Next Article in Journal
Molecular Epidemiology and Phyloevolutionary Analysis of Porcine Parvoviruses (PPV1 through PPV7) Detected in Replacement Gilts from Colombia
Next Article in Special Issue
Plant-Derived Exosome-like Nanoparticles: A Comprehensive Overview of Their Composition, Biogenesis, Isolation, and Biological Applications
Previous Article in Journal
Immunohistochemical Expression of p53 and FGFR3 Predicts Response to Enfortumab Vedotin in Metastatic Urothelial Carcinoma
Previous Article in Special Issue
Progress of Exosomal LncRNAs in Pancreatic Cancer
 
 
Retraction published on 15 May 2026, see Int. J. Mol. Sci. 2026, 27(10), 4400.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

RETRACTED: PTEN Deficiency Induced by Extracellular Vesicle miRNAs from Clonorchis sinensis Potentiates Cholangiocarcinoma Development by Inhibiting Ferroptosis

State Key Laboratory for Diagnosis and Treatment of Severe Zoonotic Infectious Diseases, Key Laboratory for Zoonosis Research of the Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin University, Changchun 130062, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(19), 10350; https://doi.org/10.3390/ijms251910350
Submission received: 9 August 2024 / Revised: 21 September 2024 / Accepted: 24 September 2024 / Published: 26 September 2024 / Retracted: 15 May 2026
(This article belongs to the Special Issue The Molecular Basis of Extracellular Vesicles in Health and Diseases)

Abstract

The human phosphatase and tensin homolog (PTEN) is a tumor suppressor. A slight deficiency in PTEN might cause cancer susceptibility and progression. Infection by the liver fluke Clonorchis sinensis could lead to persistent loss of PTEN in cholangiocarcinoma. However, the mechanism of PTEN loss and its malignant effect on cholangiocarcinoma have not yet been elucidated. Extracellular vesicles secreted by Clonorchis sinensis (CS-EVs) are rich in microRNAs (miRNAs) and can mediate communication between hosts and parasites. Herein, we delved into the miRNAs present in CS-EVs, specifically those that potentially target PTEN and modulate the progression of cholangiocarcinoma via ferroptosis mechanisms. CS-EVs were extracted by differential ultra-centrifugation for high-throughput sequencing of miRNA. Lentiviral vectors were used to construct stably transfected cell lines. Erastin was used to construct ferroptosis induction models. Finally, 36 miRNAs were identified from CS-EVs. Among them, csi-miR-96-5p inhibited PTEN expression according to the predictions and dual luciferase assay. The CCK-8 assay, xenograft tumor assays and transwell assay showed that csi-miR-96-5p overexpression and PTEN knockout significantly increased the proliferation and migration of cholangiocarcinoma cells and co-transfection of PTEN significantly reversed the effect. In the presence of erastin, the cell proliferation and migration ability of the negative transfection control group were significantly impaired, although they did not significantly change with transfection of csi-miR-96-5p and PTEN knockout, indicating that they obtained ferroptosis resistance. Mechanistically, csi-miR-96-5p and PTEN knockout significantly inhibited ferroptosis through a decrease in ferrous ion (Fe2+) and malondialdehyde (MDA), and an increase in glutathione reductase (GSH), Solute carrier family 7 member 11 (SLC7A11) and glutathione peroxidase 4 (GPX4). In conclusion, loss of PTEN promoted the progression of cholangiocarcinoma via the ferroptosis pathway and csi-miR-96-5p delivered by CS-EVs may mediate this process.

Graphical Abstract

1. Introduction

Phosphatase and tensin homolog (PTEN), a common anti-oncogene, plays a pivotal role in cell growth and migration [1]. A slight dysfunction or downregulation of PTEN activity can lead to cancer susceptibility and is conducive to tumor progression [2,3]. PTEN also interacts with other proteins and signaling pathways, extending its regulatory roles in cellular processes [4,5]. Moreover, many microRNAs (miRNAs) interact functionally with PTEN and inhibit its expression in many cancers. These miRNAs usually play a role in promoting cancer by inhibiting PTEN expression [6,7,8,9].
The Chinese liver fluke Clonorchis sinensis is an important zoonotic parasite. Humans infected by C. sinensis can develop various diseases, including cholangiocarcinoma (CCA) [10,11]. A potential factor related to the cause of CCA is the release of C. sinensis excretory–secretory products (ESPs) and extracellular vesicles (CS-EVs) [12,13,14,15,16]. CS-EVs are rich in bioactive substances, including miRNAs, which may play roles in parasite survival and pathogenesis [17,18]. Upon internalization by host cells, molecules in parasite EVs may affect host–cell gene expression and cell function, thus potentially leading to CCA development [19,20].
Previous studies have shown that liver fluke infection can lead to the continual loss of PTEN in the CCA model [21]. However, the underlying molecular mechanism has not yet been elucidated; miRNAs in CS-EVs may play a pivotal function in this process.
Ferroptosis (also known as iron death) represents a new regulated cellular demise mechanism [22]. The initiator of this process is iron-mediated lipid peroxidation, by which the aberrant accumulation of ferrous ion (Fe2+) leads to membrane destabilization and subsequent cell demise [23,24]. Solute carrier family 7 member 11 (SLC7A11) is the main component of the glutamate–cystine antiporter system Xc [25,26] and can resist ferroptosis. System Xc counter-transports extracellular cystine into cells. Cystine can be used to synthesize glutathione. GSH (glutathione reductase) and GSSG (glutathione oxidized) are two forms of glutathione. GSH is one of the most important antioxidants in cells, which can scavenge free radicals in the body and protect cells from oxidative damage. GSH also plays an important role in maintaining the appropriate redox state of sulfhydryl groups in proteins and ensuring the normal function of proteins. GSSG is a disulfide formed by two GSH molecules through sulfhydryl dehydrogenation, which is mainly used as a form of GSH storage and transport in organisms. When cells need GSH, GSSG can be reduced to GSH by glutathione reductase to meet the cell’s antioxidant and detoxification needs [27,28]. Furthermore, glutathione peroxidase 4 (GPX4) removes lipid reactive oxygen species by consuming GSH to avoid cell damage. Previous studies have shown that SLC7A11 protein expression was increased by nearly 7-fold in PTEN-knockout mouse embryonic fibroblasts [29]. The loss of PTEN could potentially inhibit ferroptosis in colorectal cancer cells through an increase in GSH levels as well as an upregulation of GPX4 expression [30]. However, the relationships between ferroptosis, PTEN loss and cholangiocarcinoma have not been studied.
This study aimed to identify miRNAs in CS-EVs that potentially target host–cell PTEN and to investigate whether they affect CCA progression through ferroptosis mechanisms.

2. Results

2.1. Extraction and Identification of CS-EVs

CS-EVs were successfully extracted by differential ultracentrifugation. The transmission electron microscope (TEM) assay revealed that the morphology of the CS-EVs was typically saucer-shaped, which was consistent with the characteristics of extracellular vesicles (Figure 1A). The nanoparticle tracking analysis (NTA) assay showed that CS-EVs exhibited an average particle size of 112.1 nm, with a main peak centered at 135.8 nm, and a concentration of 1.1 × 1012 particles/mL (Figure 1B). The identity of CS-EVs was further confirmed by the presence of CD63 and TSG101 that were detectable by Western blot analysis (Figure 1C).

2.2. Identification and Functional Enrichment Analysis of miRNAs in CS-EVs

High-throughput sequencing identified 36 miRNA species from the CS-EVs (Table 1). Twelve miRNAs with an average TPM > 10,000 were detected, and the length of the miRNAs ranged from 18 to 23 nt.
To explore the functions of these identified miRNAs, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were performed on human targets. In the biological process category, most of the miRNAs were related to the terms “oxidation–reduction”. In the cellular component category, the most enriched miRNAs were “integral components of members”. In the molecular function category, the miRNAs exhibited enrichment mainly in the term “ATP binding” (Figure 2A). For KEGG pathway mapping, the most enriched pathway was the “PTEN/PI3K/AKT” pathway (Figure 2B). Among them, csi-miR-96-5p has been proved to be abundant in our and other studies [17,18] and its seed sequence was fully conserved compared with that of humans (UUGGCACU), which suggested the potential to regulate PTEN [8,9]. In the following study, we explored the relationship between csi-miR-96-5p and PTEN expression and studied its role and related ferroptosis mechanism in the progression of CCA.

2.3. CS-EVs Could Be Taken Up by Cholangiocarcinoma Cells

PKH67 is a fluorescent EV membrane-staining dye that emits vibrant green fluorescence, allowing for clear visualization of the localization of EVs.
PKH67-CS-EVs were obtained by labeling CS-EVs with PKH67. The PKH67-CS-EVs were co-cultured with RBE cells for 24 h. CS-EVs could enter the cells, indicating that the CS-EVs and their cargos could be taken up by CCA cells (Figure 3).

2.4. csi-miR-96-5p Directly Targeted PTEN

We conducted a dual luciferase assay, wherein we synthesized both the wild-type (PTEN-WT) and mutant (PTEN-MT) sequences at the predicted binding site (Figure 4A). csi-miR-96-5p was able to bind to PTEN-WT and significantly down-regulate firefly luciferase activity, while no notable alteration was observed in the other groups, which confirmed the accuracy of the predicted binding sites (Figure 4B).
Then, we verified the regulation in CCA cells. RBE cells were transfected with csi-miR-96-5p at a final concentration of 50 nM. Compared with those in the negative control group, qPCR detection indicated that csi-miR-96-5p in RBE cells was significantly increased by approximately 595 times and that PTEN mRNA decreased by 34% for the csi-miR-96-5p group (Figure 4C,D). Western blot detection also revealed a prominent decrease in PTEN expression (Figure 4E). These results confirmed that csi-miR-96-5p targeted PTEN.

2.5. Effect of csi-miR-96-5p/PTEN Axis on Cholangiocarcinoma

Through the CCK-8 cell viability assay and calculation, the IC50 of erastin on RBE cells was 1.04 uM. In the following experiment, we used 1uM erastin as the ferroptosis induction dose.
PTEN lentivirus over-expressed (OV-PTEN) and knockout (KO-PTEN) cell lines were established and screened with puromycin; the expression efficiency was determined by Western blotting (Supplementary Materials Figure S1).
In the CCK-8 cell proliferation assay with or without erastin, the csi-miR-96-5p and KO-PTEN axis prominently increased RBE cell proliferation. In the co-transfection experiment, OV-PTEN significantly reversed the function (Figure 5A–D). In the presence of erastin, the cell proliferation of the negative control transfection group was significantly inhibited, while the cell proliferation of the transfected csi-miR-96-5p and KO-PTEN groups was not significantly affected, indicating that they obtained ferroptosis resistance. In line with these results, the xenograft tumor experiments indicated that the csi-miR-96-5p and KO-PTEN axis significantly increased the weight of tumors in HuCCT1 cells transfected with the lentivirus vector (Figure 5E).
In the transwell cell migration assay, the csi-miR-96-5p and KO-PTEN axis prominently increased the migration of RBE cells. OV-PTEN significantly reversed the ability of csi-miR-96-5p to promote cell migration (Figure 5F). In the presence of erastin, the cell migration ability of the negative transfection control group was significantly impaired, while the cell migration of the transfected csi-miR-96-5p and KO-PTEN groups was not significantly changed, indicating that they obtained ferroptosis resistance and the cell migration ability was maintained (Figure 5G).

2.6. The Ferroptosis Mechanism of csi-miR-96-5p/PTEN Axis

To further determine the mechanism, intracellular ferroptosis markers were detected. The results showed that the axis prominently decreased the accumulation of Fe2+ and MDA and increased the level of GSH. Furthermore, SLC7A11 and GPX4 proteins in RBE cells were up-regulated (Figure 6A–D). In the presence of erastin, the Fe2+ and MDA levels in the negative transfection control group were significantly increased compared to the group without erastin. On the other hand, the csi-miR-96-5p and KO-PTEN groups were not significantly changed, indicating that they obtained ferroptosis resistance. Similar results were also observed at the GSH level. These results indicated that the axis could resist erastin-induced ferroptosis, thereby promoting the malignant transformation of CCA.

3. Discussion

CCA is a highly malignant tumor, accounting for an estimated 10% to 20% of liver cancer [31]. Extensive clinical and laboratory research has consistently demonstrated a robust correlation between C. sinensis infection and the underlying etiology of CCA. This finding underscores the pivotal role that C. sinensis plays in the pathogenesis of this malignancy [32].
Loss of PTEN expression is frequently observed in tumor tissues and is correlated with increased malignancy and poorer prognosis [33]. However, the role of PTEN in ferroptosis has not been fully elucidated. One study showed that the continuous inhibition of PTEN enables cancer cells to resist ferroptosis by upregulating sterol regulatory element binding protein-1 [34]. Another study showed that ARID3A inhibits the transcription of PTEN, which leads to the depletion of GPX4 and an increase in lipid peroxidation [35]. Moreover, evidence from both animal models and in vitro experiments revealed that pioglitazone, an activator of PPARγ, effectively inhibited chondrocyte ferroptosis through a mechanism involving PTEN- induced mitophagy [36].
Through functional enrichment analysis and target gene prediction, we found that miRNAs in CS-EVs play an important role in tumor progression through multiple pathways. KEGG analysis showed that the most abundant miRNA enrichment pathway was the PTEN/PI3K/AKT pathway, followed by the MAPK pathway, etc. The miRNA targets and relative pathways are shown in Table S2. Taking into account different gene targets and different pathways, it can be concluded that miRNA may play a variety of roles in promoting cancer progression and inhibiting cancer progression. However, these results were merely predictions made through bioinformatics analysis; specific and detailed information from a large number of experiments is still required for verification.
In our study, we first predicted that the miRNAs in CS-EVs were associated with PTEN inhibition by small RNA high-throughput sequencing and gene function enrichment analysis, and then proved that csi-miR-96-5p could target and inhibit PTEN expression by dual luciferase assay and cell transfection. Cell proliferation and migration experiments showed that the csi-miR-96-5p and deletion of PTEN promoted the malignant transformation of CCA cells and significantly inhibited ferroptosis by the relative molecular mechanism. csi-miR-96-5p had the same seed sequence as hsa-miR-96-5p, despite the differences in the remaining miRNA sequences between the species. Various studies [8,9] have shown that hsa-miR-96-5p can target the inhibition of PTEN expression, thereby promoting cancer progression through multiple pathways.
Our research demonstrated the pivotal role of PTEN in modulating the malignant progression of cholangiocarcinoma via the ferroptosis pathway and the ferroptosis mechanism involved in the interaction between parasites and hosts through the delivery of miRNAs. As research progresses, the clarification of the unknown properties of these vesicles may allow the development of new methods for the prevention and treatment of C. sinensis infections and cholangiocarcinoma.

4. Materials and Methods

4.1. Animals

Sprague-Dawley rats were used to obtain C. sinensis adult worms, and Balb/c nude mice were used for subcutaneous tumor formation experiments. The protocol was approved by the Animal Ethics Committee of Jilin University (2021-703 and SY202405029). The animal experiments were carried out strictly under the supervision of the Animal Ethics and Welfare Committee. The experimental animals were allowed to freely drink and eat.

4.2. CS-EV Extraction and Identification

CS-EV extraction was performed as described previously [17]. Briefly, six-week-old Sprague-Dawley rats were infected with 200 metacercarias via gastric administration. Six weeks after infection, the rats were euthanized by cervical dislocation. Adult liver worms were collected and cultured in RPMI-1640 medium for 24 h. The medium from the cultures was centrifuged at 3000× g and 12,000× g for 30 min to collect excretory–secretory products (ESPs). After filtering, two rounds of centrifugation at 120,000× g for 90 min were completed to precipitate CS-EVs. The precipitates were dissolved in 400 µL of PBS. Transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA) and Western blot were used to identify CS-EVs as mentioned previously [17].

4.3. High-Throughput Sequencing and Functional Enrichment Analysis of miRNAs in CS-EVs

Total RNA was extracted from the CS-EVs by Trizol (Takara, Dalian, China) and a small RNA library was constructed. The procedure included the addition of 3′ and 5′ adaptors, cDNA synthesis, and PCR amplification. The quality of the small RNA library was assessed by an Agilent 2100 Bioanalyzer (Agilent Technologies, Beijing, China). The Illumina NovaSeq 6000 sequencing platform (Illumina, Beijing, China) was used for double-end sequencing. Quality control was performed on the generated raw data. Bowtie software (Version: v1.0.0) was used for alignment to the reference genome (https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_003604175.2/, accessed on 30 June 2024) [37]. The miRDeep2 software (Version: 2.0.5) was used to screen known and novel miRNAs. The online Gene Ontology (GO) resource (http://geneontology.org/, accessed date: 30 June 2024) was used for gene ontology enrichment analysis of miRNA target genes. The online tool Kyoto Encyclopedia of Genes and Genomes (KEGG) (https://www.genome.jp/kegg/, accessed on 1 June 2024) was used to analyze the signaling pathways of miRNA target genes [38].

4.4. Cell Culture and Transfection

Human CCA cell lines (RBE and HuCCT1) were obtained from the Shanghai Cell Bank at the Chinese Academy of Sciences and cultured in RPMI-1640 medium containing 10% fetal bovine serum (Epizyme, Shanghai, China). Transient transfection of csi-miR-96-5p mimics was performed using Lipofectamine 2000 (Invitrogen, Waltham, MA, USA). The csi-miR-96-5p lentiviral vector, PTEN over-expression lentiviral vector (OV-PTEN), PTEN knockout lentiviral vector based on CRISPR/Cas9 (KO-PTEN) and negative control lentiviral vectors were purchased from Shanghai Genchem Co., Ltd. (Shanghai, China). In order to construct the csi-miR-96-5p overexpressed lentiviral vector, its precursor sequence was synthesized, primers containing enzyme digestion sites were designed and PCR was performed on the precursor. After double digestion with restriction enzymes XbaI and EcoR I, the sequence was linked to the GV492 vector (Ubi-MCS-3FLAG-CBh-IRES-puromycin). The ligation products were directly transformed into E. coli and screened by ampicillin. Positive monoclonal colonies were selected for sequencing. Subsequently, lentivirus packaging and concentration and MOI value determination were performed according to the manufacturer’s instructions (Genchem, Shanghai, China). For PTEN overexpressed lentiviral vector construction, the PTEN CDS region was synthesized and the other procedures were the same as those carried out for csi-miR-96-5p. For PTEN knockout lentiviral vector construction, the GV708 vector (U6-sgRNA-EF1a-Cas9-FLAG-CMV-P2A-puro) was used. The sgRNA used for PTEN knockout was as follows: 5′-AAC TTG TCT TCC CGT CGT GT-3′. Stable cell lines were screened with puromycin. All the primers used for PCR and qPCR are listed in Table S1.

4.5. Dual Luciferase Assay

The predicted target position of PTEN 3′UTR was the 5871–5877 region, so we directly synthesized the PTEN 3′UTR 5821–6188 region including the wide type (WT) and mature type (MT) at Gene Create Bioengineering Co. in China. The two fused genes were cloned into the linearized pmirGLO vector (Promega, Madison, WI, USA) using T4 DNA ligase. The pmirGLO vector contains firefly luciferase and renilla luciferase, so renilla luciferase was used as a control. The products were transformed into E. coli and ampicillin was used to select isolate colonies containing the recombinant plasmid. The successful construction of the plasmids was verified by sequencing. The plasmids were obtained and purified through an endotoxin-free plasmid extraction kit (Tiangen, Beijing, China). The WT and MT plasmids were transfected into 293T cells with csi-miR-96-5p. After 48 h, the firefly luciferase activity was detected following the manufacturer’s procedure (Promega, USA).

4.6. Quantitative Analysis of mRNAs and miRNAs by qPCR

The total RNA and small RNA (ranging from 20 to 200 nt) were extracted utilizing Trizol reagent (Takara, China) and an miRNA isolation kit (Tiangen, China), respectively, following the manufacturers’ detailed protocols. For the reverse transcription of RNA, mRNAs were transcribed into cDNA with the PrimeScript RT Master Mix reagent kit (Takara, China). As for miRNA, a poly(A) tailing approach was employed for its reverse transcription, using the miRNA First-Strand cDNA Kit (Tiangen, China), again strictly adhering to the manufacturer’s guidelines. For quantitative PCR (qPCR) analysis, the SYBR green assay kit (Takara, China) was selected. GAPDH was used as a control for mRNA and U6 was used as a control for miRNA. The relative expression levels were computed employing the 2−ΔΔCT method. The specific primers employed in the qPCR are listed in Table S1.

4.7. Western Blot

The detailed procedure for Western blot was described previously [39]. The prime antibodies included the following: anti-CD63 (1:1000, Affinity, Changzhou, China), anti-TSG101 (1:2000, Proteintech, Wuhan, China), anti-SLC7A11 (1:1500, Boster, Wuhan, China), anti-GPX4 (1:1500, Boster, China) and anti-PTEN (1:1500, Boster, China). An anti-GAPDH antibody (1:50,000, Abclonal, Wuhan, China) was used as a control and for normalization.

4.8. Construction of Erastin-Induced Ferroptosis CCA Cell Model

The establishment method of the CCA cell ferroptosis model was the same as mentioned previously [40]. RBE cells were treated with erastin (MCE, Monmouth Junction, NJ, USA) at concentrations of 0, 0.25, 0.5, 1, 2, 4, 8 and 16 μM for 48 h and cell viability was detected by CCK-8 assay. Then, the IC50 of erastin to RBE was calculated.

4.9. Cell Proliferation Assay by CCK-8

Cells were made into 3 × 104/mL suspensions and inoculated into 96-well plates (100 µL). After culture, 10 μL of CCK-8 (MCE, NJ, USA) was dispensed into each well and incubated for 2 h. The absorbance of each well was measured at 450 nm.

4.10. Cell Proliferation Assay by Subcutaneous Tumor Model

The HuCCT1 cell line was selected for the subcutaneous tumorigenesis experiment owing to its good tumorigenicity. Lentiviral vector-mediated stably transfected HuCCT1 cells (1 × 106 cells/100 µL) were injected into the groin region of 4-week-old female BALB/c nude mice. Subsequently, tumor dimensions were monitored on a weekly basis. Upon completion of 5 weeks, the mice were humanely euthanized through cervical dislocation, and the tumors were excised for accurate weight measurements.

4.11. Cell Migration Assay by Transwell

RBE cells were resuspended in RPMI-1640 medium (5 × 105 cells/mL). Cells (100 μL) without FBS were added to the upper chambers of the 24-well plate (Corning, NY, USA), and 600 μL of culture medium supplemented with 15% FBS was added to the lower chambers. After 24 h of culture, the cells remining in the upper chambers were removed by wiping with a cotton swab. Then, the cells in the lower chambers were fixed with paraformaldehyde and stained with 0.1% crystal violet. Five fields of view were randomly selected under the microscope to count the migrated cells.

4.12. MDA, Fe2+ and GSH Assay

Cells were cultured in 6-well plates and cleaved using lysate and the cell supernatant was obtained by centrifugation. The BCA method was used to measure the total protein concentration. The MDA assay kit (Beyotime, Shanghai, China), Fe2+ assay kit (Solarbio, Beijing, China) and GSH assay kit (Beyotime, China) were used to measure relative levels according to the manufacturer’s instructions. Total protein concentrations were used to normalize each level.

4.13. Statistical Analysis

The data were presented as mean ± SD (standard deviation) and analyzed by Student’s t-test or variance analysis; both were performed with GraphPad Prism version 9.5.1. Statistical significance was detected with a p value < 0.05.

5. Conclusions

In conclusion, the loss of PTEN promoted the proliferation and migration of cholangiocarcinoma via the ferroptosis pathway and csi-miR-96-5p delivered by CS-EVs may mediate this process.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms251910350/s1.

Author Contributions

Conceptualization, L.W. and J.Y.; methodology, L.W. and M.L.; software, L.W. and M.L.; formal analysis, L.W. and M.L.; writing—review and editing, L.W. and J.Y.; supervision, J.Y.; funding acquisition, J.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Science and Technology Development Program of Jilin Province (Grant No. 20200201584JC).

Institutional Review Board Statement

The animal study protocol was approved by Jilin University (2021-703 and SY202405029).

Informed Consent Statement

Not applicable.

Data Availability Statement

The high-throughput sequencing data have been deposited in the NCBI database (BioProject: PRJNA1142748; BioSample: SAMN42956952; SRA: SRR30068625, SRR30068626, SRR30068627).

Acknowledgments

We thank Dongqiang Wang for their help with data processing in this study.

Conflicts of Interest

All the authors declare that they have no conflicts of interest.

References

  1. Jiang, T.Y.; Shi, Y.Y.; Cui, X.W.; Pan, Y.F.; Lin, Y.K.; Feng, X.F.; Ding, Z.W.; Yang, C.; Tan, Y.X.; Dong, L.W.; et al. PTEN Deficiency Facilitates Exosome Secretion and Metastasis in Cholangiocarcinoma by Impairing TFEB-mediated Lysosome Biogenesis. Gastroenterology 2023, 164, 424–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Vidotto, T.; Melo, C.M.; Lautert-Dutra, W.; Chaves, L.P.; Reis, R.B.; Squire, J.A. Pan-cancer genomic analysis shows hemizygous PTEN loss tumors are associated with immune evasion and poor outcome. Sci. Rep. 2023, 13, 5049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Alvarez-Garcia, V.; Tawil, Y.; Wise, H.M.; Leslie, N.R. Mechanisms of PTEN loss in cancer: It’s all about diversity. Semin. Cancer Biol. 2019, 59, 66–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Glaviano, A.; Foo, A.; Lam, H.Y.; Yap, K.; Jacot, W.; Jones, R.H.; Eng, H.; Nair, M.G.; Makvandi, P.; Geoerger, B.; et al. PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. Mol. Cancer 2023, 22, 138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Kimbrough-Allah, M.N.; Millena, A.C.; Khan, S.A. Differential role of PTEN in transforming growth factor beta (TGF-beta) effects on proliferation and migration in prostate cancer cells. Prostate 2018, 78, 377–389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Wu, D.; Huang, C.; Guan, K. Mechanistic and therapeutic perspectives of miRNA-PTEN signaling axis in cancer therapy resistance. Biochem. Pharmacol. 2024, 226, 116406. [Google Scholar] [CrossRef] [Scilit]
  7. Wu, H.H.; Leng, S.; Sergi, C.; Leng, R. How MicroRNAs Command the Battle against Cancer. Int. J. Mol. Sci. 2024, 25, 5865. [Google Scholar] [CrossRef] [Scilit]
  8. Park, S.E.; Kim, W.; Hong, J.Y.; Kang, D.; Park, S.; Suh, J.; You, D.; Park, Y.Y.; Suh, N.; Hwang, J.J.; et al. miR-96-5p targets PTEN to mediate sunitinib resistance in clear cell renal cell carcinoma. Sci. Rep. 2022, 12, 3537. [Google Scholar] [CrossRef] [Scilit]
  9. Vahabi, M.; Pulito, C.; Sacconi, A.; Donzelli, S.; D’Andrea, M.; Manciocco, V.; Pellini, R.; Paci, P.; Sanguineti, G.; Strigari, L.; et al. miR-96-5p targets PTEN expression affecting radio-chemosensitivity of HNSCC cells. J. Exp. Clin. Cancer Res. 2019, 38, 141. [Google Scholar] [CrossRef] [Scilit]
  10. Choi, D.; Lim, J.H.; Lee, K.T.; Lee, J.K.; Choi, S.H.; Heo, J.S.; Jang, K.T.; Lee, N.Y.; Kim, S.; Hong, S.T. Cholangiocarcinoma and Clonorchis sinensis infection: A case-control study in Korea. J. Hepatol. 2006, 44, 1066–1073. [Google Scholar] [CrossRef] [Scilit]
  11. Bouvard, V.; Baan, R.; Straif, K.; Grosse, Y.; Secretan, B.; El Ghissassi, F.; Benbrahim-Tallaa, L.; Guha, N.; Freeman, C.; Galichet, L.; et al. A review of human carcinogens—Part B: Biological agents. Lancet Oncol. 2009, 10, 321–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Xu, L.; Zhang, Y.; Lin, Z.; Deng, X.; Ren, X.; Huang, M.; Li, S.; Zhou, Q.; Fang, F.; Yang, Q.; et al. FASN-mediated fatty acid biosynthesis remodels immune environment in Clonorchis sinensis infection-related intrahepatic cholangiocarcinoma. J. Hepatol. 2024, 81, 265–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Chu, Y.; Shi, D.; Wang, N.; Ren, L.; Liu, N.; Hu, F.; Meng, W.; Hong, S.J.; Bai, X. Clonorchis sinensis legumain promotes migration and invasion of cholangiocarcinoma cells via regulating tumor-related molecules. Parasites Vectors 2023, 16, 71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Wang, C.; Lei, H.; Tian, Y.; Shang, M.; Wu, Y.; Li, Y.; Zhao, L.; Shi, M.; Tang, X.; Chen, T.; et al. Clonorchis sinensis granulin: Identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma. Parasites Vectors 2017, 10, 262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Pak, J.H.; Kim, I.K.; Kim, S.M.; Maeng, S.; Song, K.J.; Na, B.K.; Kim, T.S. Induction of cancer-related microRNA expression profiling using excretory-secretory products of Clonorchis sinensis. Parasitol. Res. 2014, 113, 4447–4455. [Google Scholar] [CrossRef] [Scilit]
  16. Chaiyadet, S.; Sotillo, J.; Smout, M.; Cantacessi, C.; Jones, M.K.; Johnson, M.S.; Turnbull, L.; Whitchurch, C.B.; Potriquet, J.; Laohaviroj, M.; et al. Carcinogenic Liver Fluke Secretes Extracellular Vesicles That Promote Cholangiocytes to Adopt a Tumorigenic Phenotype. J. Infect. Dis. 2015, 212, 1636–1645. [Google Scholar] [CrossRef] [Scilit]
  17. Yan, C.; Zhou, Q.Y.; Wu, J.; Xu, N.; Du, Y.; Li, J.; Liu, J.X.; Koda, S.; Zhang, B.B.; Yu, Q.; et al. Csi-let-7a-5p delivered by extracellular vesicles from a liver fluke activates M1-like macrophages and exacerbates biliary injuries. Proc. Natl. Acad. Sci. USA 2021, 118, e2102206118. [Google Scholar] [CrossRef] [Scilit]
  18. Zhang, X.; Duan, S.; Li, X.; Ding, J.; Zuo, L.; Sun, B.; Zhang, X.; Jiang, X.; Gao, Y.; Hu, X.; et al. Differences in the secretory exosomes of Clonorchis sinensis adults at different incubation times. Acta Trop. 2022, 234, 106604. [Google Scholar] [CrossRef] [Scilit]
  19. Ovchinnikov, V.Y.; Kashina, E.V.; Mordvinov, V.A.; Fromm, B. EV-transported microRNAs of Schistosoma mansoni and Fasciola hepatica: Potential targets in definitive hosts. Infect. Genet. Evol. 2020, 85, 104528. [Google Scholar] [CrossRef] [Scilit]
  20. Fromm, B.; Ovchinnikov, V.; Hoye, E.; Bernal, D.; Hackenberg, M.; Marcilla, A. On the presence and immunoregulatory functions of extracellular microRNAs in the trematode Fasciola hepatica. Parasite Immunol. 2017, 39, e12399. [Google Scholar] [CrossRef] [Scilit]
  21. Yothaisong, S.; Thanee, M.; Namwat, N.; Yongvanit, P.; Boonmars, T.; Puapairoj, A.; Loilome, W. Opisthorchis viverrini infection activates the PI3K/AKT/PTEN and Wnt/beta-catenin signaling pathways in a Cholangiocarcinogenesis model. Asian Pac. J. Cancer Prev. 2014, 15, 10463–10468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Tang, D.; Chen, X.; Kang, R.; Kroemer, G. Ferroptosis: Molecular mechanisms and health implications. Cell Res. 2021, 31, 107–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Gong, D.; Chen, M.; Wang, Y.; Shi, J.; Hou, Y. Role of ferroptosis on tumor progression and immunotherapy. Cell Death Discov. 2022, 8, 427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Koppula, P.; Zhuang, L.; Gan, B. Cystine transporter SLC7A11/xCT in cancer: Ferroptosis, nutrient dependency, and cancer therapy. Protein Cell 2021, 12, 599–620. [Google Scholar] [CrossRef] [Scilit]
  26. Koppula, P.; Zhang, Y.; Zhuang, L.; Gan, B. Amino acid transporter SLC7A11/xCT at the crossroads of regulating redox homeostasis and nutrient dependency of cancer. Cancer Commun. 2018, 38, 12. [Google Scholar] [CrossRef] [Scilit]
  27. Rochette, L.; Dogon, G.; Rigal, E.; Zeller, M.; Cottin, Y.; Vergely, C. Lipid Peroxidation and Iron Metabolism: Two Corner Stones in the Homeostasis Control of Ferroptosis. Int. J. Mol. Sci. 2022, 24, 449. [Google Scholar] [CrossRef] [Scilit]
  28. Capelletti, M.M.; Manceau, H.; Puy, H.; Peoc’H, K. Ferroptosis in Liver Diseases: An Overview. Int. J. Mol. Sci. 2020, 21, 4908. [Google Scholar] [CrossRef] [Scilit]
  29. Cahuzac, K.M.; Lubin, A.; Bosch, K.; Stokes, N.; Shoenfeld, S.M.; Zhou, R.; Lemon, H.; Asara, J.; Parsons, R.E. AKT activation because of PTEN loss upregulates xCT via GSK3beta/NRF2, leading to inhibition of ferroptosis in PTEN-mutant tumor cells. Cell Rep. 2023, 42, 112536. [Google Scholar] [CrossRef] [Scilit]
  30. Li, S.Q.; Xu, W.T.; Yin, Y.X.; Wei, H.T.; Li, K.Z.; Xie, M.Z.; Lv, F.; Xie, L.Y.; Hu, B.L. SNHG4-mediated PTEN destabilization confers oxaliplatin resistance in colorectal cancer cells by inhibiting ferroptosis. Apoptosis 2024, 29, 835–848. [Google Scholar] [CrossRef] [Scilit]
  31. Ilyas, S.I.; Gores, G.J. Pathogenesis, diagnosis, and management of cholangiocarcinoma. Gastroenterology 2013, 145, 1215–1229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Qian, M.B.; Chen, Y.D.; Liang, S.; Yang, G.J.; Zhou, X.N. The global epidemiology of clonorchiasis and its relation with cholangiocarcinoma. Infect. Dis. Poverty 2012, 1, 4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Lee, Y.R.; Chen, M.; Pandolfi, P.P. The functions and regulation of the PTEN tumour suppressor: New modes and prospects. Nat. Rev. Mol. Cell Biol. 2018, 19, 547–562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Yi, J.; Zhu, J.; Wu, J.; Thompson, C.B.; Jiang, X. Oncogenic activation of PI3K-AKT-mTOR signaling suppresses ferroptosis via SREBP-mediated lipogenesis. Proc. Natl. Acad. Sci. USA 2020, 117, 31189–31197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Mao, X.; Xu, J.; Xiao, M.; Liang, C.; Hua, J.; Liu, J.; Wang, W.; Yu, X.; Meng, Q.; Shi, S. ARID3A enhances chemoresistance of pancreatic cancer via inhibiting PTEN-induced ferroptosis. Redox Biol. 2024, 73, 103200. [Google Scholar] [CrossRef] [Scilit]
  36. Xue, X.; Dai, T.; Che n, J.; Xu, Y.; Yang, Z.; Huang, J.; Xu, W.; Li, S.; Meng, Q. PPARgamma activation suppresses chondrocyte ferroptosis through mitophagy in osteoarthritis. J. Orthop. Surg. Res. 2023, 18, 620. [Google Scholar] [CrossRef] [Scilit]
  37. Qiu, Y.; Wang, C.; Wang, J.; Lv, Q.; Sun, L.; Yang, Y.; Liu, M.; Liu, X.; Li, C.; Tang, B. Revealing the dynamic whole transcriptome landscape of Clonorchis sinensis: Insights into the regulatory roles of noncoding RNAs and microtubule-related genes in development. PLoS Neglect. Trop. Dis. 2024, 18, e0012311. [Google Scholar] [CrossRef] [Scilit]
  38. Zhu, L.; Liu, J.; Dao, J.; Lu, K.; Li, H.; Gu, H.; Liu, J.; Feng, X.; Cheng, G. Molecular characterization of S. japonicum exosome-like vesicles reveals their regulatory roles in parasite-host interactions. Sci. Rep. 2016, 6, 25885. [Google Scholar] [CrossRef] [Scilit]
  39. Wang, D.; Jiang, P.; Wu, X.; Zhang, Y.; Wang, C.; Li, M.; Liu, M.; Yin, J.; Zhu, G. Requirement of microtubules for secretion of a micronemal protein CpTSP4 in the invasive stage of the apicomplexan Cryptosporidium parvum. mBio 2024, 15, e0315823. [Google Scholar] [CrossRef] [Scilit]
  40. Sae-Fung, A.; Mutirangura, A.; Jitkaew, S. Identification and validation of a novel ferroptosis-related gene signature for prognosis and potential therapeutic target prediction in cholangiocarcinoma. Front. Immunol. 2022, 13, 1051273. [Google Scholar] [CrossRef] [Scilit]
Figure 1. CS-EVs were identified by different methods. (A) Observation of morphology by transmission electron microscopy. First, a 10 μL sample was dropped onto copper mesh, and the excess liquid was sucked dry. Then, uranium acetate solution was added for negative staining to enhance the contrast between the vesicle and the background. The appropriate magnification and focal length were adjusted for observation. EVs appear as discrete, membrane-bound structures, varying in size and shape (spherical or cup-like). (B) The particle size was determined by nanoparticle tracking analysis. (C) Detection of extracellular vesicle protein markers by Western blot.
Figure 1. CS-EVs were identified by different methods. (A) Observation of morphology by transmission electron microscopy. First, a 10 μL sample was dropped onto copper mesh, and the excess liquid was sucked dry. Then, uranium acetate solution was added for negative staining to enhance the contrast between the vesicle and the background. The appropriate magnification and focal length were adjusted for observation. EVs appear as discrete, membrane-bound structures, varying in size and shape (spherical or cup-like). (B) The particle size was determined by nanoparticle tracking analysis. (C) Detection of extracellular vesicle protein markers by Western blot.
Ijms 25 10350 g001
Figure 2. Functional enrichment analysis of CS-EV miRNAs through GO (A) and KEGG (B) pathways. Count refers to the number of related enriched terms.
Figure 2. Functional enrichment analysis of CS-EV miRNAs through GO (A) and KEGG (B) pathways. Count refers to the number of related enriched terms.
Ijms 25 10350 g002
Figure 3. The uptake of CS-EVs by RBE cells was verified by confocal microscopy with PKH-67 labeling (green). RBE cells were incubated with the PKH67-PBS control (A) and 10 μg of PKH67-CS-EVs (B) for 24 h.
Figure 3. The uptake of CS-EVs by RBE cells was verified by confocal microscopy with PKH-67 labeling (green). RBE cells were incubated with the PKH67-PBS control (A) and 10 μg of PKH67-CS-EVs (B) for 24 h.
Ijms 25 10350 g003
Figure 4. Dual luciferase assay and cell transfection demonstrated csi-miR-96-5p inhibited PTEN expression. (A) The binding sites are shown in red, and relative mutant nucleotides are shown below. (B) csi-miR-96-5p inhibited the 3′-UTR-luciferase reporter gene of wild-type PTEN but had no significant effect on the other groups. (CE) After transfection, the expression of PTEN was detected by qPCR and Western blot. ns, not significant difference; * means p < 0.05.
Figure 4. Dual luciferase assay and cell transfection demonstrated csi-miR-96-5p inhibited PTEN expression. (A) The binding sites are shown in red, and relative mutant nucleotides are shown below. (B) csi-miR-96-5p inhibited the 3′-UTR-luciferase reporter gene of wild-type PTEN but had no significant effect on the other groups. (CE) After transfection, the expression of PTEN was detected by qPCR and Western blot. ns, not significant difference; * means p < 0.05.
Ijms 25 10350 g004
Figure 5. The csi-miR-96-5p/KO-PTEN axis in promoting CCA progression. (AD) Proliferation of RBE cells was detected by CCK-8 assay with or without erastin. (E) Proliferation of HuCCT1 cells was detected by subcutaneous tumor. (F,G) Transwell assay was used to detect migration of RBE cells with or without erastin. After 24 h of cell culture, crystal violet staining was performed. The number of cells was observed under a 10-fold eyepiece using a light microscope. Five fields of view were randomly selected under the microscope to count the migrated cells. csi-miR-96-5p and KO-PTEN prominently increased migration. Erastin significantly reduced the migration of the negative control group, but had no significant effect on the csi-miR-96-5p and KO-PTEN group. LV, lentiviral vector transfection; KO, lentiviral knockout; OV, lentiviral over-expressed. The data are shown as the mean ± SD; * means p < 0.05.
Figure 5. The csi-miR-96-5p/KO-PTEN axis in promoting CCA progression. (AD) Proliferation of RBE cells was detected by CCK-8 assay with or without erastin. (E) Proliferation of HuCCT1 cells was detected by subcutaneous tumor. (F,G) Transwell assay was used to detect migration of RBE cells with or without erastin. After 24 h of cell culture, crystal violet staining was performed. The number of cells was observed under a 10-fold eyepiece using a light microscope. Five fields of view were randomly selected under the microscope to count the migrated cells. csi-miR-96-5p and KO-PTEN prominently increased migration. Erastin significantly reduced the migration of the negative control group, but had no significant effect on the csi-miR-96-5p and KO-PTEN group. LV, lentiviral vector transfection; KO, lentiviral knockout; OV, lentiviral over-expressed. The data are shown as the mean ± SD; * means p < 0.05.
Ijms 25 10350 g005
Figure 6. The molecular mechanism in ferroptosis. (A) Detection of intracellular GSH (glutathione reductase) with or without erastin. (B) Detection of the intracellular Fe2+ (ferrous ion) with or without erastin. (C) Detection of the intracellular MDA (malondialdehyde). (D) Detection of the intracellular SLC7A11 (Solute carrier family 7 member 11) and GPX4 (glutathione peroxidase 4) protein level with or without erastin. The data are shown as the mean ± SD; * p < 0.05.
Figure 6. The molecular mechanism in ferroptosis. (A) Detection of intracellular GSH (glutathione reductase) with or without erastin. (B) Detection of the intracellular Fe2+ (ferrous ion) with or without erastin. (C) Detection of the intracellular MDA (malondialdehyde). (D) Detection of the intracellular SLC7A11 (Solute carrier family 7 member 11) and GPX4 (glutathione peroxidase 4) protein level with or without erastin. The data are shown as the mean ± SD; * p < 0.05.
Ijms 25 10350 g006
Table 1. Identification of miRNAs in CS-EVs with average TPM values from three samples.
Table 1. Identification of miRNAs in CS-EVs with average TPM values from three samples.
No.miRNAsAverage TPM Sequences (5′-3′)
1csi-let-7-5p81,142TGGAAGACTTGTGATTTAGTTG
2csi-miR-61-5p47,397TGACTAGAAAGAGCACTCACATCC
3bantam42,816TGAGATCGCGATTAAAGCTGGT
4csi-miR-125a-5p41,060TCCCTGAGACCCTTTGATTGCC
5csi-miR-71a-5p36,373TGAAAGACATGGGTAATGAGT
6csi-miR-75532,329TGAGATTCAACTACTTCAACT
7csi-miR-36a 23,914GTCACCGGGTAGACATTCATTCAC
8csi-miR-2162-3p16,138TATTATGCAACGTTTCACTCT
9csi-miR-31-5p15,469TGGCAAGATTATGGCGAAGCTGA
10csi-miR-96-5p15,254CTTGGCACTTTGGAATTGTCAC
11csi-miR-281-3p14,198TGTCATGGAGTTGCTCTCTATA
12csi-miR-4614,185ATGTCATGGAGTTGCTCTCTACA
13csi-miR-34799856GTATTGCACTTTCCTTCGCCTTA
14csi-miR-125a9820TCCCTGAGACCCTTTGATTGCC
15csi-miR-745-3p8857TGCTGCCTGATAAGAGCTGTG
16csi-miR-7-5p7942TGGAAGACTTGTGATTTAGTTG
17csi-miR-219-5p7372TGATTGTCCATTCGCATTTCTT
18csi-miR-10-5p5984AACCCTGTAGACCCGAGTTTGG
19csi-miR-15610TGGAATGTTGTGAAGTATGTGC
20csi-miR-36a-3p4737TCACCGGGTAGACATTCCTTGC
21csi-miR-71b-5p3313TGAAAGACTTGAGTAGTGAGACG
22csi-miR-2a-3p1675AATCACAGCCCTGCTTGGAACC
23csi-miR-1901279CAGTGACCAGACATATCCCT
24csi-miR-91149CTTGGCACTTTGGAATTGTCAC
25csi-miR-2771060TAAATGCATTATCTGGTATGAT
26csi-miR-61-5p948TGTGGGTCTCTTTCTTGTCCAT
27csi-miR-307646TCACAACCTACTTGATTGAGG
28csi-miR-125c-5p361TCCCTGAGACCTTAGAGTTGTC
29csi-miR-8-3p218TAATACTGTTAGGTAAAGATGCC
30csi-miR-36b-3p213CCACCGGGTAGACATTCATCCGC
31csi-miR-2e-3p159TATCACAGTCCAAGCTTTGGT
32csi-miR-10-3p81AAATTCGAGTCTATAAGGAAAAA
33csi-miR-190-5p81TGATATGTATGGGTTACTTGGTG
34csi-miR-2b41TATCACAGCCCTGCTTGGGACACA
35csi-miR-8727GTGAGCAAAGTTTCAGGTGT
36csi-miR-12414TTAAGGCACGCGGTGAATGTCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wen, L.; Li, M.; Yin, J. RETRACTED: PTEN Deficiency Induced by Extracellular Vesicle miRNAs from Clonorchis sinensis Potentiates Cholangiocarcinoma Development by Inhibiting Ferroptosis. Int. J. Mol. Sci. 2024, 25, 10350. https://doi.org/10.3390/ijms251910350

AMA Style

Wen L, Li M, Yin J. RETRACTED: PTEN Deficiency Induced by Extracellular Vesicle miRNAs from Clonorchis sinensis Potentiates Cholangiocarcinoma Development by Inhibiting Ferroptosis. International Journal of Molecular Sciences. 2024; 25(19):10350. https://doi.org/10.3390/ijms251910350

Chicago/Turabian Style

Wen, Lijia, Meng Li, and Jigang Yin. 2024. "RETRACTED: PTEN Deficiency Induced by Extracellular Vesicle miRNAs from Clonorchis sinensis Potentiates Cholangiocarcinoma Development by Inhibiting Ferroptosis" International Journal of Molecular Sciences 25, no. 19: 10350. https://doi.org/10.3390/ijms251910350

APA Style

Wen, L., Li, M., & Yin, J. (2024). RETRACTED: PTEN Deficiency Induced by Extracellular Vesicle miRNAs from Clonorchis sinensis Potentiates Cholangiocarcinoma Development by Inhibiting Ferroptosis. International Journal of Molecular Sciences, 25(19), 10350. https://doi.org/10.3390/ijms251910350

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop