martínez-Augustin, and Carolina Gómez-Llorente. 2024. "Differential Modulation of Mouse Intestinal Organoids with Fecal Luminal Factors from Obese, Allergic, Asthmatic Children" International Journal of Molecular Sciences 25, no. 2: 866. https://doi.org/10.3390/ijms25020866
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
