Melatonin Alleviates Liver Mitochondrial Dysfunction in Leptin-Deficient Mice
Abstract
1. Introduction
2. Results
2.1. Melatonin Attenuates Lipid Storage in the Livers of ob/ob Mice
2.2. Melatonin Counteracts Leptin Deficiency-Induced Mitochondrial Biogenesis
2.3. Melatonin Reverses the Remodeling of the ETC/OXPHOS Machinery Induced by Leptin Deficiency
2.4. Melatonin Restores ATP Production in ob/ob Mice
2.5. Melatonin Reduces the Stimulation of Mitochondrial Fusion Induced by the Absence of Leptin
2.6. Melatonin Protects against Mitochondrial Outer Membrane Permeabilization in ob/ob Mice
3. Discussion
4. Materials and Methods
4.1. Animal Model and Treatments
4.2. Western Blot Immunoassay
4.3. Real-Time RT-PCR
4.4. Isolation of Mitochondrial and Cytosolic Extracts
4.5. Oxygen Consumption
4.6. ATP Levels
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ye, J. Mechanism of insulin resistance in obesity: A role of ATP. Front. Med. 2021, 15, 372–382. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, V.; Spence, D.W.; Pandi-Perumal, S.R.; Brown, G.M.; Cardinali, D.P. Melatonin in mitochondrial dysfunction and related disorders. Int. J. Alzheimers Dis. 2011, 2011, 326320. [Google Scholar] [CrossRef]
- Ploumi, C.; Daskalaki, I.; Tavernarakis, N. Mitochondrial biogenesis and clearance: A balancing act. FEBS J. 2017, 284, 183–195. [Google Scholar] [CrossRef] [PubMed]
- Medina-Gomez, G. Mitochondria and endocrine function of adipose tissue. Best. Pract Res. Clin. Endocrinol. Metab. 2012, 26, 791–804. [Google Scholar] [CrossRef]
- Zhang, Y.; Zeng, X.; Jin, S. Autophagy in adipose tissue biology. Pharmacol. Res. 2012, 66, 505–512. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Rao, H.; Liu, F.; Wei, L.; Li, H.; Wu, C. Recent Advances in Adipose Tissue Dysfunction and Its Role in the Pathogenesis of Non-Alcoholic Fatty Liver Disease. Cells 2021, 10, 3300. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Macia, M.; Santos-Ledo, A.; Leslie, J.; Paish, H.L.; Collins, A.L.; Scott, R.S.; Watson, A.; Burgoyne, R.A.; White, S.; French, J.; et al. A Mammalian Target of Rapamycin-Perilipin 3 (mTORC1-Plin3) Pathway is essential to Activate Lipophagy and Protects Against Hepatosteatosis. Hepatology 2021, 74, 3441–3459. [Google Scholar] [CrossRef]
- Yu, S.; Matsusue, K.; Kashireddy, P.; Cao, W.Q.; Yeldandi, V.; Yeldandi, A.V.; Rao, M.S.; Gonzalez, F.J.; Reddy, J.K. Adipocyte-specific gene expression and adipogenic steatosis in the mouse liver due to peroxisome proliferator-activated receptor gamma1 (PPARgamma1) overexpression. J. Biol. Chem. 2003, 278, 498–505. [Google Scholar] [CrossRef]
- Carr, R.M.; Ahima, R.S. Pathophysiology of lipid droplet proteins in liver diseases. Exp. Cell Res. 2016, 340, 187–192. [Google Scholar] [CrossRef]
- Santamarina, A.B.; Carvalho-Silva, M.; Gomes, L.M.; Okuda, M.H.; Santana, A.A.; Streck, E.L.; Seelaender, M.; do Nascimento, C.M.; Ribeiro, E.B.; Lira, F.S.; et al. Decaffeinated green tea extract rich in epigallocatechin-3-gallate prevents fatty liver disease by increased activities of mitochondrial respiratory chain complexes in diet-induced obesity mice. J. Nutr. Biochem. 2015, 26, 1348–1356. [Google Scholar] [CrossRef]
- Solis-Munoz, P.; Solis-Herruzo, J.A.; Fernandez-Moreira, D.; Gomez-Izquierdo, E.; Garcia-Consuegra, I.; Munoz-Yague, T.; Garcia Ruiz, I. Melatonin improves mitochondrial respiratory chain activity and liver morphology in ob/ob mice. J. Pineal Res. 2011, 51, 113–123. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Qu, H.; Xiong, X.; Wang, Y.; Liu, X.; Zhang, L.; Liao, X.; Liao, Q.; Sun, Z.; Ouyang, Q.; et al. Deficiency of Mitochondrial Glycerol 3-Phosphate Dehydrogenase Contributes to Hepatic Steatosis. Hepatology 2019, 70, 84–97. [Google Scholar] [CrossRef] [PubMed]
- Cioffi, F.; Giacco, A.; Petito, G.; de Matteis, R.; Senese, R.; Lombardi, A.; de Lange, P.; Moreno, M.; Goglia, F.; Lanni, A.; et al. Altered Mitochondrial Quality Control in Rats with Metabolic Dysfunction-Associated Fatty Liver Disease (MAFLD) Induced by High-Fat Feeding. Genes 2022, 13, 315. [Google Scholar] [CrossRef] [PubMed]
- Shin, S.; Kim, J.; Lee, J.Y.; Kim, J.; Oh, C.M. Mitochondrial Quality Control: Its Role in Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD). J. Obes. Metab. Syndr. 2023, 32, 289–302. [Google Scholar] [CrossRef] [PubMed]
- Nassir, F.; Rector, R.S.; Hammoud, G.M.; Ibdah, J.A. Pathogenesis and Prevention of Hepatic Steatosis. Gastroenterol. Hepatol. 2015, 11, 167–175. [Google Scholar]
- Mantena, S.K.; King, A.L.; Andringa, K.K.; Eccleston, H.B.; Bailey, S.M. Mitochondrial dysfunction and oxidative stress in the pathogenesis of alcohol- and obesity-induced fatty liver diseases. Free Radic. Biol. Med. 2008, 44, 1259–1272. [Google Scholar] [CrossRef] [PubMed]
- Ferrara, D.; Montecucco, F.; Dallegri, F.; Carbone, F. Impact of different ectopic fat depots on cardiovascular and metabolic diseases. J. Cell Physiol. 2019, 234, 21630–21641. [Google Scholar] [CrossRef] [PubMed]
- De Pauw, A.; Tejerina, S.; Raes, M.; Keijer, J.; Arnould, T. Mitochondrial (dys)function in adipocyte (de)differentiation and systemic metabolic alterations. Am. J. Pathol. 2009, 175, 927–939. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Tan, D.X.; Mayo, J.C.; Sainz, R.M.; Leon, J.; Czarnocki, Z. Melatonin as an antioxidant: Biochemical mechanisms and pathophysiological implications in humans. Acta Biochim. Pol. 2003, 50, 1129–1146. [Google Scholar] [CrossRef]
- Prunet-Marcassus, B.; Desbazeille, M.; Bros, A.; Louche, K.; Delagrange, P.; Renard, P.; Casteilla, L.; Penicaud, L. Melatonin reduces body weight gain in Sprague Dawley rats with diet-induced obesity. Endocrinology 2003, 144, 5347–5352. [Google Scholar] [CrossRef]
- Zhang, L.; Su, P.; Xu, C.; Chen, C.; Liang, A.; Du, K.; Peng, Y.; Huang, D. Melatonin inhibits adipogenesis and enhances osteogenesis of human mesenchymal stem cells by suppressing PPARgamma expression and enhancing Runx2 expression. J. Pineal Res. 2010, 49, 364–372. [Google Scholar] [CrossRef] [PubMed]
- Zanuto, R.; Siqueira-Filho, M.A.; Caperuto, L.C.; Bacurau, R.F.; Hirata, E.; Peliciari-Garcia, R.A.; do Amaral, F.G.; Marcal, A.C.; Ribeiro, L.M.; Camporez, J.P.; et al. Melatonin improves insulin sensitivity independently of weight loss in old obese rats. J. Pineal Res. 2013, 55, 156–165. [Google Scholar] [CrossRef] [PubMed]
- Agil, A.; Reiter, R.J.; Jimenez-Aranda, A.; Iban-Arias, R.; Navarro-Alarcon, M.; Marchal, J.A.; Adem, A.; Fernandez-Vazquez, G. Melatonin ameliorates low-grade inflammation and oxidative stress in young Zucker diabetic fatty rats. J. Pineal Res. 2013, 54, 381–388. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Zhang, Y.; Chen, Q.; Liu, S.; Xu, W.; Shang, W.; Wang, L.; Yu, J. Melatonin Alleviates Glucose and Lipid Metabolism Disorders in Guinea Pigs Caused by Different Artificial Light Rhythms. J. Diabetes Res. 2020, 2020, 4927403. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.; Huang, F.F.; Qu, S. Melatonin: A potential intervention for hepatic steatosis. Lipids Health Dis. 2015, 14, 75. [Google Scholar] [CrossRef] [PubMed]
- Cipolla-Neto, J.; Amaral, F.G.; Afeche, S.C.; Tan, D.X.; Reiter, R.J. Melatonin, energy metabolism, and obesity: A review. J. Pineal Res. 2014, 56, 371–381. [Google Scholar] [CrossRef] [PubMed]
- Kim, T.W.; Jeong, J.H.; Hong, S.C. The impact of sleep and circadian disturbance on hormones and metabolism. Int. J. Endocrinol. 2015, 2015, 591729. [Google Scholar] [CrossRef]
- Reiter, R.J.; Tan, D.X.; Korkmaz, A.; Ma, S. Obesity and metabolic syndrome: Association with chronodisruption, sleep deprivation, and melatonin suppression. Ann. Med. 2012, 44, 564–577. [Google Scholar] [CrossRef]
- Paradies, G.; Petrosillo, G.; Paradies, V.; Reiter, R.J.; Ruggiero, F.M. Melatonin, cardiolipin and mitochondrial bioenergetics in health and disease. J. Pineal Res. 2010, 48, 297–310. [Google Scholar] [CrossRef]
- Reiter, R.J.; Paredes, S.D.; Korkmaz, A.; Jou, M.J.; Tan, D.X. Melatonin combats molecular terrorism at the mitochondrial level. Interdiscip. Toxicol. 2008, 1, 137–149. [Google Scholar] [CrossRef]
- Stacchiotti, A.; Favero, G.; Lavazza, A.; Golic, I.; Aleksic, M.; Korac, A.; Rodella, L.F.; Rezzani, R. Hepatic Macrosteatosis Is Partially Converted to Microsteatosis by Melatonin Supplementation in ob/ob Mice Non-Alcoholic Fatty Liver Disease. PLoS ONE 2016, 11, e0148115. [Google Scholar] [CrossRef]
- Kirsz, K.; Szczesna, M.; Dudek, K.; Bartlewski, P.M.; Zieba, D.A. Influence of season and nutritional status on the direct effects of leptin, orexin-A and ghrelin on luteinizing hormone and growth hormone secretion in the ovine pituitary explant model. Domest. Anim. Endocrinol. 2014, 48, 69–76. [Google Scholar] [CrossRef] [PubMed]
- Malik, S.A.; Marino, G.; BenYounes, A.; Shen, S.; Harper, F.; Maiuri, M.C.; Kroemer, G. Neuroendocrine regulation of autophagy by leptin. Cell Cycle 2011, 10, 2917–2923. [Google Scholar] [CrossRef]
- Tan, X.; Sun, X.; Li, Q.; Zhao, Y.; Zhong, W.; Sun, X.; Jia, W.; McClain, C.J.; Zhou, Z. Leptin deficiency contributes to the pathogenesis of alcoholic fatty liver disease in mice. Am. J. Pathol. 2012, 181, 1279–1286. [Google Scholar] [CrossRef] [PubMed]
- Duong, M.; Uno, K.; Nankivell, V.; Bursill, C.; Nicholls, S.J. Induction of obesity impairs reverse cholesterol transport in ob/ob mice. PLoS ONE 2018, 13, e0202102. [Google Scholar] [CrossRef]
- Holmstrom, M.H.; Tom, R.Z.; Bjornholm, M.; Garcia-Roves, P.M.; Zierath, J.R. Effect of leptin treatment on mitochondrial function in obese leptin-deficient ob/ob mice. Metabolism 2013, 62, 1258–1267. [Google Scholar] [CrossRef] [PubMed]
- Perfield, J.W., 2nd; Ortinau, L.C.; Pickering, R.T.; Ruebel, M.L.; Meers, G.M.; Rector, R.S. Altered hepatic lipid metabolism contributes to nonalcoholic fatty liver disease in leptin-deficient Ob/Ob mice. J. Obes. 2013, 2013, 296537. [Google Scholar] [CrossRef]
- de Luxan-Delgado, B.; Potes, Y.; Rubio-Gonzalez, A.; Caballero, B.; Solano, J.J.; Fernandez-Fernandez, M.; Bermudez, M.; Rodrigues Moreira Guimaraes, M.; Vega-Naredo, I.; Boga, J.A.; et al. Melatonin reduces endoplasmic reticulum stress and autophagy in liver of leptin-deficient mice. J. Pineal Res. 2016, 61, 108–123. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- de Luxan-Delgado, B.; Caballero, B.; Potes, Y.; Rubio-Gonzalez, A.; Rodriguez, I.; Gutierrez-Rodriguez, J.; Solano, J.J.; Coto-Montes, A. Melatonin administration decreases adipogenesis in the liver of ob/ob mice through autophagy modulation. J. Pineal Res. 2014, 56, 126–133. [Google Scholar] [CrossRef]
- Silva, A.M.; Oliveira, P.J. Evaluation of respiration with clark type electrode in isolated mitochondria and permeabilized animal cells. Methods Mol. Biol. 2012, 810, 7–24. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Zhang, F.; Gong, Q.; Cui, A.; Zhuo, S.; Hu, Z.; Han, Y.; Gao, J.; Sun, Y.; Liu, Z.; et al. Hepatic ATF6 Increases Fatty Acid Oxidation to Attenuate Hepatic Steatosis in Mice Through Peroxisome Proliferator-Activated Receptor alpha. Diabetes 2016, 65, 1904–1915. [Google Scholar] [CrossRef] [PubMed]
- Ros Perez, M.; Medina-Gomez, G. Obesity, adipogenesis and insulin resistance. Endocrinol. Nutr. 2011, 58, 360–369. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Yu, L.; Cai, W.; Fan, S.; Feng, L.; Ji, G.; Huang, C. Protopanaxatriol, a novel PPARgamma antagonist from Panax ginseng, alleviates steatosis in mice. Sci. Rep. 2014, 4, 7375. [Google Scholar] [CrossRef]
- Fu, Y.; Luo, N.; Klein, R.L.; Garvey, W.T. Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation. J. Lipid Res. 2005, 46, 1369–1379. [Google Scholar] [CrossRef]
- Yazdi, P.G.; Moradi, H.; Yang, J.Y.; Wang, P.H.; Vaziri, N.D. Skeletal muscle mitochondrial depletion and dysfunction in chronic kidney disease. Int. J. Clin. Exp. Med. 2013, 6, 532–539. [Google Scholar]
- Rui, L. Energy metabolism in the liver. Compr. Physiol. 2014, 4, 177–197. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.B.; Zhou, G.; Li, C. AMPK: An emerging drug target for diabetes and the metabolic syndrome. Cell Metab. 2009, 9, 407–416. [Google Scholar] [CrossRef]
- Lopez-Erauskin, J.; Galino, J.; Bianchi, P.; Fourcade, S.; Andreu, A.L.; Ferrer, I.; Munoz-Pinedo, C.; Pujol, A. Oxidative stress modulates mitochondrial failure and cyclophilin D function in X-linked adrenoleukodystrophy. Brain 2012, 135, 3584–3598. [Google Scholar] [CrossRef]
- Matas, J.; Young, N.T.; Bourcier-Lucas, C.; Ascah, A.; Marcil, M.; Deschepper, C.F.; Burelle, Y. Increased expression and intramitochondrial translocation of cyclophilin-D associates with increased vulnerability of the permeability transition pore to stress-induced opening during compensated ventricular hypertrophy. J. Mol. Cell Cardiol. 2009, 46, 420–430. [Google Scholar] [CrossRef]
- Potes, Y.; Diaz-Luis, A.; Bermejo-Millo, J.C.; Perez-Martinez, Z.; de Luxan-Delgado, B.; Rubio-Gonzalez, A.; Menendez-Valle, I.; Gutierrez-Rodriguez, J.; Solano, J.J.; Caballero, B.; et al. Melatonin Alleviates the Impairment of Muscle Bioenergetics and Protein Quality Control Systems in Leptin-Deficiency-Induced Obesity. Antioxidants 2023, 12, 1962. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Chen, Z.; Li, S.; Zhang, Y.; Jia, S.; Li, J.; Chi, Y.; Miao, Y.; Guan, Y.; Yang, J. Hepatic overexpression of ATP synthase beta subunit activates PI3K/Akt pathway to ameliorate hyperglycemia of diabetic mice. Diabetes 2014, 63, 947–959. [Google Scholar] [CrossRef] [PubMed]
- Blanquer-Rossello, M.M.; Santandreu, F.M.; Oliver, J.; Roca, P.; Valle, A. Leptin Modulates Mitochondrial Function, Dynamics and Biogenesis in MCF-7 Cells. J. Cell Biochem. 2015, 116, 2039–2048. [Google Scholar] [CrossRef]
- Combs, T.P.; Marliss, E.B. Adiponectin signaling in the liver. Rev. Endocr. Metab. Disord. 2014, 15, 137–147. [Google Scholar] [CrossRef] [PubMed]
- Fasshauer, M.; Bluher, M. Adipokines in health and disease. Trends Pharmacol. Sci. 2015, 36, 461–470. [Google Scholar] [CrossRef] [PubMed]
- Tomita, K.; Oike, Y.; Teratani, T.; Taguchi, T.; Noguchi, M.; Suzuki, T.; Mizutani, A.; Yokoyama, H.; Irie, R.; Sumimoto, H.; et al. Hepatic AdipoR2 signaling plays a protective role against progression of nonalcoholic steatohepatitis in mice. Hepatology 2008, 48, 458–473. [Google Scholar] [CrossRef] [PubMed]
- Agil, A.; El-Hammadi, M.; Jimenez-Aranda, A.; Tassi, M.; Abdo, W.; Fernandez-Vazquez, G.; Reiter, R.J. Melatonin reduces hepatic mitochondrial dysfunction in diabetic obese rats. J. Pineal Res. 2015, 59, 70–79. [Google Scholar] [CrossRef]
- Monsenego, J.; Mansouri, A.; Akkaoui, M.; Lenoir, V.; Esnous, C.; Fauveau, V.; Tavernier, V.; Girard, J.; Prip-Buus, C. Enhancing liver mitochondrial fatty acid oxidation capacity in obese mice improves insulin sensitivity independently of hepatic steatosis. J. Hepatol. 2012, 56, 632–639. [Google Scholar] [CrossRef] [PubMed]
- Baratta, F.; Pastori, D.; Polimeni, L.; Tozzi, G.; Violi, F.; Angelico, F.; Del Ben, M. Does Lysosomial Acid Lipase Reduction Play a Role in Adult Non-Alcoholic Fatty Liver Disease? Int. J. Mol. Sci. 2015, 16, 28014–28021. [Google Scholar] [CrossRef]
- Martinez-Una, M.; Lopez-Mancheno, Y.; Dieguez, C.; Fernandez-Rojo, M.A.; Novelle, M.G. Unraveling the Role of Leptin in Liver Function and Its Relationship with Liver Diseases. Int. J. Mol. Sci. 2020, 21, 9368. [Google Scholar] [CrossRef]
- Li, S.; Bouzar, C.; Cottet-Rousselle, C.; Zagotta, I.; Lamarche, F.; Wabitsch, M.; Tokarska-Schlattner, M.; Fischer-Posovszky, P.; Schlattner, U.; Rousseau, D. Resveratrol inhibits lipogenesis of 3T3-L1 and SGBS cells by inhibition of insulin signaling and mitochondrial mass increase. Biochim. Biophys. Acta 2016, 1857, 643–652. [Google Scholar] [CrossRef] [PubMed]
- Marciniak, C.; Marechal, X.; Montaigne, D.; Neviere, R.; Lancel, S. Cardiac contractile function and mitochondrial respiration in diabetes-related mouse models. Cardiovasc. Diabetol. 2014, 13, 118. [Google Scholar] [CrossRef]
- Ahola-Erkkila, S.; Carroll, C.J.; Peltola-Mjosund, K.; Tulkki, V.; Mattila, I.; Seppanen-Laakso, T.; Oresic, M.; Tyynismaa, H.; Suomalainen, A. Ketogenic diet slows down mitochondrial myopathy progression in mice. Hum. Mol. Genet. 2010, 19, 1974–1984. [Google Scholar] [CrossRef] [PubMed]
- Corton, J.M.; Gillespie, J.G.; Hawley, S.A.; Hardie, D.G. 5-aminoimidazole-4-carboxamide ribonucleoside. A specific method for activating AMP-activated protein kinase in intact cells? Eur. J. Biochem. 1995, 229, 558–565. [Google Scholar] [CrossRef] [PubMed]
- Golubitzky, A.; Dan, P.; Weissman, S.; Link, G.; Wikstrom, J.D.; Saada, A. Screening for active small molecules in mitochondrial complex I deficient patient’s fibroblasts, reveals AICAR as the most beneficial compound. PLoS ONE 2011, 6, e26883. [Google Scholar] [CrossRef] [PubMed]
- Viscomi, C.; Bottani, E.; Civiletto, G.; Cerutti, R.; Moggio, M.; Fagiolari, G.; Schon, E.A.; Lamperti, C.; Zeviani, M. In vivo correction of COX deficiency by activation of the AMPK/PGC-1alpha axis. Cell Metab. 2011, 14, 80–90. [Google Scholar] [CrossRef]
- Liu, Y.J.; McIntyre, R.L.; Janssens, G.E.; Houtkooper, R.H. Mitochondrial fission and fusion: A dynamic role in aging and potential target for age-related disease. Mech. Ageing Dev. 2020, 186, 111212. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Zhao, J.; Liu, H.; Wang, J.; Lu, W. Melatonin inhibits apoptosis in mouse Leydig cells via the retinoic acid-related orphan nuclear receptor alpha/p53 pathway. Life Sci. 2020, 246, 117431. [Google Scholar] [CrossRef]
- Promsan, S.; Lungkaphin, A. The roles of melatonin on kidney injury in obese and diabetic conditions. Biofactors 2020, 46, 531–549. [Google Scholar] [CrossRef]
- Sheen, J.M.; Chen, Y.C.; Hsu, M.H.; Tain, Y.L.; Huang, Y.H.; Tiao, M.M.; Li, S.W.; Huang, L.T. Melatonin Alleviates Liver Apoptosis in Bile Duct Ligation Young Rats. Int. J. Mol. Sci. 2016, 17, 1365. [Google Scholar] [CrossRef]
- Loureiro, R.; Mesquita, K.A.; Oliveira, P.J.; Vega-Naredo, I. Mitochondria in cancer stem cells: A target for therapy. Recent. Pat. Endocr. Metab. Immune Drug Discov. 2013, 7, 102–114. [Google Scholar] [CrossRef]
- Machida, K.; Ohta, Y.; Osada, H. Suppression of apoptosis by cyclophilin D via stabilization of hexokinase II mitochondrial binding in cancer cells. J. Biol. Chem. 2006, 281, 14314–14320. [Google Scholar] [CrossRef]
- Elrod, J.W.; Molkentin, J.D. Physiologic functions of cyclophilin D and the mitochondrial permeability transition pore. Circ. J. 2013, 77, 1111–1122. [Google Scholar] [CrossRef] [PubMed]
- Etzler, J.C.; Bollo, M.; Holstein, D.; Deng, J.J.; Perez, V.; Lin, D.T.; Richardson, A.; Bai, Y.; Lechleiter, J.D. Cyclophilin D over-expression increases mitochondrial complex III activity and accelerates supercomplex formation. Arch. Biochem. Biophys. 2017, 613, 61–68. [Google Scholar] [CrossRef]
- Agil, A.; Rosado, I.; Ruiz, R.; Figueroa, A.; Zen, N.; Fernandez-Vazquez, G. Melatonin improves glucose homeostasis in young Zucker diabetic fatty rats. J. Pineal Res. 2012, 52, 203–210. [Google Scholar] [CrossRef] [PubMed]
- Bahrami, M.; Cheraghpour, M.; Jafarirad, S.; Alavinejad, P.; Asadi, F.; Hekmatdoost, A.; Mohammadi, M.; Yari, Z. The effect of melatonin on treatment of patients with non-alcoholic fatty liver disease: A randomized double blind clinical trial. Complement. Ther. Med. 2020, 52, 102452. [Google Scholar] [CrossRef]
- Favero, G.; Stacchiotti, A.; Castrezzati, S.; Bonomini, F.; Albanese, M.; Rezzani, R.; Rodella, L.F. Melatonin reduces obesity and restores adipokine patterns and metabolism in obese (ob/ob) mice. Nutr. Res. 2015, 35, 891–900. [Google Scholar] [CrossRef] [PubMed]
- Gonciarz, M.; Bielanski, W.; Partyka, R.; Brzozowski, T.; Konturek, P.C.; Eszyk, J.; Celinski, K.; Reiter, R.J.; Konturek, S.J. Plasma insulin, leptin, adiponectin, resistin, ghrelin, and melatonin in nonalcoholic steatohepatitis patients treated with melatonin. J. Pineal Res. 2013, 54, 154–161. [Google Scholar] [CrossRef]
- Lin, Z.; Wu, F.; Lin, S.; Pan, X.; Jin, L.; Lu, T.; Shi, L.; Wang, Y.; Xu, A.; Li, X. Adiponectin protects against acetaminophen-induced mitochondrial dysfunction and acute liver injury by promoting autophagy in mice. J. Hepatol. 2014, 61, 825–831. [Google Scholar] [CrossRef]









| Forward | Reverse | |
|---|---|---|
| AdipoR1 | CCCACCATGCCATGGAGA | GCCATGTAGCAGGTAGTCGTTGT |
| AdipoR2 | CAGGAAGATGAGGGCTTTATGG | GAGGAAGTCATTATCCTTGAGCCA |
| GAPDH | CAATGACCCCTTCATTGACC | TGGAAGATGGTGATGGGATT |
| PPARα | TGAAGAACTTCAACATGAACAAG | TTGGCCACCAGCGTCTTC |
| PPARγ | ACTATGGAGTTCATGCTTGTGAAGGA | TTCAGCTGGTCGATATCACTGGAG |
| TFAM | ACCTCGTTCAGCATATAACGTTTATGTA | GCTCTTCCCAAGACTTCATTTCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
de Luxán-Delgado, B.; Potes, Y.; Rubio-González, A.; Solano, J.J.; Boga, J.A.; Antuña, E.; Cachán-Vega, C.; Bermejo-Millo, J.C.; Menéndez-Coto, N.; García-González, C.; et al. Melatonin Alleviates Liver Mitochondrial Dysfunction in Leptin-Deficient Mice. Int. J. Mol. Sci. 2024, 25, 8677. https://doi.org/10.3390/ijms25168677
de Luxán-Delgado B, Potes Y, Rubio-González A, Solano JJ, Boga JA, Antuña E, Cachán-Vega C, Bermejo-Millo JC, Menéndez-Coto N, García-González C, et al. Melatonin Alleviates Liver Mitochondrial Dysfunction in Leptin-Deficient Mice. International Journal of Molecular Sciences. 2024; 25(16):8677. https://doi.org/10.3390/ijms25168677
Chicago/Turabian Stylede Luxán-Delgado, Beatriz, Yaiza Potes, Adrian Rubio-González, Juan José Solano, José Antonio Boga, Eduardo Antuña, Cristina Cachán-Vega, Juan Carlos Bermejo-Millo, Nerea Menéndez-Coto, Claudia García-González, and et al. 2024. "Melatonin Alleviates Liver Mitochondrial Dysfunction in Leptin-Deficient Mice" International Journal of Molecular Sciences 25, no. 16: 8677. https://doi.org/10.3390/ijms25168677
APA Stylede Luxán-Delgado, B., Potes, Y., Rubio-González, A., Solano, J. J., Boga, J. A., Antuña, E., Cachán-Vega, C., Bermejo-Millo, J. C., Menéndez-Coto, N., García-González, C., Pereira, G. C., Caballero, B., Coto-Montes, A., & Vega-Naredo, I. (2024). Melatonin Alleviates Liver Mitochondrial Dysfunction in Leptin-Deficient Mice. International Journal of Molecular Sciences, 25(16), 8677. https://doi.org/10.3390/ijms25168677

