Combining Hyperspectral Techniques and Genome-Wide Association Studies to Predict Peanut Seed Vigor and Explore Associated Genetic Loci
Abstract
1. Introduction
2. Results
2.1. Seed Vigor Variation of Peanut Exhibits Diversity
2.2. SVM and RF Models Predict Peanut Seed Vigor
2.3. Genes Regulating Seed Vigor Are Efficiently Mined Using GWAS
2.3.1. Phenotypic Data Reflects Genetic Diversity
2.3.2. Screening of Arahy.VMLN7L and Arahy.7XWF6F
2.4. VMLN7L and 7XWF6F Are Involved in the Mechanisms Regulating Seed Vigor
3. Discussion
3.1. Predictive Models Based on Vigor Phenotypes
3.2. GWAS Results Confirm High-Throughput Predictive Phenotyping Validity in Investigating Genetic Relationships for Seed Vigor
3.3. Constraints and Potential Future Research
4. Materials and Methods
4.1. Seed Materials and Experimental Design
4.2. Spectral Measurements
4.3. Seed Vigor Data Acquisition
4.4. Hyperspectral Data Pre-Processing
4.5. Modeling Approaches
4.6. Vigor Phenotype and Genetics Analysis
4.6.1. Phenotypic Statistical Analysis
4.6.2. Genotyping
4.6.3. Population Structure and Linkage Disequilibrium Analysis
4.6.4. GWAS Analysis
4.6.5. GBA and Haplotype Analysis
4.6.6. Expression Analysis of Candidate Genes
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yu, H.; Liu, H.; Erasmus, S.W.; Zhao, S.; Wang, Q.; Van Ruth, S.M. Rapid High-Throughput Determination of Major Components and Amino Acids in a Single Peanut Kernel Based on Portable near-Infrared Spectroscopy Combined with Chemometrics. Ind. Crop. Prod. 2020, 158, 112956. [Google Scholar] [CrossRef]
- Hosseini Taheri, S.E.; Bazargan, M.; Rahnama Vosough, P.; Sadeghian, A. A Comprehensive Insight into Peanut: Chemical Structure of Compositions, Oxidation Process, and Storage Conditions. J. Food Compos. Anal. 2024, 125, 105770. [Google Scholar] [CrossRef]
- Mahtta, R.; Fragkias, M.; Güneralp, B.; Mahendra, A.; Reba, M.; Wentz, E.A.; Seto, K.C. Urban Land Expansion: The Role of Population and Economic Growth for 300+ Cities. NPJ Urban Sustain. 2022, 2, 1–11. [Google Scholar] [CrossRef]
- Prăvălie, R.; Patriche, C.; Borrelli, P.; Panagos, P.; Roșca, B.; Dumitraşcu, M.; Nita, I.-A.; Săvulescu, I.; Birsan, M.-V.; Bandoc, G. Arable Lands under the Pressure of Multiple Land Degradation Processes. A Global Perspective. Environ. Res. 2021, 194, 110697. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zheng, H.; Tang, Q.; Mo, W.; Ma, J. Effects of Gibberellic Acid Application after Anthesis on Seed Vigor of Indica Hybrid Rice (Oryza sativa L.). Agronomy 2019, 9, 861. [Google Scholar] [CrossRef]
- Reed, R.C.; Bradford, K.J.; Khanday, I. Seed Germination and Vigor: Ensuring Crop Sustainability in a Changing Climate. Heredity 2022, 128, 450–459. [Google Scholar] [CrossRef] [PubMed]
- Finch-Savage, W.E.; Bassel, G.W. Seed Vigour and Crop Establishment: Extending Performance beyond Adaptation. J. Exp. Bot. 2016, 67, 567–591. [Google Scholar] [CrossRef] [PubMed]
- Rajjou, L.; Duval, M.; Gallardo, K.; Catusse, J.; Bally, J.; Job, C.; Job, D. Seed Germination and Vigor. Annu. Rev. Plant Biol. 2012, 63, 507–533. [Google Scholar] [CrossRef]
- Li, H.; Yue, H.; Xie, J.; Bu, J.; Li, L.; Xin, X.; Zhao, Y.; Zhang, H.; Yang, L.; Wang, J.; et al. Transcriptomic Profiling of the High-Vigour Maize (Zea mays L.) Hybrid Variety Response to Cold and Drought Stresses during Seed Germination. Sci. Rep. 2021, 11, 19345. [Google Scholar] [CrossRef]
- Zhang, T.; Fan, S.; Xiang, Y.; Zhang, S.; Wang, J.; Sun, Q. Non-Destructive Analysis of Germination Percentage, Germination Energy and Simple Vigour Index on Wheat Seeds during Storage by Vis/NIR and SWIR Hyperspectral Imaging. Spectrochim. Acta A Mol. Biomol. Spectrosc. 2020, 239, 118488. [Google Scholar] [CrossRef]
- Al-Turki, T.A.; Baskin, C.C. Determination of Seed Viability of Eight Wild Saudi Arabian Species by Germination and X-ray Tests. Saudi J. Biol. Sci. 2017, 24, 822–829. [Google Scholar] [CrossRef] [PubMed]
- Hill, H.J.; Taylor, A.G.; Huang, X.L. Seed Viability Determinations in Cabbage Utilizing Sinapine Leakage and Electrical Conductivity Measurements. J. Exp. Bot. 1988, 39, 1439–1447. [Google Scholar] [CrossRef]
- Fenollosa, E.; Jené, L.; Munné-Bosch, S. A Rapid and Sensitive Method to Assess Seed Longevity through Accelerated Aging in an Invasive Plant Species. Plant Methods 2020, 16, 64. [Google Scholar] [CrossRef] [PubMed]
- Gnyp, M.L.; Miao, Y.; Yuan, F.; Ustin, S.L.; Yu, K.; Yao, Y.; Huang, S.; Bareth, G. Hyperspectral Canopy Sensing of Paddy Rice Aboveground Biomass at Different Growth Stages. Field Crop. Res. 2014, 155, 42–55. [Google Scholar] [CrossRef]
- Stroppiana, D.; Boschetti, M.; Brivio, P.A.; Bocchi, S. Plant Nitrogen Concentration in Paddy Rice from Field Canopy Hyperspectral Radiometry. Field Crop. Res. 2009, 111, 119–129. [Google Scholar] [CrossRef]
- Mishra, P.; Lohumi, S. Improved Prediction of Protein Content in Wheat Kernels with a Fusion of Scatter Correction Methods in NIR Data Modelling. Biosyst. Eng. 2021, 203, 93–97. [Google Scholar] [CrossRef]
- Hu, N.; Li, W.; Du, C.; Zhang, Z.; Gao, Y.; Sun, Z.; Yang, L.; Yu, K.; Zhang, Y.; Wang, Z. Predicting Micronutrients of Wheat Using Hyperspectral Imaging. Food Chem. 2021, 343, 128473. [Google Scholar] [CrossRef] [PubMed]
- Zhao, D.; Raja Reddy, K.; Kakani, V.G.; Read, J.J.; Carter, G.A. Corn (Zea mays L.) Growth, Leaf Pigment Concentration, Photosynthesis and Leaf Hyperspectral Reflectance Properties as Affected by Nitrogen Supply. Plant Soil 2003, 257, 205–218. [Google Scholar] [CrossRef]
- Cao, C.; Wang, T.; Gao, M.; Li, Y.; Li, D.; Zhang, H. Hyperspectral Inversion of Nitrogen Content in Maize Leaves Based on Different Dimensionality Reduction Algorithms. Comput. Electron. Agric. 2021, 190, 106461. [Google Scholar] [CrossRef]
- Gao, C.; Li, H.; Wang, J.; Zhang, X.; Huang, K.; Song, X.; Yang, W.; Feng, M.; Xiao, L.; Zhao, Y.; et al. Combined Use of Spectral Resampling and Machine Learning Algorithms to Estimate Soybean Leaf Chlorophyll. Comput. Electron. Agric. 2024, 218, 108675. [Google Scholar] [CrossRef]
- Sun, J.; Shi, X.; Zhang, H.; Xia, L.; Guo, Y.; Sun, X. Detection of Moisture Content in Peanut Kernels Using Hyperspectral Imaging Technology Coupled with Chemometrics. J. Food Process. Eng. 2019, 42, e13263. [Google Scholar] [CrossRef]
- Xing, M.; Long, Y.; Wang, Q.; Tian, X.; Fan, S.; Zhang, C.; Huang, W. Physiological Alterations and Nondestructive Test Methods of Crop Seed Vigor: A Comprehensive Review. Agriculture 2023, 13, 527. [Google Scholar] [CrossRef]
- Kovar, M.; Brestic, M.; Sytar, O.; Barek, V.; Hauptvogel, P.; Zivcak, M. Evaluation of Hyperspectral Reflectance Parameters to Assess the Leaf Water Content in Soybean. Water 2019, 11, 443. [Google Scholar] [CrossRef]
- Yi, Q.-X.; Huang, J.-F.; Wang, F.-M.; Wang, X.-Z.; Liu, Z.-Y. Monitoring Rice Nitrogen Status Using Hyperspectral Reflectance and Artificial Neural Network. Environ. Sci. Technol. 2007, 41, 6770–6775. [Google Scholar] [CrossRef]
- Zhang, L.; An, D.; Wei, Y.; Liu, J.; Wu, J. Prediction of Oil Content in Single Maize Kernel Based on Hyperspectral Imaging and Attention Convolution Neural Network. Food Chem. 2022, 395, 133563. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Zhang, J.; Peng, B.; Wu, T.; Jiao, Z.; Lu, Y.; Li, G.; Fan, X.; Shen, S.; Gu, A.; et al. Hyperspectral Model Based on Genetic Algorithm and SA-1DCNN for Predicting Chinese Cabbage Chlorophyll Content. Sci. Hortic. 2023, 321, 112334. [Google Scholar] [CrossRef]
- Strachan, I.B.; Pattey, E.; Boisvert, J.B. Impact of Nitrogen and Environmental Conditions on Corn as Detected by Hyperspectral Reflectance. Remote Sens. Environ. 2002, 80, 213–224. [Google Scholar] [CrossRef]
- Lu, B.; Dao, P.D.; Liu, J.; He, Y.; Shang, J. Recent Advances of Hyperspectral Imaging Technology and Applications in Agriculture. Remote Sens. 2020, 12, 2659. [Google Scholar] [CrossRef]
- Uffelmann, E.; Huang, Q.Q.; Munung, N.S.; de Vries, J.; Okada, Y.; Martin, A.R.; Martin, H.C.; Lappalainen, T.; Posthuma, D. Genome-Wide Association Studies. Nat. Rev. Methods Primers 2021, 1, 1–21. [Google Scholar] [CrossRef]
- Korte, A.; Farlow, A. The Advantages and Limitations of Trait Analysis with GWAS: A Review. Plant Methods 2013, 9, 29. [Google Scholar] [CrossRef]
- Tam, V.; Patel, N.; Turcotte, M.; Bossé, Y.; Paré, G.; Meyre, D. Benefits and Limitations of Genome-Wide Association Studies. Nat. Rev. Genet. 2019, 20, 467–484. [Google Scholar] [CrossRef] [PubMed]
- Barik, S.R.; Pandit, E.; Sanghamitra, P.; Mohanty, S.P.; Behera, A.; Mishra, J.; Nayak, D.K.; Bastia, R.; Moharana, A.; Sahoo, A.; et al. Unraveling the Genomic Regions Controlling the Seed Vigour Index, Root Growth Parameters and Germination per Cent in Rice. PLoS ONE 2022, 17, e0267303. [Google Scholar] [CrossRef]
- Morris, K.; Barker, G.C.; Walley, P.G.; Lynn, J.R.; Finch-Savage, W.E. Trait to Gene Analysis Reveals That Allelic Variation in Three Genes Determines Seed Vigour. New Phytol. 2016, 212, 964–976. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Lancon-Verdier, V.; Le Signor, C.; She, Y.-M.; Kang, Y.; Verdier, J. Genome-Wide Association Study Identified Candidate Genes for Seed Size and Seed Composition Improvement in M. truncatula. Sci. Rep. 2021, 11, 4224. [Google Scholar] [CrossRef] [PubMed]
- Dai, L.; Lu, X.; Shen, L.; Guo, L.; Zhang, G.; Gao, Z.; Zhu, L.; Hu, J.; Dong, G.; Ren, D.; et al. Genome-Wide Association Study Reveals Novel QTLs and Candidate Genes for Seed Vigor in Rice. Front. Plant Sci. 2022, 13, 1005203. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Shao, L.; Zhou, J.; Li, R.; Pandey, M.K.; Han, Y.; Cui, F.; Zhang, J.; Guo, F.; Chen, J.; et al. Genomic Insights into the Genetic Signatures of Selection and Seed Trait Loci in Cultivated Peanut. J. Adv. Res. 2022, 42, 237–248. [Google Scholar] [CrossRef] [PubMed]
- Paysan-Lafosse, T.; Blum, M.; Chuguransky, S.; Grego, T.; Pinto, B.L.; Salazar, G.A.; Bileschi, M.L.; Bork, P.; Bridge, A.; Colwell, L.; et al. InterPro in 2022. Nucleic Acids Res. 2023, 51, D418–D427. [Google Scholar] [CrossRef] [PubMed]
- Arabidopsis Lectin Receptor Kinases LecRK-IX.1 and LecRK-IX.2 Are Functional Analogs in Regulating Phytophthora Resistance and Plant Cell Death. Available online: https://apsjournals.apsnet.org/doi/epdf/10.1094/MPMI-02-15-0025-R (accessed on 17 June 2024).
- Zhang, Z.; Xie, Q.; Jobe, T.O.; Kau, A.R.; Wang, C.; Li, Y.; Qiu, B.; Wang, Q.; Mendoza-Cózatl, D.G.; Schroeder, J.I. Identification of AtOPT4 as a Plant Glutathione Transporter. Mol. Plant 2016, 9, 481–484. [Google Scholar] [CrossRef] [PubMed]
- Stacey, M.G.; Osawa, H.; Patel, A.; Gassmann, W.; Stacey, G. Expression Analyses of Arabidopsis Oligopeptide Transporters during Seed Germination, Vegetative Growth and Reproduction. Planta 2006, 223, 291–305. [Google Scholar] [CrossRef]
- Xu, P.; Tang, G.; Cui, W.; Chen, G.; Ma, C.-L.; Zhu, J.; Li, P.; Shan, L.; Liu, Z.; Wan, S. Transcriptional Differences in Peanut (Arachis hypogaea L.) Seeds at the Freshly Harvested, After-Ripening and Newly Germinated Seed Stages: Insights into the Regulatory Networks of Seed Dormancy Release and Germination. PLoS ONE 2020, 15, e0219413. [Google Scholar] [CrossRef]
- Zou, Z.; Chen, J.; Wu, W.; Luo, J.; Long, T.; Wu, Q.; Wang, Q.; Zhen, J.; Zhao, Y.; Wang, Y.; et al. Detection of Peanut Seed Vigor Based on Hyperspectral Imaging and Chemometrics. Front. Plant Sci. 2023, 14, 1127108. [Google Scholar] [CrossRef]
- Müntz, K.; Belozersky, M.A.; Dunaevsky, Y.E.; Schlereth, A.; Tiedemann, J. Stored Proteinases and the Initiation of Storage Protein Mobilization in Seeds during Germination and Seedling Growth. J. Exp. Bot. 2001, 52, 1741–1752. [Google Scholar] [CrossRef]
- Ellis, R.H. Seed and Seedling Vigour in Relation to Crop Growth and Yield. Plant Growth Regul. 1992, 11, 249–255. [Google Scholar] [CrossRef]
- Alqudah, A.M.; Sallam, A.; Stephen Baenziger, P.; Börner, A. GWAS: Fast-Forwarding Gene Identification and Characterization in Temperate Cereals: Lessons from Barley—A Review. J. Adv. Res. 2020, 22, 119–135. [Google Scholar] [CrossRef]
- Lever, J.; Krzywinski, M.; Altman, N. Principal Component Analysis. Nat. Methods 2017, 14, 641–642. [Google Scholar] [CrossRef]
- Xiao, M.; Ma, Y.; Feng, Z.; Deng, Z.; Hou, S.; Shu, L.; Lu, Z. Rice Blast Recognition Based on Principal Component Analysis and Neural Network. Comput. Electron. Agric. 2018, 154, 482–490. [Google Scholar] [CrossRef]
- Wang, Z.; Huang, W.; Li, J.; Liu, S.; Fan, S. Assessment of Protein Content and Insect Infestation of Maize Seeds Based on On-Line near-Infrared Spectroscopy and Machine Learning. Comput. Electron. Agric. 2023, 211, 107969. [Google Scholar] [CrossRef]
- Fernández-Habas, J.; Carriere Cañada, M.; García Moreno, A.M.; Leal-Murillo, J.R.; González-Dugo, M.P.; Abellanas Oar, B.; Gómez-Giráldez, P.J.; Fernández-Rebollo, P. Estimating Pasture Quality of Mediterranean Grasslands Using Hyperspectral Narrow Bands from Field Spectroscopy by Random Forest and PLS Regressions. Comput. Electron. Agric. 2022, 192, 106614. [Google Scholar] [CrossRef]
- Purcell, S.; Neale, B.; Todd-Brown, K.; Thomas, L.; Ferreira, M.A.; Bender, D.; Maller, J.; Sklar, P.; De Bakker, P.I.; Daly, M.J.; et al. PLINK: A Tool Set for Whole-Genome Association and Population-Based Linkage Analyses. Am. J. Hum. Genet. 2007, 81, 559–575. [Google Scholar] [CrossRef]
- Raj, A.; Stephens, M.; Pritchard, J.K. fastSTRUCTURE: Variational Inference of Population Structure in Large SNP Data Sets. Genetics 2014, 197, 573–589. [Google Scholar] [CrossRef]
- Bradbury, P.J.; Zhang, Z.; Kroon, D.E.; Casstevens, T.M.; Ramdoss, Y.; Buckler, E.S. TASSEL: Software for Association Mapping of Complex Traits in Diverse Samples. Bioinformatics 2007, 23, 2633–2635. [Google Scholar] [CrossRef]
- Kang, H.M.; Sul, J.H.; Service, S.K.; Zaitlen, N.A.; Kong, S.; Freimer, N.B.; Sabatti, C.; Eskin, E. Variance Component Model to Account for Sample Structure in Genome-Wide Association Studies. Nat. Genet. 2010, 42, 348–354. [Google Scholar] [CrossRef] [PubMed]
- Dash, S.; Cannon, E.K.S.; Kalberer, S.R.; Farmer, A.D.; Cannon, S.B. PeanutBase and Other Bioinformatic Resources for Peanut. In Peanuts; Elsevier: Amsterdam, The Netherlands, 2016; pp. 241–252. ISBN 978-1-63067-038-2. [Google Scholar]
- Quick, C.; Wen, X.; Abecasis, G.; Boehnke, M.; Kang, H.M. Integrating Comprehensive Functional Annotations to Boost Power and Accuracy in Gene-Based Association Analysis. PLoS Genet. 2020, 16, e1009060. [Google Scholar] [CrossRef] [PubMed]
- Eichler, E.E.; Flint, J.; Gibson, G.; Kong, A.; Leal, S.M.; Moore, J.H.; Nadeau, J.H. Missing Heritability and Strategies for Finding the Underlying Causes of Complex Disease. Nat. Rev. Genet. 2010, 11, 446–450. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Leal, S.M. Methods for Detecting Associations with Rare Variants for Common Diseases: Application to Analysis of Sequence Data. Am. J. Hum. Genet. 2008, 83, 311–321. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Vigor Index | Experiments | Max | Min | Mean | SD | CV |
---|---|---|---|---|---|---|
N1 | 1.0000 | 0.0278 | 0.8217 | 0.2501 | ||
N2 | 1.0000 | 0.0000 | 0.5105 | 0.3563 | ||
CK | 1.0000 | 0.3667 | 0.8194 | 0.2646 | ||
A3 | 1.0000 | 0.0667 | 0.7000 | 0.3618 | ||
GE | A6 | 1.0000 | 0.0333 | 0.6194 | 0.3875 | 0.5516 |
A9 | 0.8000 | 0.0000 | 0.3472 | 0.2684 | ||
A12 | 0.5000 | 0.0000 | 0.2000 | 0.1933 | ||
A15 | 0.3667 | 0.0000 | 0.0944 | 0.1294 | ||
A18 | 0.2667 | 0.0000 | 0.0611 | 0.0908 | ||
N1 | 1.0000 | 0.0000 | 0.7284 | 0.2967 | ||
N2 | 1.0000 | 0.0000 | 0.2875 | 0.2732 | ||
CK | 0.9667 | 0.2333 | 0.7667 | 0.2689 | ||
A3 | 0.9667 | 0.0000 | 0.6194 | 0.3751 | ||
GP | A6 | 0.9000 | 0.0333 | 0.4833 | 0.3103 | 0.5839 |
A9 | 0.5000 | 0.0000 | 0.1833 | 0.1709 | ||
A12 | 0.2000 | 0.0000 | 0.0667 | 0.0752 | ||
A15 | 0.1667 | 0.0000 | 0.0194 | 0.0481 | ||
A18 | 0.1000 | 0.0000 | 0.0167 | 0.0333 | ||
N1 | 25.5000 | 0.5000 | 13.1971 | 4.9501 | ||
N2 | 19.3333 | 0.0000 | 6.4408 | 4.9333 | ||
CK | 28.8333 | 6.8333 | 22.3708 | 8.5257 | ||
A3 | 26.7000 | 0.6667 | 16.4833 | 10.0378 | ||
GI | A6 | 21.9167 | 0.5000 | 12.3347 | 8.1685 | 0.5683 |
A9 | 11.2500 | 0.0000 | 4.4361 | 3.7211 | ||
A12 | 5.0333 | 0.0000 | 2.2736 | 2.2277 | ||
A15 | 4.1500 | 0.0000 | 0.9153 | 1.3953 | ||
A18 | 2.9167 | 0.0000 | 0.6056 | 0.9658 |
GE | GP | GI | |||||||
---|---|---|---|---|---|---|---|---|---|
P1 * | P2 * | P3 * | P1 | P2 | P3 | P1 | P2 | P3 | |
CK | 0.4750 | 0.9833 | 0.9333 | 0.4250 | 0.9500 | 0.8667 | 27.7583 | 11.3750 | 23.0917 |
A3 | 0.2167 | 0.9500 | 0.9333 | 0.1250 | 0.8667 | 0.8667 | 22.8417 | 3.5167 | 23.0917 |
A6 | 0.1083 | 0.8333 | 0.9167 | 0.0833 | 0.6250 | 0.7417 | 17.4250 | 1.8417 | 17.7375 |
A9 | 0.0500 | 0.6250 | 0.3667 | 0.0167 | 0.3250 | 0.2083 | 7.7917 | 0.5708 | 4.9458 |
A12 | 0.0000 | 0.3833 | 0.2167 | 0.0000 | 0.1167 | 0.0833 | 4.2833 | 0.0000 | 2.5375 |
A15 | 0.0000 | 0.2250 | 0.0583 | 0.0000 | 0.0500 | 0.0083 | 2.3250 | 0.0000 | 0.4208 |
A18 | 0.0000 | 0.1583 | 0.0250 | 0.0000 | 0.0500 | 0.0000 | 1.6417 | 0.0000 | 0.1750 |
Vigor Index | Models | Max | Min | Mean | SD | CV | Skewness | Kurtosis |
---|---|---|---|---|---|---|---|---|
GE | SVM | 0.9809 | 0.0920 | 0.6621 | 0.2046 | 0.3090 | −0.7971 | −0.1186 |
RF | 0.9138 | 0.2260 | 0.6556 | 0.1647 | 0.2512 | −0.7352 | −0.4438 | |
Line | 1.3201 | −0.1096 | 0.6078 | 0.2362 | 0.3886 | 0.1031 | 0.3570 | |
GP | SVM | 1.0066 | 0.0055 | 0.5213 | 0.2498 | 0.4792 | −0.0525 | −1.2257 |
RF | 0.7797 | 0.1476 | 0.4570 | 0.1407 | 0.3078 | 0.1131 | −0.8223 | |
Line | 1.1046 | −0.2320 | 0.4500 | 0.2304 | 0.5120 | 0.0076 | 0.0389 | |
GI | SVM | 14.5042 | 2.4231 | 9.7315 | 3.1941 | 0.3282 | −0.3235 | −0.9603 |
RF | 17.3580 | 2.2775 | 9.2745 | 2.9555 | 0.3187 | −0.0926 | −0.3725 | |
Line | 21.9095 | −2.2886 | 9.2753 | 4.3806 | 0.4723 | 0.1001 | 0.0957 |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Arahy.VMLN7L | CCCATGATGCGCCACAAAAT | CGGTGAAATTCTTACCGCCA |
Arahy.7XWF6F | ATGGGTTTTGGTTGGAACGG | CTATGCCCTTAGCAGTGGGA |
Actin | GATTGGAATGGAAGCTGCTG | CGGTCAGCAATACCAGGGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiong, Z.; Liu, S.; Tan, J.; Huang, Z.; Li, X.; Zhuang, G.; Fang, Z.; Chen, T.; Zhang, L. Combining Hyperspectral Techniques and Genome-Wide Association Studies to Predict Peanut Seed Vigor and Explore Associated Genetic Loci. Int. J. Mol. Sci. 2024, 25, 8414. https://doi.org/10.3390/ijms25158414
Xiong Z, Liu S, Tan J, Huang Z, Li X, Zhuang G, Fang Z, Chen T, Zhang L. Combining Hyperspectral Techniques and Genome-Wide Association Studies to Predict Peanut Seed Vigor and Explore Associated Genetic Loci. International Journal of Molecular Sciences. 2024; 25(15):8414. https://doi.org/10.3390/ijms25158414
Chicago/Turabian StyleXiong, Zhenhui, Shiyuan Liu, Jiangtao Tan, Zijun Huang, Xi Li, Guidan Zhuang, Zewu Fang, Tingting Chen, and Lei Zhang. 2024. "Combining Hyperspectral Techniques and Genome-Wide Association Studies to Predict Peanut Seed Vigor and Explore Associated Genetic Loci" International Journal of Molecular Sciences 25, no. 15: 8414. https://doi.org/10.3390/ijms25158414
APA StyleXiong, Z., Liu, S., Tan, J., Huang, Z., Li, X., Zhuang, G., Fang, Z., Chen, T., & Zhang, L. (2024). Combining Hyperspectral Techniques and Genome-Wide Association Studies to Predict Peanut Seed Vigor and Explore Associated Genetic Loci. International Journal of Molecular Sciences, 25(15), 8414. https://doi.org/10.3390/ijms25158414