Disarib, a Specific BCL2 Inhibitor, Induces Apoptosis in Triple-Negative Breast Cancer Cells and Impedes Tumour Progression in Xenografts by Altering Mitochondria-Associated Processes
Abstract
1. Introduction
2. Results
2.1. Disarib Induces Cytotoxicity in TNBC Cell Lines in a Concentration-Dependent Manner without Causing Cell Cycle Arrest
2.2. Disarib Induces Mitochondria-Mediated Apoptotic Cell Death in MDA-MB-231, MDA-MB-468, and MDA-MB-453
2.3. Disarib Significantly Reduces the Colony-Forming Ability of TNBC Cell Lines
2.4. Disarib Induces Reactive Oxygen Species in MDA-MB-231, MDA-MB-468, and MDA-MB-453
2.5. Disarib Inhibits Tumour Growth in Human Triple-Negative Breast Cancer Cell Line-Derived Xenograft Models
2.6. Disarib Significantly Reduced Glycolysis and Caused a Mild Decrease in Oxidative Phosphorylation in TNBC Cell Lines
2.7. Disarib Reduced the Expression of Fission Genes in MDA-MB-231 and MDA-MB-468 Cells and Xenografts
2.8. Disarib Downregulated the Expression of Epithelial-to-Mesenchymal Transition Markers and Inhibited the Migration of MDA-MB-231 and MDA-MB-468 Cells
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Cell Culture
4.2.1. MTT Assay
4.2.2. Lactate Dehydrogenase (LDH) Assay
4.3. Colony-Forming Assay
4.3.1. AnnexinV-FITC and PI Double Staining to Examine Apoptosis
4.3.2. JC1 Assay to Investigate Mitochondrial Membrane Potential
4.3.3. Cell Cycle Analysis
4.4. Reactive Oxygen Species (ROS Analysis)
4.4.1. Spectrophotometric ROS Assay
4.4.2. Flow Cytometric Reactive Oxygen Species Assay
4.5. Western Blotting Analysis
4.6. Scratch Wound Assay
4.7. Immunofluorescence
4.7.1. Oxygen Consumption Rate Assay
4.7.2. Extracellular Acidification Rate Assay
4.7.3. Human Cell Line-Derived Xenograft Models
4.7.4. Library Preparation and Sequencing
4.7.5. Processing, Alignment of Fastq Files, and Differential Analysis
4.8. First-Strand cDNA Synthesis and Real-Time PCR
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Garcia, E.; Luna, I.; Persad, K.L.; Agopsowicz, K.; Jay, D.A.; West, F.G.; Hitt, M.M.; Persad, S. Inhibition of Triple Negative Breast Cancer Metastasis and Invasiveness by Novel Drugs That Target Epithelial to Mesenchymal Transition. Sci. Rep. 2021, 11, 11757. [Google Scholar] [CrossRef] [PubMed]
- Neophytou, C.; Boutsikos, P.; Papageorgis, P. Molecular Mechanisms and Emerging Therapeutic Targets of Triple-Negative Breast Cancer Metastasis. Front. Oncol. 2018, 8, 31. [Google Scholar] [CrossRef] [PubMed]
- Nieto, M.A.; Huang, R.; Jackson, R.A.; Thiery, J.P. Review EMT: 2016. Cell 2016, 166, 45. [Google Scholar] [CrossRef] [PubMed]
- Abdulla, T.; Luna-Zurita, L.; De La Pompa, J.L.; Schleich, J.-M.; Summers, R. Epithelial to Mesenchymal Transition—The Roles of Cell Morphology, Labile Adhesion and Junctional Coupling. Comput. Methods Programs Biomed. 2013, 111, 435–446. [Google Scholar] [CrossRef] [PubMed]
- Polyak, K.; Li, Y.; Zhu, H.; Lengauer, C.; Willson, J.K.; Markowitz, S.D.; Trush, M.A.; Kinzler, K.W.; Vogelstein, B. Somatic Mutations of the Mitochondrial Genome in Human Colorectal Tumours. Nat. Genet. 1998, 20, 291–293. [Google Scholar] [CrossRef] [PubMed]
- Jang, M.H.; Kim, H.J.; Kim, E.J.; Chung, Y.R.; Park, S.Y. Expression of Epithelial-Mesenchymal Transition–Related Markers in Triple-Negative Breast Cancer: ZEB1 as a Potential Biomarker for Poor Clinical Outcome. Hum. Pathol. 2015, 46, 1267–1274. [Google Scholar] [CrossRef] [PubMed]
- Hollier, B.G.; Evans, K.; Mani, S.A. The Epithelial-to-Mesenchymal Transition and Cancer Stem Cells: A Coalition Against Cancer Therapies. J. Mammary Gland Biol. Neoplasia 2009, 14, 29–43. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Wang, M.; Wang, M.; Yao, L.; Li, X.; Dong, H.; Li, M.; Li, X.; Liu, X.; Xu, Y. Exploring the Metabolic Vulnerabilities of Epithelial–Mesenchymal Transition in Breast Cancer. Front. Cell Dev. Biol. 2020, 8, 655. [Google Scholar] [CrossRef]
- Jang, M.; Kim, S.S.; Lee, J. Cancer Cell Metabolism: Implications for Therapeutic Targets. Exp. Mol. Med. 2013, 45, e45. [Google Scholar] [CrossRef]
- Arundhathi, J.R.D.; Mathur, S.R.; Gogia, A.; Deo, S.V.S.; Mohapatra, P.; Prasad, C.P. Metabolic Changes in Triple Negative Breast Cancer-Focus on Aerobic Glycolysis. Mol. Biol. Rep. 2021, 48, 4733–4745. [Google Scholar] [CrossRef]
- Wang, Z.; Jiang, Q.; Dong, C. Metabolic Reprogramming in Triple-Negative Breast Cancer. Cancer Biol. Med. 2020, 17, 44. [Google Scholar] [CrossRef] [PubMed]
- Jia, D.; Lu, M.; Jung, K.H.; Park, J.H.; Yu, L.; Onuchic, J.N.; Kaipparettu, B.A.; Levine, H. Elucidating Cancer Metabolic Plasticity by Coupling Gene Regulation with Metabolic Pathways. Proc. Natl. Acad. Sci. USA 2019, 116, 3909–3918. [Google Scholar] [CrossRef] [PubMed]
- Sawyers, C. Targeted Cancer Therapy. Nature 2004, 432, 294–297. [Google Scholar] [CrossRef]
- Johnstone, R.W.; Ruefli, A.A.; Lowe, S.W. Apoptosis: A Link between Cancer Genetics and Chemotherapy. Cell 2002, 108, 153–164. [Google Scholar] [CrossRef]
- Dawson, S.-J.; Makretsov, N.; Blows, F.M.; Driver, K.E.; Provenzano, E.; Le Quesne, J.; Baglietto, L.; Severi, G.; Giles, G.G.; McLean, C.A. BCL2 in Breast Cancer: A Favourable Prognostic Marker across Molecular Subtypes and Independent of Adjuvant Therapy Received. Br. J. Cancer 2010, 103, 668–675. [Google Scholar] [CrossRef] [PubMed]
- Park, S.-J.; Yoon, B.-H.; Kim, S.-K.; Kim, S.-Y. GENT2: An Updated Gene Expression Database for Normal and Tumor Tissues. BMC Med Genom. 2019, 12, 101. [Google Scholar] [CrossRef] [PubMed]
- Oakes, S.R.; Vaillant, F.; Lim, E.; Lee, L.; Breslin, K.; Feleppa, F.; Deb, S.; Ritchie, M.E.; Takano, E.; Ward, T.; et al. Sensitization of BCL-2–Expressing Breast Tumors to Chemotherapy by the BH3 Mimetic ABT-737. Proc. Natl. Acad. Sci. USA 2012, 109, 2766–2771. [Google Scholar] [CrossRef]
- Radha, G.; Raghavan, S.C. BCL2: A Promising Cancer Therapeutic Target. Biochim. Biophys. Acta (BBA)-Rev. Cancer 2017, 1868, 309–314. [Google Scholar] [CrossRef]
- Vandenberg, C.J.; Cory, S. ABT-199, a New Bcl-2–Specific BH3 Mimetic, Has in Vivo Efficacy against Aggressive Myc-Driven Mouse Lymphomas without Provoking Thrombocytopenia. Blood J. Am. Soc. Hematol. 2013, 121, 2285–2288. [Google Scholar] [CrossRef]
- Wang, L.; Li, J.; Zheng, Z.; Liu, H.; Du, G.; Li, S. Antitumor Activities of a Novel Indolin-2-Ketone Compound, Z24: More Potent Inhibition on bFGF-Induced Angiogenesis and Bcl-2 over-Expressing Cancer Cells. Eur. J. Pharmacol. 2004, 502, 1–10. [Google Scholar] [CrossRef]
- Iyer, D.; Vartak, S.V.; Mishra, A.; Goldsmith, G.; Kumar, S.; Srivastava, M.; Hegde, M.; Gopalakrishnan, V.; Glenn, M.; Velusamy, M.; et al. Identification of a Novel BCL 2-specific Inhibitor That Binds Predominantly to the BH 1 Domain. FEBS J. 2016, 283, 3408–3437. [Google Scholar] [CrossRef] [PubMed]
- Vartak, S.V.; Hegde, M.; Iyer, D.; Gaikwad, S.; Gopalakrishnan, V.; Srivastava, M.; Karki, S.S.; Choudhary, B.; Ray, P.; Santhoshkumar, T.R. A Novel Inhibitor of BCL2, Disarib Abrogates Tumor Growth While Sparing Platelets, by Activating Intrinsic Pathway of Apoptosis. Biochem. Pharmacol. 2016, 122, 10–22. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Varsha, K.K.; Kumari, S.; Gopalakrishnan, V.; Jose, A.E.; Choudhary, B.; Mantelingu, K.; Raghavan, S.C. Acute Toxicity Analysis of Disarib, an Inhibitor of BCL2. Sci. Rep. 2020, 10, 15188. [Google Scholar] [CrossRef] [PubMed]
- Rajendran, V.; Jain, M.V. In Vitro Tumorigenic Assay: Colony Forming Assay for Cancer Stem Cells. In Cancer Stem Cells; Papaccio, G., Desiderio, V., Eds.; Methods in Molecular Biology; Springer New York: New York, NY, USA, 2018; Volume 1692, pp. 89–95. ISBN 978-1-4939-7400-9. [Google Scholar]
- Shoemaker, R.H.; Wolpert-DeFilippes, M.K.; Kern, D.H.; Lieber, M.M.; Makuch, R.W.; Melnick, N.R.; Miller, W.T.; Salmon, S.E.; Simon, R.M.; Venditti, J.M. Application of a Human Tumor Colony-Forming Assay to New Drug Screening. Cancer Res. 1985, 45, 2145–2153. [Google Scholar] [PubMed]
- Lanning, N.J.; Castle, J.P.; Singh, S.J.; Leon, A.N.; Tovar, E.A.; Sanghera, A.; MacKeigan, J.P.; Filipp, F.V.; Graveel, C.R. Metabolic Profiling of Triple-Negative Breast Cancer Cells Reveals Metabolic Vulnerabilities. Cancer Metab. 2017, 5, 6. [Google Scholar] [CrossRef] [PubMed]
- Romero, N.; Swain, P.M.; Kam, Y.; Rogers, G.; Dranka, B.P. Bioenergetic Profiling of Cancer Cell Lines: Quantifying the Impact of Glycolysis on Cell Proliferation. Cancer Res. 2018, 78, 3487. [Google Scholar] [CrossRef]
- Palmer, C.S.; Osellame, L.D.; Stojanovski, D.; Ryan, M.T. The Regulation of Mitochondrial Morphology: Intricate Mechanisms and Dynamic Machinery. Cell. Signal. 2011, 23, 1534–1545. [Google Scholar] [CrossRef] [PubMed]
- Young, A.I.J.; Law, A.M.K.; Castillo, L.; Chong, S.; Cullen, H.D.; Koehler, M.; Herzog, S.; Brummer, T.; Lee, E.F.; Fairlie, W.D.; et al. MCL-1 Inhibition Provides a New Way to Suppress Breast Cancer Metastasis and Increase Sensitivity to Dasatinib. Breast Cancer Res. 2016, 18, 125. [Google Scholar] [CrossRef] [PubMed]
- Todt, F.; Cakir, Z.; Reichenbach, F.; Emschermann, F.; Lauterwasser, J.; Kaiser, A.; Ichim, G.; Tait, S.W.; Frank, S.; Langer, H.F.; et al. Differential Retrotranslocation of Mitochondrial Bax and Bak. EMBO J. 2015, 34, 67–80. [Google Scholar] [CrossRef]
- Edlich, F.; Banerjee, S.; Suzuki, M.; Cleland, M.M.; Arnoult, D.; Wang, C.; Neutzner, A.; Tjandra, N.; Youle, R.J. Bcl-xL Retrotranslocates Bax from the Mitochondria into the Cytosol. Cell 2011, 145, 104–116. [Google Scholar] [CrossRef]
- Carné Trécesson, S.d.; Souazé, F.; Basseville, A.; Bernard, A.-C.; Pécot, J.; Lopez, J.; Bessou, M.; Sarosiek, K.A.; Letai, A.; Barillé-Nion, S. BCL-XL Directly Modulates RAS Signalling to Favour Cancer Cell Stemness. Nat. Commun. 2017, 8, 1123. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.; Chen, Z.; Tang, L.H.; Fang, Y.; Shin, S.J.; Panarelli, N.C.; Chen, Y.-T.; Li, Y.; Jiang, X.; Du, Y.-C.N. Bcl-xL Promotes Metastasis Independent of Its Anti-Apoptotic Activity. Nat. Commun. 2016, 7, 10384. [Google Scholar] [CrossRef] [PubMed]
- Costantini, P.; Jacotot, E.; Decaudin, D.; Kroemer, G. Mitochondrion as a Novel Target of Anticancer Chemotherapy. J. Natl. Cancer Inst. 2000, 92, 1042–1053. [Google Scholar] [CrossRef] [PubMed]
- Moldoveanu, T.; Czabotar, P.E. BAX, BAK, and BOK: A Coming of Age for the BCL-2 Family Effector Proteins. Cold Spring Harb. Perspect. Biol. 2020, 12, a036319. [Google Scholar] [CrossRef] [PubMed]
- Chipuk, J.E.; Kuwana, T.; Bouchier-Hayes, L.; Droin, N.M.; Newmeyer, D.D.; Schuler, M.; Green, D.R. Direct Activation of Bax by P53 Mediates Mitochondrial Membrane Permeabilization and Apoptosis. Science 2004, 303, 1010–1014. [Google Scholar] [CrossRef] [PubMed]
- Hui, L.; Zheng, Y.; Yan, Y.; Bargonetti, J.; Foster, D.A. Mutant P53 in MDA-MB-231 Breast Cancer Cells Is Stabilized by Elevated Phospholipase D Activity and Contributes to Survival Signals Generated by Phospholipase D. Oncogene 2006, 25, 7305–7310. [Google Scholar] [CrossRef] [PubMed]
- Bose, P.; Gandhi, V.; Konopleva, M. Pathways and Mechanisms of Venetoclax Resistance. Leuk. Lymphoma 2017, 58, 2026–2039. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.P. How Mitochondria Produce Reactive Oxygen Species. Biochem. J. 2009, 417, 1–13. [Google Scholar] [CrossRef]
- Kim, I.; Rodriguez-Enriquez, S.; Lemasters, J.J. Selective Degradation of Mitochondria by Mitophagy. Arch. Biochem. Biophys. 2007, 462, 245–253. [Google Scholar] [CrossRef]
- Neumann, C.A.; Fang, Q. Are Peroxiredoxins Tumor Suppressors? Curr. Opin. Pharmacol. 2007, 7, 375–380. [Google Scholar] [CrossRef]
- Skuli, S.J.; Alomari, S.; Gaitsch, H.; Bakayoko, A.; Skuli, N.; Tyler, B.M. Metformin and Cancer, an Ambiguanidous Relationship. Pharmaceuticals 2022, 15, 626. [Google Scholar] [CrossRef] [PubMed]
- Zhou, F.; Zeng, C.; Kuang, W.; Cheng, C.; Liu, H.; Yan, X.; Chen, X.; Zhou, G.; Cao, S. Metformin Exerts a Synergistic Effect with Venetoclax by Downregulating Mcl-1 Protein in Acute Myeloid Leukemia. J. Cancer 2021, 12, 6727. [Google Scholar] [CrossRef] [PubMed]
- Radde, B.N.; Ivanova, M.M.; Mai, H.X.; Salabei, J.K.; Hill, B.G.; Klinge, C.M. Bioenergetic Differences between MCF-7 and T47D Breast Cancer Cells and Their Regulation by Oestradiol and Tamoxifen. Biochem. J. 2015, 465, 49–61. [Google Scholar] [CrossRef] [PubMed]
- Deshmukh, A.; Deshpande, K.; Arfuso, F.; Newsholme, P.; Dharmarajan, A. Cancer Stem Cell Metabolism: A Potential Target for Cancer Therapy. Mol. Cancer 2016, 15, 69. [Google Scholar] [CrossRef]
- Dong, D.; Dong, Y.; Fu, J.; Lu, S.; Yuan, C.; Xia, M.; Sun, L. Bcl2 Inhibitor ABT737 Reverses the Warburg Effect via the Sirt3-HIF1α Axis to Promote Oxidative Stress-Induced Apoptosis in Ovarian Cancer Cells. Life Sci. 2020, 255, 117846. [Google Scholar] [CrossRef] [PubMed]
- Panina, S.B.; Pei, J.; Kirienko, N.V. Mitochondrial Metabolism as a Target for Acute Myeloid Leukemia Treatment. Cancer Metab. 2021, 9, 17. [Google Scholar] [CrossRef] [PubMed]
- Pollyea, D.A.; Stevens, B.M.; Jones, C.L.; Winters, A.; Pei, S.; Minhajuddin, M.; D’Alessandro, A.; Culp-Hill, R.; Riemondy, K.A.; Gillen, A.E. Venetoclax with Azacitidine Disrupts Energy Metabolism and Targets Leukemia Stem Cells in Patients with Acute Myeloid Leukemia. Nat. Med. 2018, 24, 1859–1866. [Google Scholar] [CrossRef] [PubMed]
- Alkhatabi, H.A.; Zohny, S.F.; Shait Mohammed, M.R.; Choudhry, H.; Rehan, M.; Ahmad, A.; Ahmed, F.; Khan, M.I. Venetoclax-Resistant Mv4-11 Leukemic Cells Activate Pi3k/Akt Pathway for Metabolic Reprogramming and Redox Adaptation for Survival. Antioxidants 2022, 11, 461. [Google Scholar] [CrossRef] [PubMed]
- Velez, J.; Pan, R.; Lee, J.T.; Enciso, L.; Suarez, M.; Duque, J.E.; Jaramillo, D.; Lopez, C.; Morales, L.; Bornmann, W. Biguanides Sensitize Leukemia Cells to ABT-737-Induced Apoptosis by Inhibiting Mitochondrial Electron Transport. Oncotarget 2016, 7, 51435. [Google Scholar] [CrossRef]
- Montraveta, A.; Xargay-Torrent, S.; Rosich, L.; López-Guerra, M.; Roldán, J.; Rodríguez, V.; Lee-Vergés, E.; de Frías, M.; Campàs, C.; Campo, E. Bcl-2high Mantle Cell Lymphoma Cells Are Sensitized to Acadesine with ABT-199. Oncotarget 2015, 6, 21159. [Google Scholar] [CrossRef]
- Youle, R.J.; Van Der Bliek, A.M. Mitochondrial Fission, Fusion, and Stress. Science 2012, 337, 1062–1065. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, N.; Skees, J.; Todd, K.J.; West, D.A.; Lambert, K.A.; Robinson, W.A.; Amato, C.M.; Couts, K.L.; Van Gulick, R.; MacBeth, M. MCL1 Inhibitors S63845/MIK665 plus Navitoclax Synergistically Kill Difficult-to-Treat Melanoma Cells. Cell Death Dis. 2020, 11, 443. [Google Scholar] [CrossRef]
- Weiner-Gorzel, K.; Murphy, M. Mitochondrial Dynamics, a New Therapeutic Target for Triple Negative Breast Cancer. Biochim. Biophys. Acta (BBA)-Rev. Cancer 2021, 1875, 188518. [Google Scholar] [CrossRef]
- Cheng, C.-T.; Kuo, C.-Y.; Ouyang, C.; Li, C.-F.; Chung, Y.; Chan, D.C.; Kung, H.-J.; Ann, D.K. Metabolic Stress-Induced Phosphorylation of KAP1 Ser473 Blocks Mitochondrial Fusion in Breast Cancer Cells. Cancer Res. 2016, 76, 5006–5018. [Google Scholar] [CrossRef]
- Lucantoni, F.; Salvucci, M.; Dussmann, H.; Prehn, J.H. BCL (X) L and BCL2 Increase Mitochondrial Dynamics in Breast Cancer Cell: Evidence from Functional and Genetic Studies. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 2021, 1868, 119095. [Google Scholar] [CrossRef]
- Hikita, H.; Takehara, T.; Shimizu, S.; Kodama, T.; Shigekawa, M.; Iwase, K.; Hosui, A.; Miyagi, T.; Tatsumi, T.; Ishida, H.; et al. The Bcl-xL Inhibitor, ABT-737, Efficiently Induces Apoptosis and Suppresses Growth of Hepatoma Cells in Combination with Sorafenib. Hepatology 2010, 52, 1310–1321. [Google Scholar] [CrossRef]
- Fan, Z.; Yu, H.; Cui, N.; Kong, X.; Liu, X.; Chang, Y.; Wu, Y.; Sun, L.; Wang, G. ABT737 Enhances Cholangiocarcinoma Sensitivity to Cisplatin through Regulation of Mitochondrial Dynamics. Exp. Cell Res. 2015, 335, 68–81. [Google Scholar] [CrossRef] [PubMed]
- Sarrio, D.; Franklin, C.K.; Mackay, A.; Reis-Filho, J.S.; Isacke, C.M. Epithelial and Mesenchymal Subpopulations within Normal Basal Breast Cell Lines Exhibit Distinct Stem Cell/Progenitor Properties. Stem Cells 2012, 30, 292–303. [Google Scholar] [CrossRef]
- Lindley, L.E.; Briegel, K.J. Molecular Characterization of TGFβ-Induced Epithelial-Mesenchymal Transition in Normal Finite Lifespan Human Mammary Epithelial Cells. Biochem. Biophys. Res. Commun. 2010, 399, 659–664. [Google Scholar] [CrossRef] [PubMed]
- An, J.; Lv, J.; Li, A.; Qiao, J.; Fang, L.; Li, Z.; Li, B.; Zhao, W.; Chen, H.; Wang, L. Constitutive Expression of Bcl-2 Induces Epithelial-Mesenchymal Transition in Mammary Epithelial Cells. BMC Cancer 2015, 15, 476. [Google Scholar] [CrossRef]
- Winter, M.; Meignan, S.; Völkel, P.; Angrand, P.-O.; Chopin, V.; Bidan, N.; Toillon, R.-A.; Adriaenssens, E.; Lagadec, C.; Le Bourhis, X. Vimentin Promotes the Aggressiveness of Triple Negative Breast Cancer Cells Surviving Chemotherapeutic Treatment. Cells 2021, 10, 1504. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Lv, L.; Tang, Y.; Zhang, L.; Wang, L. MMP-1 Is Overexpressed in Triple-negative Breast Cancer Tissues and the Knockdown of MMP-1 Expression Inhibits Tumor Cell Malignant Behaviors In vitro. Oncol Lett 2018. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.-C.; Lai, Y.-A.; Lin, Y.-C.; Ma, J.-W.; Huang, L.-F.; Yang, N.-S.; Ho, C.-T.; Kuo, S.-C.; Way, T.-D. Curcumin Suppresses Doxorubicin-Induced Epithelial–Mesenchymal Transition via the Inhibition of TGF-β and PI3K/AKT Signaling Pathways in Triple-Negative Breast Cancer Cells. J. Agric. Food Chem. 2013, 61, 11817–11824. [Google Scholar] [CrossRef] [PubMed]
- Du, B.; Shim, J.S. Targeting Epithelial–Mesenchymal Transition (EMT) to Overcome Drug Resistance in Cancer. Molecules 2016, 21, 965. [Google Scholar] [CrossRef] [PubMed]
- Ashrafizadeh, M.; Zarrabi, A.; Hushmandi, K.; Kalantari, M.; Mohammadinejad, R.; Javaheri, T.; Sethi, G. Association of the Epithelial–Mesenchymal Transition (EMT) with Cisplatin Resistance. Int. J. Mol. Sci. 2020, 21, 4002. [Google Scholar] [CrossRef]
- Wang, Q.; Cheng, Y.; Wang, Y.; Fan, Y.; Li, C.; Zhang, Y.; Wang, Y.; Dong, Q.; Ma, Y.; Teng, Y.; et al. Tamoxifen Reverses Epithelial–Mesenchymal Transition by Demethylating miR-200c in Triple-Negative Breast Cancer Cells. BMC Cancer 2017, 17, 492. [Google Scholar] [CrossRef]
- Ramesh, V.; Brabletz, T.; Ceppi, P. Targeting EMT in Cancer with Repurposed Metabolic Inhibitors. Trends Cancer 2020, 6, 942–950. [Google Scholar] [CrossRef] [PubMed]
- Koroth, J.; Nirgude, S.; Tiwari, S.; Gopalakrishnan, V.; Mahadeva, R.; Kumar, S.; Karki, S.S.; Choudhary, B. Investigation of Anti-Cancer and Migrastatic Properties of Novel Curcumin Derivatives on Breast and Ovarian Cancer Cell Lines. BMC Complement Altern. Med. 2019, 19, 273. [Google Scholar] [CrossRef]
- Crowley, L.C.; Scott, A.P.; Marfell, B.J.; Boughaba, J.A.; Chojnowski, G.; Waterhouse, N.J. Measuring Cell Death by Propidium Iodide Uptake and Flow Cytometry. Cold Spring Harb. Protoc. 2016, 2016, pdb-prot087163. [Google Scholar] [CrossRef]
- Darzynkiewicz, Z.; Juan, G.; Li, X.; Gorczyca, W.; Murakami, T.; Traganos, F. Cytometry in Cell Necrobiology: Analysis of Apoptosis and Accidental Cell Death (Necrosis). Cytometry 1997, 27, 1–20. [Google Scholar] [CrossRef]
- Srivastava, M.; Hegde, M.; Chiruvella, K.K.; Koroth, J.; Bhattacharya, S.; Choudhary, B.; Raghavan, S.C. Sapodilla Plum (Achras Sapota) Induces Apoptosis in Cancer Cell Lines and Inhibits Tumor Progression in Mice. Sci. Rep. 2014, 4, 6147. [Google Scholar] [CrossRef]
- Eruslanov, E.; Kusmartsev, S. Identification of ROS Using Oxidized DCFDA and Flow-Cytometry. In Advanced Protocols in Oxidative Stress II; Armstrong, D., Ed.; Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2010; Volume 594, pp. 57–72. ISBN 978-1-60761-410-4. [Google Scholar]
- Pérez-Gallardo, R.V.; Briones, L.S.; Díaz-Pérez, A.L.; Gutiérrez, S.; Rodríguez-Zavala, J.S.; Campos-García, J. Reactive Oxygen Species Production Induced by Ethanol in Saccharomyces Cerevisiae Increases Because of a Dysfunctional Mitochondrial Iron–Sulfur Cluster Assembly System. FEMS Yeast Res. 2013, 13, 804–819. [Google Scholar] [CrossRef]
- TeSlaa, T.; Teitell, M.A. Techniques to Monitor Glycolysis. Methods Enzymol. 2014, 542, 91–114. [Google Scholar] [PubMed]
- Meyer, M.; Kircher, M. Illumina Sequencing Library Preparation for Highly Multiplexed Target Capture and Sequencing. Cold Spring Harb. Protoc. 2010, 2010, pdb-prot5448. [Google Scholar] [CrossRef]
- Bronner, I.F.; Quail, M.A. Best Practices for Illumina Library Preparation. CP Hum. Genet. 2019, 102, e86. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. Subgroup, 1000 Genome Project Data Processing The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Quinlan, A.R. BEDTools: The Swiss-Army Tool for Genome Feature Analysis. CP Bioinform. 2014, 47. [Google Scholar] [CrossRef]
- Swift, M.L. GraphPad Prism, Data Analysis, and Scientific Graphing. J. Chem. Inf. Comput. Sci. 1997, 37, 411–412. [Google Scholar] [CrossRef]







| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| SNAIL | AATCGGAAGCCTAACTACAGCG | GTCCCAGATGAGCATTGGCA |
| SLUG | AAGCATTTCAACGCCTCCAAA | AGGATCTCTGGTTGTGGTATGAC |
| ZEB1 | GGGAGGAGCAGTGAAAGAGA | TTTCTTGCCCTTCCTTTCTG |
| ZEB2 | AAGCCAGGGACAGATCAGC | CCACACTCTGTGCATTTGAACT |
| TWIST1 | GTTGACTCTAGCTCGGACCAC | GCCAGTTTGATCCCAGTATTTT |
| Mid49 | CAGAAACGGGGGAAGCGG | CACCAGGAGACGCACATGG |
| MFN1 | GAGGTGCTATCTCGGAGACAC | GCCAATCCCACTAGGGAGAAC |
| MFN2 | CACATGGAGCGTTGTACCAG | TTGAGCACCTCCTTAGCAGAC |
| OPA1 | TGTGAGGTCTGCCAGTCTTTA | TGTCCTTAATTGGGGTCGTTG |
| DRP1 | ACCCGGAGACCTCTCATTCT | TGACAACGTTGGGTGAAAAA |
| FIS1 | GATGACATCCGTAAAGGCATCG | AGAAGACGTAATCCCGCTGTT |
| MFF | CACCACCTCGTGTACTTACGC | GTCTGCCAACTGCTCGGATTT |
| PINK1 | CCCAAGCAACTAGCCCCTC | GGCAGCACATCAGGGTAGTC |
| PARKIN | GTGTTTGTCAGGTTCAACTCCA | GAAAATCACACGCAACTGGTC |
| GAPDH | CCCTTCATTGACCTCAACTACAT | CTGGAGATGGTGATGGGATTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Manjunath, M.; Ravindran, F.; Sharma, S.; Siddiqua, H.; Raghavan, S.C.; Choudhary, B. Disarib, a Specific BCL2 Inhibitor, Induces Apoptosis in Triple-Negative Breast Cancer Cells and Impedes Tumour Progression in Xenografts by Altering Mitochondria-Associated Processes. Int. J. Mol. Sci. 2024, 25, 6485. https://doi.org/10.3390/ijms25126485
Manjunath M, Ravindran F, Sharma S, Siddiqua H, Raghavan SC, Choudhary B. Disarib, a Specific BCL2 Inhibitor, Induces Apoptosis in Triple-Negative Breast Cancer Cells and Impedes Tumour Progression in Xenografts by Altering Mitochondria-Associated Processes. International Journal of Molecular Sciences. 2024; 25(12):6485. https://doi.org/10.3390/ijms25126485
Chicago/Turabian StyleManjunath, Meghana, Febina Ravindran, Shivangi Sharma, Humaira Siddiqua, Sathees C. Raghavan, and Bibha Choudhary. 2024. "Disarib, a Specific BCL2 Inhibitor, Induces Apoptosis in Triple-Negative Breast Cancer Cells and Impedes Tumour Progression in Xenografts by Altering Mitochondria-Associated Processes" International Journal of Molecular Sciences 25, no. 12: 6485. https://doi.org/10.3390/ijms25126485
APA StyleManjunath, M., Ravindran, F., Sharma, S., Siddiqua, H., Raghavan, S. C., & Choudhary, B. (2024). Disarib, a Specific BCL2 Inhibitor, Induces Apoptosis in Triple-Negative Breast Cancer Cells and Impedes Tumour Progression in Xenografts by Altering Mitochondria-Associated Processes. International Journal of Molecular Sciences, 25(12), 6485. https://doi.org/10.3390/ijms25126485

