A Systematic Review and Developmental Perspective on Origin of CMS Genes in Crops
Abstract
1. Introduction
2. Structure and Origin of CMS Genes
2.1. Chimeric Configuration of Mitochondrial CMS-Associated Genes
2.2. Original CMS Source from a Distant Hybridization
2.3. Close Connection between Original CMS Source and Distant Hybridization
3. Complexity of Angiosperm Mitochondria and Mitogenome
3.1. Variation in Mitogenome Size in Higher Plants
3.2. Complex Mitogenome Structure and Its Dynamic Change
3.3. Variation in mtDNA Sequences
3.4. Conserved Sequences and Recombination Characteristics
3.5. Substoichiometric Shifting
4. Mitochondria and mtDNA Behavior during Seed Germination
4.1. Promitochondria in Dry Seed and Mitochondrial Biosynthesis during Seed Germination
4.2. Mitochondrial Fusion and Fission during Seed Germination
4.3. Timing of mtDNA Recombination
4.3.1. MtDNA Recombination in Plants
4.3.2. The mtDNA Recombination during Distant Hybridization in Yeasts and Animals
5. Interaction between Mitochondrial and Nuclear Genomes
5.1. Stability and Quantity of Mitogenome Controlled by Nuclear Loci
5.2. Contradiction between Heterologous Genome in Nuclei and Mitogenome
6. Mechanism of the Origin of CMS Genes
6.1. CMS Genes Originate from mtDNA Recombination during Hybrid Seed Germination
6.2. Molecular Mechanism and Sequence Characters of mtDNA Recombination
7. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Mackenzie, S.; Shichuan, H.; Lyznik, A. The elusive plant mitochondrion as a genetic system. Plant Physiol. 1994, 105, 775–780. [Google Scholar] [CrossRef] [Scilit]
- Dewey, R.E.; Levings, C.S.; Timothy, D.H. Novel recombinations in the maize mitochondrial genome produce a unique transcriptional unit in the Texas male-sterile cytoplasm. Cell 1986, 44, 439–449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iwabuchi, M.; Kyozuka, J.; Shimamoto, K. Processing followed by complete editing of an altered mitochondrial apt6 RNA restores fertility of cytoplasmic male sterile rice. EMBO J. 1993, 12, 1437–1446. [Google Scholar] [CrossRef] [Scilit]
- Luo, D.; Xu, H.; Liu, Z.; Guo, J.; Li, H.; Chen, L.; Fang, C.; Zhang, Q.; Bai, M.; Yao, N.; et al. A detrimental mitochondrial-nuclear interaction causes cytoplasmic male sterility in rice. Nat. Genet. 2013, 45, 573–577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Z.; Zhao, N.; Li, S.S.; Grover, C.E.; Nie, H.S.; Wendel, J.F.; Hua, J. Plant mitochondrial genome evolution and cytoplasmic male sterility. Cri. Rev. Plant Sci. 2017, 36, 55–69. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Hao, W.; Liu, J.; Fan, S.; Zhao, W.; Deng, L.; Wang, X.; Hu, Z.; Hua, W.; Wang, H. A novel chimeric mitochondrial gene confers cytoplasmic effects on seed oil content in Polyploid Rapeseed (Brassica napus). Mol. Plant 2019, 12, 582–596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takatsuka, A.; Kazama, T.; Arimura, S.; Toriyama, K. TALEN-mediated depletion of the mitochondrial gene orf312 proves that it is a Tadukan-type cytoplasmic male sterility-causative gene in rice. Plant J. 2022, 110, 994–1004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, H.; Lu, Q.; Qiu, S.; Yu, H.; Wang, Z.; Yu, Z.; Lu, Y.; Wang, L.; Xia, F.; Wu, Y.; et al. Fujian cytoplasmic male sterility and the fertility restorer gene OsRf19 provide a promising breeding system for hybrid rice. Proc. Natl. Acad. Sci. USA 2022, 119, e2208759119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chase, C.D. Cytoplasmic male sterility, a window to the world of plant mitochondrial–nuclear interactions. Trends Genet. 2007, 23, 81–90. [Google Scholar] [CrossRef] [Scilit]
- Kubo, T.; Newton, K.J. Angiosperm mitochondrial genomes and mutations. Mitochondrion 2008, 8, 5–14. [Google Scholar] [CrossRef] [Scilit]
- Gray, M.W.; Burger, G.; Lang, B.F. Mitochondrial evolution. Science 1999, 283, 1476–1481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Z.; Cuthbert, J.M.; Taylor, D.R.; Sloan, D.B. The massive mitochondrial genome of the angiosperm Silene noctiflora is evolving by gain or loss of entire chromosomes. Proc. Natl. Acad. Sci. USA 2015, 112, 10185–10191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roger, A.J.; Muñoz- Gómez, S.A.; Kamikawa, R. The origin and diversification of mitochondria. Curr. Biol. 2017, 27, R1177–R1192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Notsu, Y.; Masood, S.; Nishikawa, T.; Kubo, N.; Akiduki, G.; Nakazono, M.; Kirai, A.; Kadowaki, K. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome, frequent DNA sequence acquisition and loss during the evolution of flowering plants. Mol. Gene. Genet. 2002, 268, 434–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sugiyama, Y.; Watase, Y.; Nagase, M.; Makita, N.; Yagura, S.; Hirai, A.; Sugiura, M. The complete nucleotide sequence and multipartite organization of the tobacco mitochondrial genome, comparative analysis of mitochondrial genomes in higher plants. Mol. Gene. Genet. 2005, 272, 603–615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanson, M.; Bentolila, S. Interactions of mitochondrial and nuclear genes that affect male gametophyte development. Plant Cell 2004, 16, S154–S169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Charlesworth, D. Origins of rice cytoplasmic male sterility genes. Cell Res. 2017, 27, 3–4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.M.; Chen, S.; Zhao, Z.; Ma, C.; Liu, Y. Investigation of B-atp6-orfH79 distributing in Chinese populations of Oryza rufipogon and analysis of its chimeric structure. BMC Plant Biol. 2023, 23, 81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reddemann, A.; Horn, R. Recombination events involving the atp9 gene are associated with male sterility of CMS PET2 in sunflower. Int. J. Mol. Sci. 2018, 19, 806. [Google Scholar] [CrossRef] [Scilit]
- Apitz, J.; Weihe, A.; Pohlheim, F.; Börner, T. Biparental inheritance of organelles in Pelargonium: Evidence for intergenomic recombination of mitochondrial DNA. Planta 2013, 237, 509–515. [Google Scholar] [CrossRef] [Scilit]
- Case, A.L.; Willis, J.H. Hybrid male sterility in Mimulus (Phrymaceae) is associated with a geographically restricted mitochondrial rearrangement. Evolution 2008, 62, 1026–1039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jaramillo-Correa, J.P.; Bousquet, J. Mitochondrial genome recombination in the zone of contact between two hybridizing conifers. Genetics 2005, 171, 1951–1962. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leducq, J.-B.; Henault, M.; Charron, G.; Nielly-Thibault, L.; Terrat, Y.; Fiumera, H.L.; Shapiro, B.J.; Landry, C.R. Mitochondrial recombination and introgression during speciation by hybridization. Mol. Biol. Evol. 2017, 34, 1947–1959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hénault, M.; Marsit, S.; Charron, G.; Landry, C.R. Hybridization drives mitochondrial DNA degeneration and metabolic shift in a species with biparental mitochondrial inheritance. Genome Res. 2022, 32, 2043–2056. [Google Scholar] [CrossRef] [Scilit]
- Dowton, M.; Castro, L.R.; Campbell, S.L.; Bargon, S.D.; Austin, A.D. Frequent mitochondrial gene rearrangements at the Hymenopteran nad3–nad5 junction. J. Mol. Evol. 2003, 56, 517–526. [Google Scholar] [CrossRef] [Scilit]
- Balakirev, E.S. Recombinant mitochondrial genomes reveal recent interspecific hybridization between Invasive Salangid Fishes. Life 2022, 12, 661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, H.Y.; Chou, J.Y.; Cheong, L.; Chang, N.H.; Yang, S.Y.; Leu, J.Y. Incompatibility of nuclear and mitochondrial genomes causes hybrid sterility between two yeast species. Cell 2008, 135, 1065–1073. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Greiner, S.; Bock, R. Tuning a ménage à trois: Co-evolution and co-adaptation of nuclear and organellar genomes in plants. BioEssays 2013, 35, 354–365. [Google Scholar] [CrossRef] [Scilit]
- Sanchez-Puerta, M.V.; Garcia, L.E.; Wohlfeiler, J.; Ceriotti, L.F. Unparalleled replacement of native mitochondrial genes by foreign homologs in a holoparasitic plant. New Phytol. 2017, 214, 376–387. [Google Scholar] [CrossRef] [Scilit]
- Allen, J.O.; Fauron, C.M.; Minx, P.; Roark, L.; Oddiraju, S.; Lin, G.N.; Meyer, L.; Sun, H.; Kim, K.; Wang, C. Comparisons among two fertile and three male-sterile mitochondrial genomes of maize. Genetics 2007, 177, 1173–1192. [Google Scholar] [CrossRef] [Scilit]
- Bentolila, S.; Stefanov, S. A reevaluation of rice mitochondrial evolution based on the complete sequence of male fertile and male sterile mitochondrial genomes. Plant Physiol. Preview 2012, 158, 996–1017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujii, S.; Kazama, T.; Yamada, M.; Toriyama, K. Discovery of global genomic re-organization based on comparison of two newly sequenced rice mitochondrial genomes with cytoplasmic male sterility-related genes. Genomics 2010, 11, 209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kubo, T.; Nishizawa, S.; Sugawara, A.; Itchoda, N.; Estiati, A.; Mikami, T. The complete nucleotide sequence of the mitochondrial genome of sugar beet (Beta vulgaris L.) reveals a novel gene for tRNAcys (GCA). Nucleic Acids Res. 2000, 28, 2571–2576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Satoh, M.; Kubo, T.; Nishizawa, S.; Estiati, A.; Itchoda, N.; Mikami, T. The cytoplasmic male-sterile type and normal type mitochondrial genomes of sugar beet share the same complement of genes of known function but differ in the content of expressed ORFs. Mol. Gene. Genet. 2004, 272, 247–256. [Google Scholar] [CrossRef] [Scilit]
- Satoh, M.; Kubo, T.; Mikami, T. The Owen mitochondrial genome in sugar beet (Beta vulgaris L.), possible mechanisms of extensive rearrangements and the origin of the mitotype-unique regions. Theor. Appl. Genet. 2006, 113, 477–484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Das, S.; Sen, S.; Chakraborty, A.; Chakraborti, P.; Maiti, M.K.; Basu, A.; Basu, D.; Sen, S.K. An unedited 1.1 kb mitochondrial orfB gene transcript in the Wild Abortive Cytoplasmic Male Sterility (WA-CMS) system of Oryza sativa L. subsp. Indica. BMC Plant Biol. 2010, 10, 39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yashitola, J.; Sundaram, R.M.; Biradar, S.K.; Thirumurugan, T.; Vishnupriya, M.R.; Rajeshwari, R.; Viraktamath, B.C.; Sarma, N.P.; Sontir, V. A sequence specific PCR marker for distinguishing rice Lines on the basis of wild abortive cytoplasm from their cognate maintainer Lines. Crop Sci. 2004, 44, 920–924. [Google Scholar] [CrossRef] [Scilit]
- Subudhi, P.K.; Nandi, S.; Casal, C.; Virmani, S.S.; Huang, N. Classification of rice germplasm III. High-resolution fingerprinting of cytoplasmic genetic male-sterile (CMS) lines with AFLP. Theor. Appl. Genet. 1998, 96, 941–949. [Google Scholar] [CrossRef] [Scilit]
- Akagi, H.; Sakamoto, M.; Shinjyo, C.; Shimada, H.; Fujimura, T. A unique sequence located downstream from the rice mitochondrial atp6 may cause male sterility. Curr. Genet. 1994, 25, 52–58. [Google Scholar] [CrossRef] [Scilit]
- Hu, J.; Wang, K.; Huang, W.C.; Liu, G.; Gao, Y.; Wang, J.M.; Huang, Q.; Ji, Y.X.; Qin, X.J.; Wan, L.; et al. The rice pentatricopeptide repeat protein rf5 restores fertility in hong-lian cytoplasmic male-sterile lines via a complex with the glycine-rich protein GRP162. Plant Cell 2012, 24, 109–122. [Google Scholar] [CrossRef] [Scilit]
- Kazama, T.; Itabashi, E.; Fujii, S.; Nakamura, T.; Toriyama, K. Mitochondrial ORF79 levels determine pollen abortion in cytoplasmic male sterile rice. Plant J. 2016, 85, 707–716. [Google Scholar] [CrossRef] [Scilit]
- Xie, H.-W.; Peng, X.-J.; Qian, M.-J.; Cai, Y.-C.; Ding, X.; Chen, Q.-S.; Cai, Q.-Y.; Zhu, Y.-L.; Yan, L.-G.; Cai, Y.-H. The chimeric mitochondrial gene orf182 causes non-pollen-type abortion in Dongxiang cytoplasmic male-sterile rice. Plant J. 2018, 95, 715–726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zabala, G.; Gabay-laughnan, S.; Laughnan, J.R. The nuclear gene Rf3 affects the expression of the mitochondrial chimeric sequence R implicated in S-type male sterility in maize. Genetics 1997, 147, 847–860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kempken, E.; Mullen, J.A.; Pring, D.R.; Tang, H.V. RNA editing of sorghum mitochondrial atp6 transcripts changes 15 amino acids and generates a carboxy-terminus identical to yeast. Curr. Genet. 1991, 20, 417–422. [Google Scholar] [CrossRef] [Scilit]
- Pring, D.R.; Tang, H.V.; Howad, W.; Kempken, F. A unique two-gene gametophytic male sterility system in sorghum involving a possible role of RNA editing in fertility restoration. J. Hered. 1999, 90, 386–393. [Google Scholar] [CrossRef] [Scilit]
- Tang, H.V.; Pring, D.R.; Muza, F.R. Sorghum mitochondrial orf25 and a related chimeric configuration of a male sterile cytoplasm. Curr. Genet. 1996, 29, 265–274. [Google Scholar] [CrossRef] [PubMed]
- Hedgcoth, C.; EL-Shehawi, A.M.; Ping, W.P.; Clarkson, M.; Tamalis, D. A chimeric open reading frame associated with cytoplasmic male sterility in alloplasmic wheat with Triticum timopheevi mitochondria is present in several Triticum and Aegilops species, barley, and rye. Curr. Genet. 2002, 41, 357–365. [Google Scholar] [CrossRef] [Scilit]
- Singh, M.; Brown, G.G. Suppression of cytoplasmic male sterility by nuclear genes alters expression of a nove1 mitochondrial gene region. Plant Cell 1991, 3, 1349–1362. [Google Scholar]
- L’Homme, Y.; Stahl, R.J.; Li, X.Q.; Hameed, A.; Brown, G.G. Brassica nap cytoplasmic male sterility is associated with expression of a mtDNA region containing a chimeric gene similar to the pol CMS-associated orf224 gene. Curr. Genet. 1997, 31, 325–335. [Google Scholar] [CrossRef] [Scilit]
- Bonhomme, S.; Budar, F.; Lancelin, D.; Small, I.; Defrance, M.C.; Pelletier, G. Sequence and transcript analysis of the Nco2.50 ogura-specific fragment correlated with cytoplasmic male sterility in Brassica cybrids. Mol. Gen. Genet. 1992, 235, 340–348. [Google Scholar] [CrossRef] [Scilit]
- Dieterich, J.H.; Braun, H.P.; Schmitz, U.K. Alloplasmic male sterility in Brassica napus (CMS ‘Tournefortii-Stiewe’) is associated with a special gene arrangement around a novel atp9 gene. Mol. Gen. Genet. 2003, 269, 723–731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Landgren, M.; Zetterstrand, M.; Sundberg, E.; Glimelius, K. Alloplasmic male-sterile Brassica lines containing B. tournefortii mitochondria express an ORF3 of the atp6 gene and a 32 kDa protein. Plant Mol. Biol. 1996, 32, 879–890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.H.; Huai, Y.; Zhang, M.F. Mitochondrial atpA gene is altered in a new orf220-type cytoplasmic male-sterile line of stem mustard (Brassica juncea). Mol. Biol. Rep. 2009, 36, 273–280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashutosh, K.P.; Kumar, V.D.; Sharma, P.C.; Prakash, S.; Bhat, S.R. A novel orf108 co-transcribed with the atpA gene is associated with cytoplasmic male sterility in Brassica juncea carrying Moricandia arvensis cytoplasm. Plant Cell Physiol. 2008, 49, 284–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shinada, T.; Kikuchi, Y.; Fujimoto, R.; Kishitani, S. An alloplasmic male-sterile Line of Brassica oleracea harboring the mitochondria from Diplotaxis muralis expresses a novel chimeric open reading frame, orf72. Plant Cell Physiol. 2006, 47, 549–553. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makaroff, C.A.; Apel, I.J.; Palmer, J.D. The atp6 coding region has been disrupted and a novel reading frame generated in the mitochondrial genome of cytoplasmic male-sterile radish. J. Biol. Chem. 1989, 264, 11706–11713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iwabuchi, M.; Koizuka, N.; Fujimoto, H.; Sakai, T.; Imamura, J. Identification and expression of the Kosena radish (Raphanus sativus cv. Kosena) homologue of the Orgura radish CMS-associated gene, orf138. Plant Mol. Biol. 1999, 39, 183–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krishnasamy, S.; Makaroff, C.A. Characterization of the radish mitochondrial orfB locus: Possible relationship with male-sterility in Ogura radish. Curr. Genet. 1993, 24, 156–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Köhler, R.H.; Horn, R.; Lössl, A.; Zetsche, K. Cytoplasmic male sterility in sunflower is correlated with the co-transcription of a new open reading frame with the atpA gene. Mol. Gene. Genet. 1991, 227, 369–376. [Google Scholar] [CrossRef] [Scilit]
- Spassova, M.F.; Moneger, C.J.; Leaver, P.; Petrov, A.; Atanassov, H.; Nijkamp, J.; Hille, J. Characterization and expression of the mitochondrial genome of a new type of cytoplasmic male-sterile sunflower. Plant Mol. Biol. 1994, 26, 1819–1831. [Google Scholar] [CrossRef] [Scilit]
- Janska, H.; Sarria, R.; Woloszynska, M.; Montiel, M.A.; Mackenzie, S.A. Stoichiometric shifts in the common bean mitochondrial genome leading to male sterility and spontaneous reversion to fertility. Plant Cell 1998, 10, 1163–1180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abad, A.R.; Mehrtens, B.J.; Mackenzie, S.A. Specific expression in reproductive tissues and fate of a mitochondrial sterility-associated protein in cytoplasmic male-sterile bean. Plant Cell 1995, 7, 271–285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xue, Y.; Collin, S.; Davies, D.R.; Thomas, C.M. Differential screening of mitochondrial cDNA libraries from male-sterile and male-fertile sugar beet reveals genome rearrangements at atpA and atp6 loci. Plant Mol. Biol. 1994, 25, 91–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.; Lim, H.; Park, S.; Cho, K.; Sung, S.; Oh, D.; Kim, K. Identification of a novel mitochondrial genome type and development of molecular makers for cytoplasm classification in radish (Raphanus sativus L.). Theor. Appl. Genet. 2007, 115, 1137–1145. [Google Scholar] [CrossRef] [Scilit]
- Young, E.G.; Hanson, M.R. A fused mitochondrial gene associated with cytoplasmic male sterility is developmentally regulated. Cell 1987, 50, 41–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anderson, E.D.; Owens, J.N. Megagametophyte development, fertilization, and cytoplasmic inheritance in Taxus brevifolia. Int. J. Plant Sci. 1999, 160, 459–469. [Google Scholar] [CrossRef] [Scilit]
- Mogensen, H.L. The how and whys of cytoplasmic inheritance in seed plants. Am. J. Bot. 1996, 83, 383–404. [Google Scholar] [CrossRef] [Scilit]
- Greiner, S.; Sobanski, J.; Bock, R. Why are most organelle genomes transmitted maternally? Bioessays 2015, 37, 80–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wagner, D.B.E.; Dong, J.E. Paternal leakage of mitochondrial DNA in pinus. Theor. Appl. Genet. 1991, 82, 510–514. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.G. Rice Male Sterility Biology; Wuhan University Press: Wuhan, China, 2001; pp. 117–221. [Google Scholar]
- Fu, T.D.; Yang, G.S.; Yang, X.N.; Ma, C.Z. The discovery, research and utilization of pol cytoplasmic male sterile in Brassicanapus. Prog. Nat. Sci. Commun. -State Key Lab. China 1995, 5, 287–293. [Google Scholar]
- Ogura, H. Studies on the new male sterility in Japanese radish, with special reference to the utilization of this sterility towards the practical raising of hybrid seeds. Mem. Fac. Agric. Kagoshima Univ. 1968, 6, 39–78. [Google Scholar]
- Shinjyo, C. Cytoplasmic genetic male sterility in cultivated rice, Oryza sativa L. II. The inheritance of male sterility. Jpn. J. Genet. 1969, 44, 149–156. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.Y.; Wang, Y.Y.; Chen, H.R.; Lu, B.R. Conserving traditional rice varieties through management for crop diversity. BioScience 2003, 53, 158–162. [Google Scholar] [CrossRef] [Scilit]
- ICRISAT (International Crops Research Institute for the Semi-Arid Tropics). Sorghum in the Eighties. In Proceedings of the International Symposium on Sorghum, Patancheru, India, 2–7 November 1981; ICRISAT: Hyderabad, India, 1982; pp. 364–378. [Google Scholar]
- Leclercq, P. Une sterilite cytoplasmique chez le tournesol. Annals Amelior des. Plantes 1969, 19, 99–106. [Google Scholar]
- Shifriss, C.; Frankel, R. A new male sterility gene in C. annuum L. J. Am. Soc. Horti. Sci. 1969, 94, 385–387. [Google Scholar] [CrossRef] [Scilit]
- Shiga, T. Male sterility and cytoplasmic differentiation. In Brassica Crops and Wild Allies, Biology and Breeding; Tsunoda, S., Ed.; Japan Scientific Societies Press: Tokyo, Japan, 1980; pp. 205–221. [Google Scholar]
- Forsberg, J.; Dixelius, C.; Lagercrantz, U.; Glimelius, K. UV dose-dependent DNA elimination in asymmetric hybrids between Brassica napus and Arabidopsis thaliana. Plant Sci. 1998, 131, 65–76. [Google Scholar] [CrossRef] [Scilit]
- Boeshore, M.L.; Lifshits, I.; Hanson, M.R.; Izhar, S. Novel composition of mitochondrial genomes in Petunia somatic hybrids derived from cytoplasmic male sterile and fertile plants. Mol. Gen. Genet. 1983, 190, 459–467. [Google Scholar] [CrossRef] [Scilit]
- Sandhu, A.; Abdelnoor, R.V.; Mackenzie, S.A. Transgenic induction of mitochondrial rearrangements for cytoplasmic male sterility in crop plants. Proc. Natl. Acad. Sci. USA 2007, 104, 1766–1770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, S.; Abad, A.R.; Gelvin, S.B.; Mackenzie, S.A. A cytoplasmic male sterility-associated mitochondrial protein causes pollen disruption in transgenic tobacco. Proc. Natl. Acad. Sci. USA 1996, 93, 11763–11768. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Zou, Y.; Li, X.; Zhang, Q.; Chen, L.; Wu, H.; Su, D.; Chen, Y.; Guo, J.; Luo, D.; et al. Cytoplasmic male sterility of rice with Boro II cytoplasm is caused by a cytotoxic peptide and is restored by two related PPR motif genes via distinct modes of mRNA silencing. Plant Cell 2006, 18, 676–687. [Google Scholar] [CrossRef] [Scilit]
- Yi, P.; Wang, L.; Sun, Q.P.; Zhu, Y.G. Discovery of mitochondria chimeric gene associated with male sterility of Honglian-rice. Chin. Sci. Bull. 2002, 47, 744–747. (In Chinese) [Google Scholar] [CrossRef] [Scilit]
- Pradhan, S.B.; Jachuck, P.J. Development of new sources of cytoplasmic male sterile lines in rice. Plant Breed. 2008, 118, 459–461. [Google Scholar] [CrossRef] [Scilit]
- Christov, M. Ways of production of new CMS sources in sunflower. Biotechnol. Biotec. Eq. 1999, 13, 25–32. [Google Scholar] [CrossRef] [Scilit]
- Serieys, H. Identification, study and utilization in breeding programs of new CMS sources. In Proceedings of the 2005 Sunflower Subnetwork Progress Report, Novi Sad, Serbia, 17–20 July 2005; FAO Subnetwork: Rome, Italy, 2005; pp. 47–53. [Google Scholar]
- Christov, M. New type of cytoplasmic male sterility in sunflower. Helia 2003, 26, 51–58. [Google Scholar] [CrossRef] [Scilit]
- Vulpe, V. Source de androsterilitate la floarea soarelui. Analete ICCPT Fundulea 1972, 38, 273–277. [Google Scholar]
- Whelan, E.D.P. A new source of CMS in sunflower. Euphytica 1980, 29, 33–46. [Google Scholar] [CrossRef] [Scilit]
- Serieys, H.; Vincourt, P. Characterization of some new CMS sources from Helianthus genus. Helia 1987, 10, 9–13. [Google Scholar]
- Duvick, D.N. Cytoplasmic pollen sterility in corn. Adv. Genet. 1965, 13, 1–56. [Google Scholar]
- Saxena, K.B.; Kumar, R.V.; Srivastava, N.; Bao, S. A cytoplasmic-nuclear male-sterility system derived from a cross between Cajanus cajanifolius and Cajanus cajan. Euphytica 2005, 145, 289–294. [Google Scholar] [CrossRef] [Scilit]
- Smith, M.B.; Palmer, R.G.; Horner, H.T. Microscopy of a cytoplasmic male-sterile soybean from an interspecific cross between Glycine max and G. soja (Leguminosae). Am. J. Bot. 2002, 89, 417–426. [Google Scholar] [CrossRef] [Scilit]
- Xing, M.; Guan, C.; Guan, M. Comparative cytological and transcriptome analyses of anther development in Nsa cytoplasmic male sterile (1258A) and maintainer lines in Brassica napus produced by distant hybridization. Int. J. Mol. Sci. 2022, 23, 2004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.B.; Xiao, Y.H.; Zhu, Y.G.; Li, R.Q.; Liu, C.L.; Wang, J.M. Study and Practice of Hybrid Rice; Shanghai Scientific and Technical Publishers: Shanghai, China, 1982; p. 145. [Google Scholar]
- Bonavent, J.F.; Bessone, L.; Geny, A.; Berville, A.; Denizot, J.P.; Brian, C. A possible origin for the sugar beet cytoplasmic male sterility source Owen. Genome 1989, 32, 322–327. [Google Scholar] [CrossRef] [Scilit]
- Duvick, D.N. The use of cytoplasmic male sterility in hybrid seed production. Econ. Bot. 1959, 13, 167–195. [Google Scholar] [CrossRef] [Scilit]
- Clayton, E.E. Male sterile tobacco. J. Hered. 1950, 41, 171–175. [Google Scholar] [CrossRef] [Scilit]
- Gillman, J.D.; Bentolila, S.; Hanson, M.R. Cytoplasmic Male Sterility and Fertility Restoration in Petunia. In Petunia Evolution, Development and Physiological Genetics; Great, T., Strommer, J., Eds.; Springer: Berlin/Heidelberg, Germany, 2009; pp. 107–129. [Google Scholar]
- Csillery, G.A. Contribution to the list of the possible interspecific crosses in Capsicum. In Proceedings of the Eucarpia Vth Meeting on Genetics and Breeding of Capsicum and Eggplant, Plovdiv, Bulgaria, 1983; pp. 15–17. [Google Scholar]
- Woong, Y.I. The Inheritance of Male Sterility and Its Utilization for Breeding in Pepper (Capsicum spp.). Ph.D. Thesis, Kyung Hee University, Seoul, Republic of Korea, 1990; pp. 1–70. [Google Scholar]
- Shifriss, C. Male sterility in pepper (Capsicum annuum L.). Euphytica 1997, 93, 83–88. [Google Scholar] [CrossRef] [Scilit]
- Peterson, P.A. Cytoplasmically inherited male sterility in Capsicum. Am. Nat. 1958, 92, 111–119. [Google Scholar] [CrossRef] [Scilit]
- Krupnov, Y.A. Gcnnaya I Tsitoplazmatichcskaya Muzhskaya Sterilnosl Rasteniy; Kolos: Moscow, Russia, 1973. [Google Scholar]
- Wu, Z.Q.; Liao, X.Z.; Zhang, X.N.; Tembrock, L.R.; Broz, A. Genomic architectural variation of plant mitochondria—A review of multichromosomal structuring. J. Syst. Evol. 2020, 60, 160–168. [Google Scholar] [CrossRef] [Scilit]
- Chang, S.; Yang, T.; Du, T.; Huang, Y.; Chen, J.; Yan, J.; He, J.; Guan, R. Mitochondrial genome sequencing helps show the evolutionary mechanism of mitochondrial genome formation in Brassica. BMC Genom. 2011, 12, 497. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Wang, J.; He, W.; Kan, S.; Liao, X.; Jordan, D.R.; Mace, E.S.; Tao, Y.; Cruickshank, A.W.; Klein, R.; et al. Variation in mitogenome structural conformation in wild and cultivated lineages of sorghum corresponds with domestication history and plastome evolution. BMC Plant Biol. 2023, 23, 91. [Google Scholar] [CrossRef] [Scilit]
- Preuten, T.; Cincu, E.; Fuchs, J.; Zoschke, R.; Liere, K.; Borner, T. Fewer genes than organelles: Extremely low and variable gene copy numbers in mitochondria of somatic plant cell. Plant J. 2010, 64, 948–959. [Google Scholar] [CrossRef] [Scilit]
- Johnston, I.G.; Burgstaller, J.P.; Havlicek, V.; Kolbe, T.; Rülicke, T.; Brem, G.; Poulton, J.; Jones, N.S. Stochastic modelling, Bayesian inference, and new in vivo measurements elucidate the debated mtDNA bottleneck mechanism. eLife 2015, 4, e07464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wai, T.; Teoli, D.; Shoubridge, E.A. The mitochondrial DNA genetic bottleneck results from replication of a subpopulation of genomes. Nat. Genet. 2008, 40, 1484–1488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, N.; Lo, Y.S.; Ansari, M.I.; Ho, K.C.; Jeng, S.T.; Lin, N.S.; Dai, H. Correlation between mtDNA complexity and mtDNA replication mode in developing cotyledon mitochondria during mung bean seed germination. New Phytol. 2017, 213, 751–763. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sloan, D.B.; Warren, J.M.; Williams, A.M.; Wu, Z.; Abdel-Ghany, S.E.; Chicco, A.J.; Havird, J.C. Cytonuclear integration and coevolution. Nat. Rev. Genet. 2018, 19, 635–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shao, R.; Kirkness, E.F.; Barker, S.C. The single mitochondrial chromosome typical of animals has evolved into 18 minichromosomes in the human body louse, Pediculus humanus. Genome Res. 2009, 19, 904–912. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sloan, D.B.; Alverson, A.J.; Chuckalovcak, J.P.; Wu, M.; McCauley, D.E.; Palmer, J.D.; Taylor, D.R. Rapid evolution of enormous, multi-chromosomal genomes in flowering plant mitochondria with exceptionally high mutation rates. PLoS Biol. 2012, 10, e1001241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanchez-Puerta, M.V.; Zubko, M.K.; Palmer, J.D. Homologous recombination and retention of a single form of most genes shape the highly chimeric mitochondrial genome of a cybrid plant. New Phytol. 2015, 206, 381–396. [Google Scholar] [CrossRef] [Scilit]
- Lai, C.; Wang, J.; Kan, S.; Zhang, S.; Li, P.; Reeve, W.G.; Wu, Z.; Zhang, Y. Comparative analysis of mitochondrial genomes of Broussonetia spp. (Moraceae) reveals heterogeneity in structure, synteny, intercellular gene transfer, and RNA editing. Front. Plant Sci. 2022, 13, 1052151. [Google Scholar] [CrossRef] [Scilit]
- Bi, C.; Qu, Y.; Hou, J.; Wu, K.; Ye, N.; Yin, T. Deciphering the multi-chromosomal mitochondrial genome of Populus simonii. Front. Plant Sci. 2022, 13, 914635. [Google Scholar] [CrossRef] [Scilit]
- Alverson, A.J.; Rice, D.W.; Dickinson, S.; Barry, K.; Palmer, J.D. Origins and recombination of the bacterial-sized multichromosomal mitochondrial genome of cucumber (Cucumis sativus). Plant Cell 2011, 23, 2499–2513. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Li, D.; Yao, X.; Song, Q.; Wang, Z.; Zhang, Q.; Zhong, C.; Liu, Y.; Huang, H. Evolution and diversification of kiwifruit mitogenomes through extensive whole-genome rearrangement and mosaic loss of intergenic sequences in a highly variable region. Genome Biol. Evol. 2019, 11, 1192–1206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manchekar, M.; Scissum-Gunn, K.; Song, D.; Khazi, F.; Mclean, S.L.; Nielsen, B.L. DNA recombination activity in soybean mitochondria. J. Mol. Biol. 2006, 356, 288–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morley, S.A.; Nielsen, B.L. Plant mitochondrial DNA. Front. Biosci-Landmrk. 2017, 22, 1023–1032. [Google Scholar] [CrossRef] [Scilit]
- Gualberto, J.M.; Mileshina, D.; Wallet, C.; Niazi, A.K.; Weber-Lotfi, F.; Dietrich, A. The plant mitochondrial genome: Dynamics and maintenance. Biochimie 2014, 100, 107–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kozik, A.; Rowan, B.A.; Lavelle, D.; Berke, L.; Schranz, M.E.; Michelmore, R.W. The alternative reality of plant mitochondrial DNA: One ring does not rule them all. PLoS Genet. 2019, 15, e1008373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Howell, K.A.; Millar, A.H.; Whelan, J. Ordered assembly of mitochondria during rice germination begins with promitochondrial structures rich in components of the protein import apparatus. Plant Mol. Biol. 2006, 60, 201–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mollier, P.; Hoffmann, B.; Debast, C.; Small, I. The gene encoding Arabidopsis thaliana mitochondrial ribosomal protein S13 is a recent duplication of the gene encoding plastid S13. Curr. Genet. 2002, 40, 405–409. [Google Scholar] [CrossRef] [Scilit]
- Iorizzo, M.; Grzebelus, D.; Senalik, D.; Szklarczyk, M.; Spooner, D.; Simon, P. Against the traffic: The first evidence for mitochondrial DNA transfer into the plastid genome. Mob. Genet. Elem. 2012, 2, 261–266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rabah, S.O.; Lee, C.; Hajrah, N.H.; Makki, R.M.; Alharby, H.F.; Alhebshi, A.M.; Sabir, J.S.; Jansen, R.K.; Ruhlman, T.A. Plastome Sequencing of Ten Nonmodel Crop Species Uncovers a Large Insertion of Mitochondrial DNA in Cashew. Plant Genome 2017, 10, plantgenome2017.03.0020. [Google Scholar] [CrossRef] [Scilit]
- Adams, K.L.; Rosenblueth, M.; Qiu, Y.L.; Palmer, J.D. Multiple losses and transfers to the nucleus of two mitochondrial respiratory genes during angiosperm evolution. Genetics 2001, 158, 1289–1300. [Google Scholar] [CrossRef] [Scilit]
- Adams, K.L.; Qiu, Y.L.; Stoutemyer, M.; Palmer, J.D. Punctuated evolution of mitochondrial gene content: High and variable rates of mitochondrial gene loss and transfer to the nucleus during angiosperm evolution. Proc. Natl. Acad. Sci. USA 2002, 99, 9905–9912. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Wang, B.; Li, L.; Qiu, Y.L.; Xue, J. Conservative and dynamic evolution of mitochondrial genomes in early land plants. In Genomics Chloroplasts Mitochondria; Springer: Dordrecht, The Netherlands, 2012; Volume 35, pp. 159–174. [Google Scholar]
- Bock, R.; Knoop, V. Genomics of Chloroplasts and Mitochondria; Springer: Dordrecht, The Netherlands; New York, NY, USA; London, UK, 2012; p. 269. [Google Scholar]
- Cole, L.; Guo, W.; Mower, J.; Palmer, J. High and variable rates of repeat-mediated mitochondrial genome rearrangement in a genus of plants. Mol. Biol. Evol. 2018, 35, 2773–2785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Handa, H.; Itani, K.; Sato, H. Structural features and expression analysis of a linear mitochondrial plasmid in rapeseed (Brassica napus L.). Mol.Genet Genom. 2002, 267, 797–805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clifton, S.W.; Minx, P.; Fauron, C.M.; Gibson, M.; Allen, J.O. Sequence and comparative analysis of the maize NB mitochondrial genome. Plant Physiol. 2004, 136, 3486–3503. [Google Scholar] [CrossRef] [Scilit]
- Palmer, J.D.; Herbon, L.A. Plant mitochondrial DNA evolved rapidly in structure, but slowly in sequence. J. Mol. Evol. 1988, 28, 87–97. [Google Scholar] [CrossRef] [Scilit]
- Mower, J.P.; Touzet, P.; Gummow, J.S.; Delph, L.F.; Palmer, J.D. Extensive variation in synonymous substitution rates in mitochondrial genes of seed plants. BMC Evol. Biol. 2007, 7, e135. [Google Scholar] [CrossRef] [Scilit]
- Abdelnoor, R.V.; Yule, R.; Elo, A.; Christensen, A.C.; Meyer-Gauen, G.; Mackenzie, S.A. Substoichiometric shifting in the plant mitochondrial genome is influenced by a gene homologous to muts. Proc. Natl. Acad. Sci. USA 2003, 100, 5968–5973. [Google Scholar] [CrossRef] [Scilit]
- Feng, X.; Kaur, A.P.; Mackenzie, S.A.; Dweikat, I.M. Substoichiometric shifting in the fertility reversion of cytoplasmic male sterile pearl millet. Theor. Appl. Genet. 2009, 118, 1361–1370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, N.; Xu, X.; Wamboldt, Y.; Machenzie, S.A.; Yang, X.D.; Hu, Z.Y.; Yang, J.H.; Zhang, M.F. MutS HOMOLOG1 silencing me–diates ORF220 substoichiometric shifting and causes male sterility in Brassica juncea. J. Exp. Bot. 2016, 67, 435–444. [Google Scholar] [CrossRef] [Scilit]
- Alexander-Lawrie, B. Recombination and Inheritance in Mitochondrial Genomes of a Freshwater Gastropod; New Mexico Institute of Mining and Technology Socorro: New Mexico, NW, USA, 2022; p. 22. [Google Scholar]
- Paszkiewicz, G.; Gualberto, J.M.; Benamar, A.; Macherel, D.; Logan, D.C. Arabidopsis seed mitochondria are bioenergetically active immediately upon imbibition and specialize via biogenesis in preparation for autotrophic growth. Plant Cell 2017, 29, 109–128. [Google Scholar] [CrossRef] [Scilit]
- Logan, D.C. Mitochondrial fusion, division and positioning in plants. Biochem. Soc. T. 2010, 38, 789–795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Law, S.R.; Narsai, R.; Taylor, N.L.; Delannoy, E.; Carrie, C.; Giraud, E.; Millar, A.H.; Small, I.; Whelan, J. Nucleotide and RNA metabolism prime translational initiation in the earliest events of mitochondrial biogenesis during Arabidopsis germination. Plant Physiol. 2012, 158, 1610–1627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Logan, D.C.; Millar, A.H.; Sweetlove, L.J.; Hill, S.A.; Leaver, C.J. Mitochondrial biogenesis during germination in maize embryos. Plant Physiol. 2001, 125, 662–672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodríguez, J.L.; De Diego, J.G.; Rodrí Vguez, F.D.; Cervantes, E. Mitochondrial structures during seed germination and early seedling development in Arabidopsis thaliana. Biologia 2015, 70, 1019–1025. [Google Scholar] [CrossRef] [Scilit]
- Millar, A.H.; Whelan, J.; Soole, K.L.; Day, D.A. Organization and regulation of mitochondrial respiration in plants. Annu. Rev. Plant Biol. 2011, 62, 79–104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carrie, C.; Murcha, M.W.; Giraud, E.; Ng, S.; Zhang, M.F.; Narsai, R.; Whelan, J. How do plants make mitochondria. Planta 2013, 237, 429–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herrmann, J.M. Converting bacteria to organelles: Evolution of mitochondrial protein sorting. Trends Microbiol. 2003, 11, 74–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giraud, E.; Ng, S.; Carrie, C.; Duncan, O.; Low, J.; Lee, C.P.; Van Aken, O.; Millar, A.H.; Murcha, M.; Whelan, J. TCP transcription factors link the regulation of genes encoding mitochondrial proteins with the circadian clock in Arabidopsis thaliana. Plant Cell 2010, 22, 3921–3934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheahan, M.B.; McCurdym, D.W.; Rose, R.J. Mitochondria as a connected population: Ensuring continuity of the mitochondrial genome during plant cell dedifferentiation through massive mitochondrial fusion. Plant J. 2005, 44, 744–755. [Google Scholar] [CrossRef] [Scilit]
- Kimata, Y.; Higaki, T.; Kurihara, D.; Ando, N.; Matsumoto, H.; Higashiyama, T.; Ueda, M. Mitochondrial dynamics and segregation during the asymmetric division of Arabidopsis zygotes. Quant. Plant Biol. 2020, 1, e3. [Google Scholar] [CrossRef] [Scilit]
- Scott, I.; Youle, R.J. Mitochondrial fission and fusion. Essays Biochem. 2010, 47, 85–98. [Google Scholar] [PubMed]
- Czarna, M.; Kolodziejczak, M.; Janska, H. Mitochondrial proteome studies in seeds during germination. Proteomes 2016, 4, 19. [Google Scholar] [CrossRef] [Scilit]
- Kraus, F.; Roy, K.; Pucadyil, T.J.; Ryan, M.T. Function and regulation of the divisome for mitochondrial fission. Nature 2021, 590, 57–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arimura, S.; Tsutsumi, N. Mitochondrial and peroxisomal division. In Molecular Cell Biology of the Growth and Differentiation of Plant Cells 15; Rose, D.J., Ed.; CRC Press: Boca Raton, FL, USA, 2016; pp. 51–65. [Google Scholar]
- Rose, R.J.; McCurdy, D.W. New beginnings: Mitochondrial renewal by massive mitochondrial fusion. Trends Plant Sci. 2017, 22, 641–643. [Google Scholar] [CrossRef] [Scilit]
- Arimura, S.; Yamamoto, J.; Aida, G.P.; Nakazono, M.; Tsutsumi, N. Frequent fusion and fission of plant mitochondria with unequal nucleoid distribution. Proc. Natl. Acad. Sci. USA 2004, 101, 7805–7808. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oldenburg, D.J.; Bendich, A.J. Mitochondrial DNA from the Liverwort Marchantia polymorpha, circularly permuted linear molecules, head-to-tail concatemers, and a 5′ protein. J. Mol Biol. 2001, 310, 549–562. [Google Scholar] [CrossRef] [Scilit]
- Backert, S.; Borner, T. Phage T4-like intermediates of DNA replication and recombination in the mitochondria of the higher plant Chenopodium album (L.). Curr. Genet. 2000, 37, 304–314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bendich, A.J. Reaching for the ring: The study of mitochondrial genome structure. Curr. Genet. 1993, 24, 279–290. [Google Scholar] [CrossRef] [Scilit]
- Sloan, D.B. One ring to rule them all? Genome sequencing provides new insights into the ‘master circle’ model of plant mitochondrial DNA structure. New Phytol. 2013, 200, 978–985. [Google Scholar] [CrossRef] [Scilit]
- Belliard, G.; Vedel, F.; Pelletier, G. Mitochondrial recombination in cytoplasmic hybrids of Nicotiana tabacum by protoplast fusion. Nature 1979, 281, 401–403. [Google Scholar] [CrossRef] [Scilit]
- Garcia, L.E.; Mikhajlo, K.; Zubko, M.K.; Zubko, E.I.; Sanchez-Puerta, M.V. Elucidating genomic patterns and recombination events in plant cybrid mitochondria. Plant Mol. Biol. 2019, 100, 433–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zubko, M.; Zubko, E.; Patskovsky, Y.V.; Khvedynich, O.A.; Fisahn, J.; Gleba, Y.Y.; Schieder, O. Novel ‘homeotic’ CMS patterns generated in Nicotiana via cybridization with Hyoscyamus and Scopolia. J. Exp. Bot. 1996, 47, 1101–1110. [Google Scholar] [CrossRef] [Scilit]
- Guo, W.W.; Wu, R.C.; Fan, G.E.; Cheng, Y.J. Analysis of mitochondrial genomes in Citrus interspecific somatic hybrids produced by protoplast fusion. Bot. Stud. 2008, 49, 295–300. [Google Scholar]
- Akagi, H.; Shimada, H.; Fujimura, T. High-frequency inter-parental recombination between mitochondrial genomes of rice cybrids. Curr. Genet. 1995, 29, 58–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poláková, S.B.; Lichtner, Ž.; Szemes, T.; Smolejová, M.; Sulo, P. Mitochondrial DNA duplication, recombination, and introgression during interspecific hybridization. Sci. Rep. 2021, 11, 12726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Banguera-Hinestroza, E.; Sawall, Y.; Al-Sofyani, A.; Mardulyn, P.; Fuertes-Aguilar, J.; Cárdenas-Henao, H.; Jimenez-Infante, F.; Voolstra, C.R.; Flot, J.-F. mtDNA recombination indicative of hybridization suggests a role of the mitogenome in the adaptation of reef-building corals to extreme environments. BioRxiv 2019, 462069. [Google Scholar] [CrossRef] [Scilit]
- Ciborowski, K.L.; Consuegra, S.; De Leániz, C.G.; Beaumont, M.A.; Wang, J.; Jordan, W.C. Rare and fleeting: An example of interspecific recombination in animal mitochondrial DNA. Biol. Lett. 2007, 3, 554–557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balakirev, E.S.; Romanov, N.S.; Mikheev, P.B.; Ayala, F.J. Mitochondrial DNA variation and introgression in Siberian taimen Hucho taimen. PLoS ONE 2013, 8, e71147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, X.; Liu, S.; Liu, Y. Evidence for recombination of mitochondrial DNA in triploid crucian carp. Genetics 2006, 172, 1745–1749. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Jiao, N.; Zhao, L.; Zhang, M.; Zhou, P.; Huang, X. Evidence for the paternal mitochondrial DNA in the crucian carp-like fish lineage with hybrid origin. Sci. China-Life Sci. 2019, 63, 102–115. (In Chinese) [Google Scholar] [CrossRef] [Scilit]
- Piganeau, G.; Gardner, M.; Eyre-Walker, A. A broad survey of recombination in animal mitochondria. Mol. Biol. Evol. 2004, 21, 2319–2325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peris, D.; Sylvester, K.; Libkind, D.; Goncalves, P.; Sampaio, J.P.; Alexander, W.G.; Hittinger, C.T. Population structure and reticulate evolution of Saccharomyces eubayanus and its lager-brewing hybrids. Mol. Ecol. 2014, 23, 2031–2045. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peris, D.; Arias, A.; Orlic, S.; Belloch, C.; Perez-Traves, L.; Querol, A.; Barrio, E. Mitochondrial introgression suggests extensive ancestral hybridization events among Saccharomyces species. Mol. Phylogenet. Evol. 2017, 108, 49–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wolters, J.F.; Chiu, K.; Fiumera, H.L. Population structure of mitochondrial genomes in Saccharomyces cerevisiae. BMC Genom. 2015, 16, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wolters, J.F.; Charron, G.; Gaspary, A.; Landry, C.R.; Fiumera, A.C.; Fiumera, H.L. Mitochondrial recombination reveals mito-mito epistasis in yeast. Genetics 2018, 209, 307–319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Sun, W.; Gu, Q.; Yao, J.; Tan, H.; Huang, X.; Qin, Q.; Tao, M.; Zhang, C.; Liu, S. Variations in the mitochondrial genome of a goldfish-like hybrid [Koi carp (♀) × Blunt snout Bream (♂)] indicate paternal leakage. Front. Genet. 2021, 11, 613520. [Google Scholar] [CrossRef] [Scilit]
- Ujvari, B.; Dowton, M.; Thomas, M. Mitochondrial DNA recombination in a free-ranging Australian lizard. Biol. Lett. 2007, 3, 189–192. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.-Z.; Arrieta-Montiel, M.P.; Virdi, K.S.; de Paula, W.B.; Widhalm, J.R.; Basset, G.J.; Davila, J.I.; Elthon, T.E.; Elowsky, C.G.; Sato, S.J.; et al. MutS HOMOLOG1 is a nucleoid protein that alters mitochondrial and plastid properties and plant response to high light. Plant Cell 2011, 23, 3428–3441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mackenzie, S.A.; Chase, C.D. Fertility restoration is associated with loss of a portion of the mitochondrial genome in cytoplasmic male-sterile common bean. Plant Cell 1990, 2, 905–912. [Google Scholar] [CrossRef] [Scilit]
- Small, I.; Suvolk, R.; Leaver, C.J. Evolution of plant mitochondrial genomes via substoichiometric intermediates. Cell 1989, 58, 69–76. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Guo, W.; Wang, B.; Li, X.; Chen, H.; Wei, L.; Wang, Y.; Wu, J.; Long, H. Instability of chromosome number and DNA methylation variation induced by hybridization and amphidiploid formation between Raphanus sativus L. and Brassica alboglabra Bailey. BMC Plant Biol. 2010, 10, 207. [Google Scholar] [CrossRef] [Scilit]
- Fox, T.D. Mitochondrial protein synthesis, import, and assembly. Genet. 2012, 192, 1203–1234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koch, R.E.; Buchanan, K.L.; Casagrande, S.; Crino, O.; Dowling, D.K.; Hill, G.E.; Hood, W.R.; McKenzie, M.; Mariette, M.M.; Noble, D.W.; et al. Integrating mitochondrial aerobic metabolism into ecology and evolution. Trends Ecol. Evol. 2021, 36, 321–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Youle, R.J. Mitochondria—Striking a balance between host and endosymbiont. Science 2019, 365, 6454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, J.; Herrmann, J.M.; Becker, T. Quality control of the mitochondrial proteome. Nat. Rev. Mol. Cell Biol. 2021, 22, 54–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pershina, L.A.; Trubacheeva, N.V. Interspecific incompatibility in the wide hybridization of plants and ways to overcome it. Russ. J. Genet. Appl. Res. 2017, 7, 358–368. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.P.; Kim, S.; Lim, H.; Ahn, Y.S.; Sung, S.K. Identification of mitochondrial genome rearrangements unique to novel cytoplasmic male sterility in radish (Raphanus sativus L.). Theor. Appl. Genet. 2009, 118, 719–728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.; Wang, L.; Huang, J.; Zhang, X.; Yuan, Y.; Chen, J.Q.; Hurst, L.D.; Tian, D. Parent–progeny sequencing indicates higher mutation rates in heterozygotes. Nature 2015, 523, 463–467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hao, W.L.; Palmer, J.D. Fine-scale mergers of chloroplast and mitochondrial genes create functional, transcompartmentally chimeric mitochondrial genes. Proc. Natl. Acad. Sci. USA 2009, 106, 16728–16733. [Google Scholar] [CrossRef] [Scilit]
- Hao, W.L.; Richardson, A.O.; Zheng, Y.H.; Palmer, J.D. Gorgeous mosaic of mitochondrial genes created by horizontal transfer and gene conversion. Proc. Natl. Acad. Sci. USA 2010, 107, 21576–21581. [Google Scholar] [CrossRef] [Scilit]
- Albert, B.; Godelle, B.; Gouyon, P.H. Evolution of the plant mitochondrial genome, dynamics of duplication and deletion of sequences. J. Mol. Evol. 1998, 46, 155–158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.H.; Kim, B.D. The organization of mitochondrial atp6 gene region in male fertile and CMS lines of pepper (Capsicum annuum L.). Curr. Genet. 2006, 49, 59–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Long, Y.M.; Zhao, L.F.; Niu, B.X. Hybrid male sterility in rice controlled by interaction between divergent alleles of two adjacent genes. Proc. Natl. Acad. Sci. USA 2008, 105, 18871–18876. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marchler-Bauer, A.; Bo, Y.; Han, L.; He, J.; Lanczycki, C.J.; Lu, S.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; et al. CDD/SPARCLE: Functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 2017, 45, D200–D203. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Material | Type | Chimeric Gene | Gene Involved | Origin Style | CDD | References |
|---|---|---|---|---|---|---|
| Oryza sativa L. subsp. indica | WA | WA352 | orf284, orf288, orf224 | Spontaneous | ATGACGAGAG | Luo et al., 2013 [4] |
| Oryza sativa L. subsp. indica | WA | orfB | atp6 | Spontaneous | GGATAATCCG | Das et al., 2010 [36] |
| Oryza sativa L. subsp. indica | WA | AY295770 | rps-rp116-nad3-rps12 | Spontaneous | ACGGCCCTCA | Yashitola et al., 2004 [37] |
| Oryza rufipogon Griff | CW | orf307, NC_013816 | coxⅡ, orf288, orf224 | Distant hybridization | TGTTTATCAT | Fujii et al., 2010 [32] |
| Oryza sativa L. subsp. indica | Chinsurah Boro II | orf79, D14339 | atp6 | Distant hybridization | ATGGCAAATC | Akagi et al., 1994 [38]; Wang et al., 2006 [39] |
| Oryza sativa L. subsp. indica | HL | orf 79 | atp6 | Distant hybridization | ATGACAAATC | Hu et al., 2012 [40] |
| Oryza sativa L. subsp. japonica | Lead | L-orf79 | atp6 | Distant hybridization | ATGACAAATC | Kazama et al., 2016 [41] |
| Oryza sativa L. subsp. indica | FA | FA182 | - | Distant hybridization | No CDD | Jiang et al., 2022 [8] |
| Oryza sativa L. subsp. indica | D1-CMS | orf182 | - | Distant hybridization | No CDD | Xie et al., 2018 [42] |
| Zea mays L. | T | urf13 | 26S-ribosomal | Distant hybridization | CGTCAATGAT | Dewey et al., 1986 [2] |
| Zea mays L. | S | orf355/orf77 | atp9, orf221 | Distant hybridization | ATGGAAGATA ATGTTTGCAT | Zabala et al., 1997 [43] |
| Sorghum bicolor (L.) Moench | IS1112C(A3) | atp6 x57100 | atp6 | Distant hybridization | GTTCGTGTTC | Kempken et al., 1991 [44] |
| Sorghum bicolor (L.) Moench | IS1112C(A3) | orfF107 | orf209, atp9 | Distant hybridization | ATGTCGCGAC | Pring et al., 1999 [45] |
| Sorghum bicolor (L.) Moench | IS1112C(A3) | orf265/orf130 | T-urf13, atp6-2; orf25 | Distant hybridization | ATGAACGGTC | Tang et al., 1996 [46] |
| Triticum timopheevi Zhuk | T. timopheevi | orf256 | cox1 | Distant hybridization | - | Hedgcoth et al., 2002 [47] |
| Brassica napus L. | Pol | orf224 | atp6 | Spontaneous | GGATGCTACT | Singh et al., 1991 [48] |
| Brassica napus L. | Nap | orf222 | nad5, orf139 | Protoplast fusion | ATTAATCTAA | L’Homme et al., 1997 [49] |
| Brassica napus L. | Ogura | orf158, orf138, z12626 | tRNA-fMet | Cybrid induce | TGCCTCAACT ATGATTACCT | Bonhomme et al., 1992 [50] |
| Brassica napus L. | Tour | orf193, | atp9, cob, nad2 | Cybrid induce | - | Dieterich et al., 2003 [51] |
| Brassica juncea L. | Tour (juncea) | orf263, x83692 | atp6-nad5 | Distant hybridization | ATGAAAAATA | Landgren et al., 1996 [52] |
| Brassica juncea L. | 220-type | orf220, AAO59387 | atpA | Distant hybridization | - | Yang et al., 2009 [53] |
| Brassica juncea L. | Mori | orf108, EF483940 | atpA | Cybrid induce | ATGAATACTA | Ashutosh et al., 2008 [54] |
| Brassica oleracea L. | Mur | orf72. AB243571 | atp9-2, rps7 | - | ATGGAAATTC | Shinada et al., 2006 [55] |
| Raphanus sativus L. | Ogura | atp6. M24672 | orf105, fMet-tRNA | Cybrid induce CrGC15 | AGTGATACAT | Makaroff et al., 1989 [56] |
| Raphanus satiuus L. cv. Kosena | Kos | orf125 | orfB | Spontaneous | ATGATTACCT | Iwabuchi et al., 1999 [57] |
| Raphanus sativus L. | Ogura | orf138 | orfB | Spontaneous | ATGATTACCT | Krishnasamy et al., 1993 [58] |
| Helianthus annuus L. | Pet | orfH522-atpA, x55963 | cob, atp9 | Distant hybridization | ATGCCTCAAC | Köhler et al. 1991 [59] |
| Helianthus annuus L. ssp. tetanus | Ant1 | atp6 X82386 | atp6, atp9, atpA, nadl + 5 and coxIII | Distant hybridization | ATGTGACTGA | Spassova et al. 1994 [60] |
| Phaseolus vulgaris Linn | G08063 | pvs-orf239, M87062 | cob3, psb | Spontaneous | ATGGATCATTTGTTCCTCCC | Janska et al., 1998 [61]; Abad et al., 1995 [62] |
| Beta vulgaris subsp. vulgaris | Owen | atpa, X68691, atp6, X54722 | atpA, atp6 | Spontaneous | ATGGAATTCTATGGGTACTC | Xue et al., 1994 [63] |
| Capsicum annuum Linn | PI164835 from India | ψatp6-2, DQ126680 | atp6 | Spontaneous | ATGATGCGAC | Kim et al., 2006 [64] |
| Petunia parodii | Pcf | orf402 | atp9, cox2, urfs | Cybrid induce | TCGTGATGGA | Young et al., 1987 [65] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Ding, Z.; Lou, H.; Han, R.; Ma, C.; Yang, S. A Systematic Review and Developmental Perspective on Origin of CMS Genes in Crops. Int. J. Mol. Sci. 2024, 25, 8372. https://doi.org/10.3390/ijms25158372
Zhang X, Ding Z, Lou H, Han R, Ma C, Yang S. A Systematic Review and Developmental Perspective on Origin of CMS Genes in Crops. International Journal of Molecular Sciences. 2024; 25(15):8372. https://doi.org/10.3390/ijms25158372
Chicago/Turabian StyleZhang, Xuemei, Zhengpin Ding, Hongbo Lou, Rui Han, Cunqiang Ma, and Shengchao Yang. 2024. "A Systematic Review and Developmental Perspective on Origin of CMS Genes in Crops" International Journal of Molecular Sciences 25, no. 15: 8372. https://doi.org/10.3390/ijms25158372
APA StyleZhang, X., Ding, Z., Lou, H., Han, R., Ma, C., & Yang, S. (2024). A Systematic Review and Developmental Perspective on Origin of CMS Genes in Crops. International Journal of Molecular Sciences, 25(15), 8372. https://doi.org/10.3390/ijms25158372

