Studies on the Relationships between Growth and Gonad Development during First Sexual Maturation of Macrobrachium nipponense and Associated SNPs Screening
Abstract
1. Introduction
2. Results
2.1. Growth and Gonad Development Trait Analyses
2.2. Association between Growth and Gonad Development Traits
2.3. SNP Identification and Polymorphism of Mn-CTS L1
2.4. Association between Growth and Gonad Development Traits
2.5. Association of Mn-CTS L1 SNPs with Gonad Development Traits
3. Discussion
4. Materials and Methods
4.1. Ethics Statement and Consent to Participate
4.2. Sample Prawns
4.3. Traits Measurement and DNA Extraction
4.4. Primer Design and Synthesis of Cathepsin L Gene and PCR Amplification
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fu, H.T.; Jiang, S.F.; Xiong, Y.W. Current status and prospects of farming the giant river prawn (Macrobrachium rosenbergii) and the oriental river prawn (Macrobrachium nipponense) in China. Aquac. Res. 2012, 43, 993–998. [Google Scholar]
- Ministry of Agriculture Fisheries Bureau. China Fishery Statistical Yearbook; Chinese Agricultural Press: Beijing, China, 2022. [Google Scholar]
- Kong, Y.Q.; Ding, Z.L.; Zhang, Y.X.; Zhou, P.X.; Wu, C.B.; Zhu, M.H.; Ye, J.Y. Types of carbohydrate in feed affect the growth performance, antioxidant capacity, immunity, and activity of digestive and carbohydrate metabolism enzymes in juvenile Macrobrachium nipponense. Aquaculture 2019, 512, 734282. [Google Scholar] [CrossRef]
- Jiang, S.F.; Xiong, Y.W.; Zhang, W.Y.; Zhu, J.P.; Cheng, D.; Gong, Y.S.; Wu, Y.; Qiao, H.; Fu, H.T. Molecular Characterization of a Novel Cathepsin L in Macrobrachium nipponense and Its Function in Ovary Maturation. Front. Endocrinol. 2021, 12, 816813. [Google Scholar] [CrossRef] [PubMed]
- López-Martínez, J.; Rábago-Quiroz, C.; Nevárez-Martínez, M.O.; García-Juárez, A.R.; Rivera-Parra, G.; Chávez-Villalba, J. Growth, reproduction, and size at first maturity of blue shrimp, Litopenaeus stylirostris (Stimpson, 1874) along the east coast of the Gulf of California. Mex. Fish. Res. 2005, 71, 93–102. [Google Scholar] [CrossRef]
- Qiu, C.L.; Dong, L.S.; Xiao, S.J.; Xu, S.B.; Fang, M.; Wang, Z.Y. Genetic parameter estimation of nine quantitative traits by a marker-based method in Large Yellow Croaker, Larimichthys crocea (Richardson). Aquac. Res. 2017, 48, 5892–5900. [Google Scholar] [CrossRef]
- Gao, Y.X.; Dong, L.S.; Xu, S.B.; Xiao, S.J.; Fang, M.; Wang, Z.Y. Genome-wide association study using single marker analysis and Bayesian methods for the gonadosomatic index in the large yellow croaker. Aquaculture 2018, 486, 26–30. [Google Scholar] [CrossRef]
- Peixoto, S.; Calazans, N.; Silva, E.F.; Nole, L.; Soares, R.; Frédou, F.L. Reproductive cycle and size at first sexual maturity of the white shrimp Penaeus schmitti (Burkenroad, 1936) in northeastern Brazil. Lat. Am. J. Aquat. Res. 2018, 46, 1–9. [Google Scholar] [CrossRef]
- Kodama, K.; Shimizu, T.; Yamakawa, T.; Aoki, I. Reproductive biology of the female Japanese mantis shrimp Oratosquilla oratoria (Stomatopoda) in relation to changes in the seasonal pattern of larval occurrence in Tokyo Bay, Japan. Fish. Sci. 2004, 70, 734–745. [Google Scholar] [CrossRef]
- Yamada, R.; Kodama, K.; Yamakawa, T.; Horiguchi, T.; Aoki, I. Growth and reproductive biology of the small penaeid shrimp Trachysalambria curvirostris in Tokyo Bay. Mar. Biol. 2007, 151, 961–971. [Google Scholar] [CrossRef]
- Jiang, S.F.; Xiong, Y.W.; Xia, Z.X.; Wang, J.S.; Zhang, W.Y.; Cheng, D.; Fu, H.T. Identification SNPs in vitellogenin gene and their association with ovarian development and growth of Macrobrachium nipponense. Aquac. Res. 2022, 53, 6478–6486. [Google Scholar]
- Felterman, M.; Zou, E. The exogenous methyl farnesoate does not impact ecdysteroid signaling in the crustacean epidermis in vivo. Aquaculture 2011, 317, 251–254. [Google Scholar] [CrossRef]
- Wang, W.N.; Wang, A.L.; Liu, Y.; Xiu, J.; Liu, Z.B.; Sun, R.Y. Effects of temperature on growth, adenosine phosphates, ATPase and cellular defense response of juvenile shrimp Macrobrachium nipponense. Aquaculture 2006, 256, 624–630. [Google Scholar] [CrossRef]
- Ding, Z.L.; Kong, Y.Q.; Li, J.F.; Cao, F.; Zhang, Y.X.; Du, Z.Y.; Ye, J.Y. Growth and metabolic responses of juvenile Macrobrachium nipponense to different dietary carbohydrate levels. Aquacult. Nutr. 2017, 23, 1136–1144. [Google Scholar] [CrossRef]
- Huang, Y.H.; Zhang, M.; Li, Y.M.; Wu, D.L.; Liu, Z.Q.; Jiang, Q.C.; Zhao, Y.L. Effects of salinity acclimation on the growth performance, osmoregulation and energy metabolism of the oriental river prawn, Macrobrachium nipponense (De Haan). Aquac. Res. 2019, 50, 685–693. [Google Scholar] [CrossRef]
- Li, F.J.; Zhang, S.Y.; Fu, C.P.; Li, T.T.; Cui, X.Y. Molecular and functional analysis of the insulin-like peptides gene in the oriental river prawn Macrobrachium nipponense. Gen. Comp. Endocr. 2019, 280, 209–214. [Google Scholar] [CrossRef]
- Li, L.Q.; Wang, W.L.; Yusuf, A.; Zhu, Y.M.; Zhou, Y.; Ji, P.; Huang, X.X. Effects of dietary lipid levels on the growth, fatty acid profile and fecundity in the oriental river prawn, Macrobrachium nipponense. Aquac. Res. 2020, 51, 1893–1902. [Google Scholar] [CrossRef]
- Zhu, J.P.; Fu, H.T.; Qiao, H.; Jin, S.B.; Zhang, W.Y.; Jiang, S.F.; Gong, Y.S.; Xiong, Y.W. Expression and functional analysis of cathepsin L1 in ovarian development of the oriental river prawn, Macrobrachium nipponense. Aquac. Rep. 2021, 20, 100724. [Google Scholar] [CrossRef]
- Jiang, S.F.; Xiong, Y.W.; Zhang, W.Y.; Zhu, J.P.; Cheng, D.; Gong, Y.S.; Fu, H.T. A novel legumain-like proteases in Macrobrachium nipponense: Identification, characterization and function analysis in ovary maturation. Front. Endocrinol. 2022, 13, 858726. [Google Scholar] [CrossRef]
- Waiho, K.; Fazhan, H.; Baylon, J.C.; Madihah, H.; Noorbaiduri, S.; Ma, H.; Ikhwanuddin, M. On types of sexual maturity in brachyurans, with special reference to size at the onset of sexual maturity. J. Shellfish Res. 2017, 36, 807–839. [Google Scholar] [CrossRef]
- Fontoura, N.F.; Braun, A.S.; Milani, P.C.C. Estimating size at first maturity (L50) from Gonadossomatic Index (GSI) data. Neotrop. Ichthyol. 2009, 7, 217–222. [Google Scholar] [CrossRef]
- Binohlan, C.; Froese, R. Empirical equations for estimating maximum length from length at first maturity. J. Appl. Ichthyol. 2009, 25, 611–613. [Google Scholar] [CrossRef]
- Stark, J.W. Contrasting maturation and growth of northern rock sole in the eastern Bering Sea and Gulf of Alaska for the purpose of stock management. N. Am. J. Fish. Manag. 2012, 32, 93–99. [Google Scholar] [CrossRef]
- Lorenzen, K. Toward a new paradigm for growth modeling in fisheries stock assessments: Embracing plasticity and its consequences. Fish. Res. 2016, 180, 4–22. [Google Scholar] [CrossRef]
- Agumassie, T. Overview of length-weight relationship, condition factor and size at first maturity of Nile tilapia Oreochromis niloticus (L.) in different water bodies of Ethiopia: A review. J. Nat. Sci. Res. 2018, 8, 35–41. [Google Scholar]
- Fontoura, N.F.; Jesus, A.S.; Larre, G.G.; Porto, J.R. Can weight/length relationship predict size at first maturity? A case study with two species of Characidae. Neotrop. Ichthyol. 2017, 8, 835–840. [Google Scholar]
- Mesquita, C.; Dobby, H.; Sweeting, S.; Jones, C.S.; Pierce, G.J. Size-at-maturity of Brown Crab (Cancer pagurus) in Scottish waters based on gonadal and morphometric traits. Fish. Res. 2020, 229, 105610. [Google Scholar] [CrossRef]
- Hashiguti, D.T.; Soares, B.E.; Wilson, K.L.; Oliveira-Raiol, R.D.; Montag, L.F.D.A. Comparing three methods to estimate the average size at first maturity: A case study on a Curimatid exhibiting polyphasic growth. Ecol. Freshw. Fish 2019, 28, 266–273. [Google Scholar] [CrossRef]
- Tian, C.X.; Yang, M.; Lv, L.Y.; Yuan, Y.C.; Liang, X.F.; Guo, W.J.; Song, Y.; Zhao, C. Single nucleotide polymorphisms in growth hormone gene and their association with growth traits in Siniperca chuatsi (Basilewsky). Int. J. Mol. Sci. 2014, 15, 7029–7036. [Google Scholar] [CrossRef]
- Pang, M.X.; Tong, J.G.; Yu, X.M.; Fu, B.D.; Zhou, Y. Molecular cloning, expression pattern of follistatin gene and association analysis with growth traits in bighead carp (Hypophthalmichthys nobilis). Comp. Biochem. Physiol. B-Biochem. Mol. Biol. 2018, 218, 44–53. [Google Scholar] [CrossRef]
- De-Santis, C.; Jerry, D.R. Candidate growth genes in finfish—where should we be looking? Aquaculture 2007, 272, 22–38. [Google Scholar] [CrossRef]
- Feng, X.; Yu, X.M.; Tong, J.G. Novel single nucleotide polymorphisms of the insulinlike growth factor-I gene and their associations with growth traits in common carp (Cyprinus carpio L.). Int. J. Mol. Sci. 2014, 15, 22471–22482. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.Y.; Fu, B.D.; Pang, M.X.; Feng, X.; Wang, X.H.; Yu, X.M.; Tong, J.G. QTL fine mapping and identification of candidate genes for growth-related traits in bighead carp (Hypophthalmichehys nobilis). Aquaculture 2016, 465, 134–143. [Google Scholar] [CrossRef]
- Janpoom, S.; Sawatpanich, P.; Klinbunga, S.; Menasveta, P.; Khamnamtong, B. Development of methods for detection of SNPs in Activin type IIB receptor and a preliminary study on association between its polymorphism and growth parameters of the Asian seabass Lates calcarifer. Fish. Sci. 2017, 83, 515–522. [Google Scholar] [CrossRef]
- Du, X.D.; Yan, X.; Zhang, W.W.; Zhu, Z.; Qin, W.H.; Dong, X.J.; Zhang, X.J. A SNP in Cathepsin L is associated with carapace length trait in giant freshwater prawn Macrobrachium rosenbergii. Biologia 2021, 76, 3587–3593. [Google Scholar] [CrossRef]
- Si, M.R.; Li, Y.D.; Jiang, S.G.; Yang, Q.B.; Jiang, S.; Yang, L.S.; Zhou, F.L. Identification of multifunctionality of the PmE74 gene and development of SNPs associated with low salt tolerance in Penaeus monodon. Fish Shellfish Immunol. 2022, 128, 7–18. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.Y.; Zhang, W.P.; Wang, M.H.; Xu, S.Q.; Zhong, L.Q.; Bian, W.J.; Zhang, S.Y.; Chen, X.H. Characterization of rrp44 gene in channel catfish (Ictalurus punctatus): Molecular cloning, tissue distribution, and single nucleotide polymorphisms (SNPs) association analysis with growth traits. Aquac. Rep. 2023, 30, 101613. [Google Scholar] [CrossRef]
- Han, M.L.; Zhao, Y.F.; Tan, C.H.; Xiong, Y.J.; Wang, W.J.; Wu, F.; Fei, Y. Cathepsin L upregulation-induced EMT phenotype is associated with the acquisition of cisplatin or paclitaxel resistance in A549 cells. Acta Pharmacol. Sin. 2016, 37, 1606–1622. [Google Scholar] [CrossRef] [PubMed]
- Terra, W.R.; Dias, R.O.; Ferreira, C. Recruited lysosomal enzymes as major digestive enzymes in insects. Biochem. Soc. Trans. 2019, 47, 615–623. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.D.; McCarron, R.C.; Nordin, J.H. A cysteine protease that processes insect vitellin—Purification and partial characterization of the enzyme and the proenzyme. J. Biol. Chem. 1996, 271, 33344–33351. [Google Scholar] [CrossRef][Green Version]
- Yamahama, Y.; Uto, N.; Tamotsu, S.; Miyata, T.; Yamamoto, Y.; Watabe, S.; Takahashi, S.Y. In vivo activation of pro-form Bombyx cysteine protease (BCP) in silkmoth eggs: Localization of yolk proteins and BCP, and acidification of yolk granules. J. Insect Physiol. 2003, 49, 131–140. [Google Scholar] [CrossRef]
- Tingaud-Sequeira, A.; Cerda, J. Phylogenetic relationships and gene expression pattern of three different cathepsin L (Ctsl) isoforms inzebrafish: Ctsla is the putative yolk processing enzyme. Gene 2007, 386, 98–106. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.U.; Zafar, A.; Tanveer, J.; Khan, M.A.; Kim, S.H.; Alsulami, M.M.; Lee, S.W. Deep learning network selection and optimized information fusion for enhanced COVID-19 detection. Int. J. Imag. Syst. Technol. 2023, 34, e23001. [Google Scholar] [CrossRef]
- Iqbal, M.S.; Naqvi, R.A.; Alizadehsani, R.; Hussain, S.; Moqurrab, S.A.; Lee, S.W. An adaptive ensemble deep learning framework for reliable detection of pandemic patients. Comput. Biol. Med. 2024, 168, 107836. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.S.; Jiang, S.F.; Zhang, W.Y.; Xiong, Y.W.; Jin, S.B.; Cheng, D.; Fu, H.T. Function Analysis of Cholesterol 7-Desaturase in Ovarian Maturation and Molting in Macrobrachium nipponense: Providing Evidence for Reproductive Molting Progress. Int. J. Mol. Sci. 2023, 24, 6940. [Google Scholar] [CrossRef] [PubMed]
- Yeh, F.C.; Boyle, T.J.B. Population genetic analysis of co-dominant and dominant marker and quantitative traits. Belg. J. Bot. 1997, 130, 129–157. [Google Scholar]
- Anderson, P.A.; Lawrence, G.J.; Morrish, B.C.; Ayliffe, M.A.; Finnegan, E.J.; Ellis, J.G. Inactivation of the flax rust resistance gene M associated with loss of a repeated unit within the leucine-rich repeat coding region. Plant Cell 1997, 9, 641–651. [Google Scholar]
Total Length (TL, mm) | Body Length (BL, mm) | Body Weight (BW, mm) | Second Pereiopod Length (SPL, mm) | Abdomen Length (AL, mm) | Abdomen Width (AW, mm) | Carapace Length (CL, mm) | Carapace Width (CW, mm) | GSI% | HSI% | |
---|---|---|---|---|---|---|---|---|---|---|
F | 40.43 ± 5.23 | 27.58 ± 3.54 | 0.72 ± 0.33 | 22.24 ± 4.20 | 18.34 ± 2.47 | 4.87 ± 0.79 | 10.54 ± 1.69 | 5.58 ± 0.93 | 1.21% ± 0.75% | 1.51% ± 0.11% |
M | 46.51 ± 9.29 | 31.79 ± 6.30 | 1.22 ± 0.82 | 28.72 ± 9.56 | 21.08 ± 4.34 | 5.49 ± 1.13 | 12.51 ± 2.89 | 6.52 ± 1.70 | 1.01% ± 0.83% | 1.30% ± 0.09% |
p | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.05 | >0.05 |
Correlation | Total Length (TL, mm) | Body Length (BL, mm) | Body Weight (BW, mm) | Second Pereiopod Length (SPL, mm) | Abdomen Length (AL, mm) | Abdomen Width (AW, mm) | Carapace Length (CL, mm) | Carapace Width (CW, mm) | |
---|---|---|---|---|---|---|---|---|---|
MGSI | PC | −0.336 ** | −0.426 ** | −0.309 ** | −0.402 ** | −0.304 ** | −0.322 ** | −0.391 ** | −0.340 ** |
p | 0.001 | 0.001 | 0.003 | 0.005 | 0.004 | 0.002 | 0.007 | 0.001 | |
MHSI | PC | 0.091 | 0.121 | 0.083 | 0.076 | 0.108 | 0.135 | 0.142 | 0.112 |
p | 0.207 | 0.091 | 0.251 | 0.291 | 0.134 | 0.061 | 0.058 | 0.118 | |
n | 195 | 195 | 195 | 195 | 195 | 195 | 195 | 195 | |
FGSI | PC | −0.111 | −0.112 | −0.119 | −0.024 | −0.046 | −0.094 | 0.003 | −0.105 |
p | 0.122 | 0.166 | 0.096 | 0.733 | 0.519 | 0.188 | 0.965 | 0.143 | |
FHSI | PC | 0.041 | 0.054 | −0.006 | 0.022 | 0.093 | 0.079 | 0.120 | 0.026 |
p | 0.569 | 0.453 | 0.929 | 0.758 | 0.193 | 0.269 | 0.094 | 0.718 | |
n | 197 | 197 | 197 | 197 | 197 | 197 | 197 | 197 |
Location | Length/bp | GC% | SNPs |
---|---|---|---|
Exon 1 | 68 | 49 | |
Intron 1 | 371 | 29 | A+118T, C+155G, 206G, T+216G, A+333G |
Exon 2 | 154 | 50 | T+521A |
Intron 2 | 177 | 35 | C+640T, C+642T, T+698C, A+709T |
Exon 3 | 180 | 54 | A+782G |
Intron 3 | 147 | 42 | |
Exon 4 | 187 | 51 | |
Intron 4 | 144 | 32 | A+1379C |
Exon 5 | 166 | 55 | |
Intron 5 | 214 | 35 | C+1698G, C+1717T |
Exon 6 | 205 | 54 | A+1884C, A+1885G |
SNP | Genotype | Total Length (TL, mm) | Body Length (BL, mm) | Body Weight (BW, mm) | Second Pereiopod Length (SPL, mm) | Abdomen Length (AL, mm) | Abdomen Width (AW, mm) | Carapace Length (CL, mm) | Carapace Width (CW, mm) |
---|---|---|---|---|---|---|---|---|---|
Female | |||||||||
A+118T | TT | 39.77 ± 4.83 b | 27.17 ± 3.27 b | 0.67 ± 0.28 c | 21.79 ± 3.88 b | 18.01 ± 2.18 b | 4.80 ± 0.74 b | 10.41 ± 1.66 b | 5.46 ± 0.84 c |
AA | 42.17 ± 5.83 b | 28.67 ± 4.23 b | 0.82 ± 0.41 b | 23.06 ± 5.01 b | 19.12 ± 3.18 b | 5.06 ± 0.84 b | 10.82 ± 1.82 b | 5.90 ± 1.11 b | |
AT | 45.01 ± 5.37 a | 30.42 ± 3.54 a | 1.06 ± 0.42 a | 25.47 ± 4.72 a | 20.39 ± 2.66 a | 5.40 ± 0.94 a | 11.60 ± 1.39 a | 6.31 ± 1.09 a | |
C+155G | GG | 40.55 ± 5.41 a | 27.68 ± 3.69 a | 0.72 ± 0.34 | 22.28 ± 4.32 a | 18.38 ± 2.54 | 4.89 ± 0.78 | 10.60 ± 1.72 a | 5.58 ± 0.95 |
CC | 37.35 ± 3.63 b | 25.40 ± 2.52 b | 0.54 ± 0.14 b | 19.20 ± 2.11 b | 17.10 ± 1.63 | 4.49 ± 0.75 | 9.58 ± 1.76 b | 5.10 ± 0.81 b | |
GC | 41.77 ± 3.82 a | 28.36 ± 2.43 a | 0.78 ± 0.27 a | 23.59 ± 3.60 a | 18.78 ± 2.16 | 5.02 ± 0.80 | 10.78 ± 1.24 a | 5.85 ± 0.72 a | |
T+216G | GG | 40.84 ± 5.62 | 27.97 ± 3.81 a | 0.74 ± 0.35 | 22.53 ± 4.49 a | 18.56 ± 2.62 | 4.91 ± 0.81 | 10.68 ± 1.77 a | 5.62 ± 0.99 |
TT | 39.27 ± 4.16 | 26.35 ± 2.82 b | 0.63 ± 0.19 | 20.44 ± 3.19 b | 17.69 ± 1.89 | 4.82 ± 0.79 | 9.92 ± 1.59 b | 5.45 ± 0.89 | |
GT | 40.01 ± 4.09 | 27.13 ± 2.67 a | 0.70 ± 0.30 | 22.33 ± 3.54 a | 17.98 ± 2.11 | 4.80 ± 0.74 | 10.53 ± 1.37 a | 5.53 ± 0.73 | |
A+1379C | AA | 38.10 ± 3.96 b | 25.91 ± 2.59 b | 0.56 ± 0.16 b | 20.73 ± 3.00 b | 17.33 ± 1.88 b | 4.55 ± 0.61 b | 9.87 ± 1.48 b | 5.14 ± 0.68 b |
CC | 41.62 ± 5.50 a | 28.38 ± 3.75 a | 0.80 ± 0.37 a | 22.89 ± 4.56 a | 18.84 ± 2.64 a | 5.06 ± 0.82 a | 10.87 ± 1.68 a | 5.80 ± 0.99 a | |
AC | 40.16 ± 4.16 a | 27.79 ± 2.72 a | 0.68 ± 0.18 a | 21.09 ± 4.34 a | 18.15 ± 1.73 a | 4.59 ± 0.59 b | 10.61 ± 2.08 a | 5.49 ± 0.64 a | |
Male | |||||||||
A+118T | TT | 45.91 ± 9.06 b | 31.39 ± 6.12 b | 1.17 ± 0.82 b | 28.50 ± 9.57 b | 20.80 ± 4.21 b | 5.39 ± 1.09 b | 12.36 ± 2.77 b | 6.40 ± 1.63 b |
AA | 49.35 ± 10.84 b | 34.06 ± 7.07 a | 1.50 ± 0.91 b | 30.71 ± 10.81 a | 22.44 ± 4.61 a | 5.92 ± 1.17 a | 13.05 ± 3.41 a | 7.19 ± 2.03 a | |
AT | 54.44 ± 8.82 a | 35.02 ± 6.08 a | 1.91 ± 1.04 a | 35.49 ± 11.20 a | 24.08 ± 4.87 a | 6.34 ± 1.15 a | 15.23 ± 3.30 a | 7.83 ± 2.04 a | |
A+1379C | AA | 43.73 ± 8.84 b | 29.89 ± 5.77 b | 0.99 ± 0.67 b | 26.47 8.10 b | 19.92 ± 4.06 b | 5.23 ± 1.09 b | 11.82 ± 2.82 b | 6.02 ± 1.53 b |
CC | 49.05 ± 9.75 a | 33.61 ± 6.68 a | 1.46 ± 0.94 a | 31.16 ± 10.91 a | 22.16 ± 4.54 a | 5.73 ± 1.16 a | 13.20 ± 3.11 a | 6.98 ± 1.83 a | |
AC | 44.12 ± 6.02 b | 29.77 ± 4.15 b | 0.92 ± 0.48 b | 26.21 ± 4.78 b | 19.48 ± 2.47 b | 5.15 ± 0.96 b | 11.90 ± 1.45 b | 6.01 ± 1.36 b |
SNP | Genotype | FGSI% | SNP | Genotype | MGSI% | SNP | Genotype | FHSI% |
---|---|---|---|---|---|---|---|---|
A+782G | AA | 1.09 ± 0.64 b | A+1379C | AA | 1.23 ± 1.19 a | A+206G | GG | 5.80 ± 1.27 b |
AG | 1.32 ± 0.79 a | CC | 0.95 ± 0.61 b | AA | 5.51 ± 1.30 b | |||
A+1379C | AA | 1.30 ± 0.70 a | AC | 1.03 ± 1.15 b | AG | 6.68 ± 3.25 a | ||
CC | 1.05 ± 0.40 b | A+782G | AA | 5.99 ± 1.96 a | ||||
AC | 1.07 ± 0.43 b | AG | 5.38 ± 1.30 b | |||||
A+1379C | AA | 5.99 ± 1.90 a | ||||||
CC | 5.84 ± 1.33 a | |||||||
AC | 5.03 ± 1.14 b |
Primer Name | Forward | Reverse | Amplification Location (bp) |
---|---|---|---|
CTS L1-1 | TCTCCCGTTCAATAAACAT | TAAGTACCCTACCTGAACCACCT | 1–336 |
CTS L1-2 | TAAGTACCCTACCTGAACCACCT | TCAACATCGGCAGCTCTGG | 285–994 |
CTS L1-3 | TCCCTCCCACCATTCGTTT | TTGGCAGACTTCCGGTTTT | 786–1213 |
CTS L1-4 | AAGCAATGCCTCCCTGACA | GGACCTTCGTCGTGGACAG | 1070–1607 |
CTS L1-5 | TCTGCTGTCCACGACGAAG | ACACCGCAGTGGTTGTTCT | 1585–2013 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, S.; Xie, Y.; Gao, Z.; Niu, Y.; Ma, C.; Zhang, W.; Xiong, Y.; Qiao, H.; Fu, H. Studies on the Relationships between Growth and Gonad Development during First Sexual Maturation of Macrobrachium nipponense and Associated SNPs Screening. Int. J. Mol. Sci. 2024, 25, 7071. https://doi.org/10.3390/ijms25137071
Jiang S, Xie Y, Gao Z, Niu Y, Ma C, Zhang W, Xiong Y, Qiao H, Fu H. Studies on the Relationships between Growth and Gonad Development during First Sexual Maturation of Macrobrachium nipponense and Associated SNPs Screening. International Journal of Molecular Sciences. 2024; 25(13):7071. https://doi.org/10.3390/ijms25137071
Chicago/Turabian StyleJiang, Sufei, Yinxiang Xie, Zijian Gao, Yunpeng Niu, Cheng Ma, Wenyi Zhang, Yiwei Xiong, Hui Qiao, and Hongtuo Fu. 2024. "Studies on the Relationships between Growth and Gonad Development during First Sexual Maturation of Macrobrachium nipponense and Associated SNPs Screening" International Journal of Molecular Sciences 25, no. 13: 7071. https://doi.org/10.3390/ijms25137071
APA StyleJiang, S., Xie, Y., Gao, Z., Niu, Y., Ma, C., Zhang, W., Xiong, Y., Qiao, H., & Fu, H. (2024). Studies on the Relationships between Growth and Gonad Development during First Sexual Maturation of Macrobrachium nipponense and Associated SNPs Screening. International Journal of Molecular Sciences, 25(13), 7071. https://doi.org/10.3390/ijms25137071