A Well-Established Gut Microbiota Enhances the Efficiency of Nutrient Metabolism and Improves the Growth Performance of Trachinotus ovatus
Abstract
1. Introduction
2. Results
2.1. Construction of the Antibiotic-Treated T. ovatus Model
2.2. Differences in the Growth Performance of Antibiotic-Treated and Control T. ovatus
2.3. Differences in the Gut Microbiota of Antibiotic-Treated and Control T. ovatus
2.4. Metabolomic Differences in the Antibiotic-Treated and Control Groups
2.5. Differences in Gene Expression between Antibiotic-Treated and Control T. ovatus
2.6. Expression Analysis of Key Genes
2.7. Correlation between Intestinal Bacteria and the DEGs and DMs
3. Discussion
4. Materials and Methods
4.1. Experimental Design and Sample Collection
4.2. Antibiotic-Treated T. ovatus Model
4.3. Growth Performance Analyses
4.4. Intestinal Microbiome Analysis
4.5. Intestinal Metabolomics Analysis
4.6. Intestinal Transcriptomic Analysis
4.7. Expression and Localization Analysis of Key Genes
4.8. Correlation Analysis
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sender, R.; Fuchs, S.; Milo, R. Are We Really Vastly Outnumbered? Revisiting the Ratio of Bacterial to Host Cells in Humans. Cell 2016, 164, 337–340. [Google Scholar] [CrossRef] [PubMed]
- Clarke, G.; Stilling, R.M.; Kennedy, P.J.; Stanton, C.; Cryan, J.F.; Dinan, T.G. Minireview: Gut microbiota: The neglected endocrine organ. Mol. Endocrinol. 2014, 28, 1221–1238. [Google Scholar] [CrossRef] [PubMed]
- Round, J.L.; Mazmanian, S.K. The gut microbiota shapes intestinal immune responses during health and disease. Nat. Rev. Immunol. 2009, 9, 313–323. [Google Scholar] [CrossRef] [PubMed]
- Cornuault, J.K.; Byatt, G.; Paquet, M.-E.; De Koninck, P.; Moineau, S. Zebrafish: A big fish in the study of the gut microbiota. Curr. Opin. Biotechnol. 2022, 73, 308–313. [Google Scholar] [CrossRef] [PubMed]
- Kolodziejczyk, A.A.; Zheng, D.; Elinav, E. Diet–microbiota interactions and personalized nutrition. Nat. Rev. Microbiol. 2019, 17, 742–753. [Google Scholar] [CrossRef] [PubMed]
- Sonnenburg, J.L.; Backhed, F. Diet-microbiota interactions as moderators of human metabolism. Nature 2016, 535, 56–64. [Google Scholar] [CrossRef]
- Bolte, L.A.; Vila, A.V.; Imhann, F.; Collij, V.; Gacesa, R.; Peters, V.; Wijmenga, C.; Kurilshikov, A.; Campmans-Kuijpers, M.J.; Fu, J. Long-term dietary patterns are associated with pro-inflammatory and anti-inflammatory features of the gut microbiome. Gut 2021, 70, 1287–1298. [Google Scholar] [CrossRef] [PubMed]
- Clements, K.D.; Angert, E.R.; Montgomery, W.L.; Choat, J.H. Intestinal microbiota in fishes: What’s known and what’s not. Mol. Ecol. 2014, 23, 1891–1898. [Google Scholar] [CrossRef]
- Wang, A.; Zhang, Z.; Ding, Q.; Yang, Y.; Bindelle, J.; Ran, C.; Zhou, Z. Intestinal Cetobacterium and acetate modify glucose homeostasis via parasympathetic activation in zebrafish. Gut Microbes 2021, 13, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Bäckhed, F.; Ding, H.; Wang, T.; Hooper, L.V.; Koh, G.Y.; Nagy, A.; Semenkovich, C.F.; Gordon, J.I. The gut microbiota as an environmental factor that regulates fat storage. Proc. Natl. Acad. Sci. USA 2004, 101, 15718–15723. [Google Scholar] [CrossRef]
- Ringø, E.; Harikrishnan, R.; Soltani, M.; Ghosh, K. The effect of gut microbiota and probiotics on metabolism in fish and shrimp. Animals 2022, 12, 3016. [Google Scholar] [CrossRef]
- FAO. The State of World Fisheries and Aquaculture 2022. Towards Blue Transformation; FAO: Rome, Italy, 2022. [Google Scholar]
- Fei, N.; Zhao, L. An opportunistic pathogen isolated from the gut of an obese human causes obesity in germfree mice. ISME J. 2013, 7, 880–884. [Google Scholar] [CrossRef]
- Ruiz, V.E.; Battaglia, T.; Kurtz, Z.D.; Bijnens, L.; Ou, A.; Engstrand, I.; Zheng, X.; Iizumi, T.; Mullins, B.J.; Müller, C.L. A single early-in-life macrolide course has lasting effects on murine microbial network topology and immunity. Nat. Commun. 2017, 8, 518. [Google Scholar] [CrossRef]
- Pham, L.N.; Kanther, M.; Semova, I.; Rawls, J.F. Methods for generating and colonizing gnotobiotic zebrafish. Nat. Protoc. 2008, 3, 1862–1875. [Google Scholar] [CrossRef]
- Brandl, K.; Plitas, G.; Mihu, C.N.; Ubeda, C.; Jia, T.; Fleisher, M.; Schnabl, B.; DeMatteo, R.P.; Pamer, E.G. Vancomycin-resistant enterococci exploit antibiotic-induced innate immune deficits. Nature 2008, 455, 804–807. [Google Scholar] [CrossRef] [PubMed]
- Morgun, A.; Dzutsev, A.; Dong, X.; Greer, R.L.; Sexton, D.J.; Ravel, J.; Schuster, M.; Hsiao, W.; Matzinger, P.; Shulzhenko, N. Uncovering effects of antibiotics on the host and microbiota using transkingdom gene networks. Gut 2015, 64, 1732–1743. [Google Scholar] [CrossRef]
- Yukgehnaish, K.; Kumar, P.; Sivachandran, P.; Marimuthu, K.; Arshad, A.; Paray, B.A.; Arockiaraj, J. Gut microbiota metagenomics in aquaculture: Factors influencing gut microbiome and its physiological role in fish. Rev. Aquac. 2020, 12, 1903–1927. [Google Scholar] [CrossRef]
- Schoeler, M.; Caesar, R. Dietary lipids, gut microbiota and lipid metabolism. Rev Endocr Metab Disord 2019, 20, 461–472. [Google Scholar] [CrossRef] [PubMed]
- Dong, P.; Guo, H.; Huang, L.; Zhang, D.; Wang, K. Glucose addition improves the culture performance of Pacific white shrimp by regulating the assembly of Rhodobacteraceae taxa in gut bacterial community. Aquaculture 2023, 567, 739254. [Google Scholar] [CrossRef]
- Shields-Menard, S.A.; Amirsadeghi, M.; French, W.T.; Boopathy, R. A review on microbial lipids as a potential biofuel. Bioresour. Technol. 2018, 259, 451–460. [Google Scholar] [CrossRef]
- Bhatia, S.K.; Gurav, R.; Choi, T.-R.; Han, Y.H.; Park, Y.-L.; Park, J.Y.; Jung, H.-R.; Yang, S.-Y.; Song, H.-S.; Kim, S.-H.; et al. Bioconversion of barley straw lignin into biodiesel using Rhodococcus sp. YHY01. Bioresour. Technol. 2019, 289, 121704. [Google Scholar] [CrossRef]
- Chen, Z.; Wan, C. Co-fermentation of lignocellulose-based glucose and inhibitory compounds for lipid synthesis by Rhodococcus jostii RHA1. Process Biochem. 2017, 57, 159–166. [Google Scholar] [CrossRef]
- Kim, Y.J.; Liu, R.H. Increase of Conjugated Linoleic Acid Content in Milk by Fermentation with Lactic Acid Bacteria. J. Food Sci. (Wiley-Blackwell) 2002, 67, 1731–1737. [Google Scholar] [CrossRef]
- Ogawa, J.; Kishino, S.; Ando, A.; Sugimoto, S.; Mihara, K.; Shimizu, S. Production of conjugated fatty acids by lactic acid bacteria. J. Biosci. Bioeng. 2005, 100, 355–364. [Google Scholar] [CrossRef]
- Velagapudi, V.R.; Hezaveh, R.; Reigstad, C.S.; Gopalacharyulu, P.; Yetukuri, L.; Islam, S.; Felin, J.; Perkins, R.; Borén, J.; Orešič, M.; et al. The gut microbiota modulates host energy and lipid metabolism in mice[S]. J. Lipid Res. 2010, 51, 1101–1112. [Google Scholar] [CrossRef] [PubMed]
- Kindt, A.; Liebisch, G.; Clavel, T.; Haller, D.; Hörmannsperger, G.; Yoon, H.; Kolmeder, D.; Sigruener, A.; Krautbauer, S.; Seeliger, C.; et al. The gut microbiota promotes hepatic fatty acid desaturation and elongation in mice. Nat. Commun. 2018, 9, 3760. [Google Scholar] [CrossRef]
- Armstrong, L.E.; Belval, L.N.; Casa, D.J. Metabolism, bioenergetics and thermal physiology: Influences of the human intestinal microbiota. Nutr. Res. Rev. 2019, 32, 205–217. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, M.; Anishetty, S. A meta-metabolome network of carbohydrate metabolism: Interactions between gut microbiota and host. Biochem. Biophys. Res. Commun. 2012, 428, 278–284. [Google Scholar] [CrossRef] [PubMed]
- Collins, S.M.; Surette, M.; Bercik, P. The interplay between the intestinal microbiota and the brain. Nat. Rev. Microbiol. 2012, 10, 735–742. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Koshio, S. Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture 2016, 454, 243–251. [Google Scholar] [CrossRef]
- Liu, W.; Ren, P.; He, S.; Xu, L.; Yang, Y.; Gu, Z.; Zhou, Z. Comparison of adhesive GUT bacteria, immunity, and disease resistance in juvenile hybrid tilapia fed different Lactobacillus strains. Fish Shellfish Immunol. 2013, 34, 1661. [Google Scholar]
- Christian Larbi, A.; Andrews, A.; Gyamfua, A. A Review of Probiotics, Prebiotics, and Synbiotics in Crab: Present Research, Problems, and Future Perspective. J. Shellfish Res. 2017, 36, 799–806. [Google Scholar]
- Baker-Austin, C.; Oliver, J.D.; Alam, M.; Ali, A.; Waldor, M.K.; Qadri, F.; Martinez-Urtaza, J. Vibrio spp. infections. Nat. Rev. Dis. Primers 2018, 4, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Clemens, J.D.; Nair, G.B.; Ahmed, T.; Qadri, F.; Holmgren, J. Cholera. Lancet 2017, 390, 1539–1549. [Google Scholar] [CrossRef] [PubMed]
- Letchumanan, V.; Chan, K.G.; Lee, L.H. Vibrio parahaemolyticus: A review on the pathogenesis, prevalence, and advance molecular identification techniques. Front. Microbiol. 2014, 5, 705. [Google Scholar] [CrossRef] [PubMed]
- Du, Y.; Meng, Q.; Zhang, Q.; Guo, F. Isoleucine or valine deprivation stimulates fat loss via increasing energy expenditure and regulating lipid metabolism in WAT. Amino Acids 2012, 43, 725–734. [Google Scholar] [CrossRef] [PubMed]
- van Vught, A.J.A.H.; Nieuwenhuizen, A.G.; Brummer, R.-J.M.; Westerterp-Plantenga, M.S. Effects of Oral Ingestion of Amino Acids and Proteins on the Somatotropic Axis. J. Clin. Endocrinol. Metab. 2008, 93, 584–590. [Google Scholar] [CrossRef] [PubMed]
- Ng, W.K.; Koh, C.B. The utilization and mode of action of organic acids in the feeds of cultured aquatic animals. Rev. Aquac. 2016, 9, 342–368. [Google Scholar] [CrossRef]
- Suhaila Abdul, S.; Sofea, T.; Fariborz, E.; Aziz, A.; Wing-Keong, N.; Nicholas, R. Effects of Different Dietary Organic Acids on the Survival, Growth, and Hepatopancreatic Histopathology of the Blue Swimmer Crab (Portunus pelagicus). J. Shellfish Res. 2016, 35, 555–561. [Google Scholar]
- Guo, Y.J.; Pan, W.W.; Liu, S.B.; Shen, Z.F.; Xu, Y.; Hu, L.L. ERK/MAPK signalling pathway and tumorigenesis. Exp. Ther. Med. 2020, 19, 1997–2007. [Google Scholar] [CrossRef]
- Zhou, B.; Der, C.J.; Cox, A.D. The role of wild type RAS isoforms in cancer. Semin. Cell Dev. Biol. 2016, 58, 60–69. [Google Scholar] [CrossRef]
- Benhaiem, S.; Dehnhard, M.; Bonanni, R.; Hofer, H.; Goymann, W.; Eulenberger, K.; East, M.L. Validation of an enzyme immunoassay for the measurement of faecal glucocorticoid metabolites in spotted hyenas (Crocuta crocuta). Gen. Comp. Endocrinol. 2012, 178, 265–271. [Google Scholar] [CrossRef] [PubMed]
- Simanshu, D.K.; Nissley, D.V.; McCormick, F. RAS Proteins and Their Regulators in Human Disease. Cell 2017, 170, 17–33. [Google Scholar] [CrossRef]
- Breves, J.P.; Springer-Miller, R.H.; Chenoweth, D.A.; Paskavitz, A.L.; Chang, A.Y.H.; Regish, A.M.; Einarsdottir, I.E.; Björnsson, B.T.; McCormick, S.D. Cortisol regulates insulin-like growth-factor binding protein (igfbp) gene expression in Atlantic salmon parr. Mol. Cell. Endocrinol. 2020, 518, 110989. [Google Scholar] [CrossRef]
- Zhou, F.; Zhang, H.; Cong, Z.; Zhao, L.-H.; Zhou, Q.; Mao, C.; Cheng, X.; Shen, D.-D.; Cai, X.; Ma, C.; et al. Structural basis for activation of the growth hormone-releasing hormone receptor. Nat. Commun. 2020, 11, 5205. [Google Scholar] [CrossRef]
- Ren, Y.; Wen, H.; Li, Y.; Li, J. Stocking density affects the growth performance and metabolism of Amur sturgeon by regulating expression of genes in the GH/IGF axis. J. Oceanol. Limnol. 2018, 36, 956–972. [Google Scholar] [CrossRef]
- Li, M. The Origination of Growth Hormone/Insulin-Like Growth Factor System: A Story From Ancient Basal Chordate Amphioxus. Front. Endocrinol. (Lausanne) 2022, 13, 825722. [Google Scholar] [CrossRef]
- Sheng, Y.; Ren, H.; Limbu, S.M.; Sun, Y.; Qiao, F.; Zhai, W.; Du, Z.Y.; Zhang, M. The Presence or Absence of Intestinal Microbiota Affects Lipid Deposition and Related Genes Expression in Zebrafish (Danio rerio). Front. Microbiol. 2018, 9, 1124. [Google Scholar] [CrossRef] [PubMed]
- Nadkarni, M.A.; Martin, F.E.; Jacques, N.A.; Hunter, N. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 2002, 148, 257–266. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996. [Google Scholar] [CrossRef]
- Stackebrandt, E.; Goebel, B.M. Taxonomic Note: A Place for DNA-DNA Reassociation and 16S rRNA Sequence Analysis in the Present Species Definition in Bacteriology. Int. J. Syst. Bacteriol. 1994, 44, 846–849. [Google Scholar] [CrossRef]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef] [PubMed]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.-C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Song, W.; Jin, C.; Huang, K.; Yu, Q.; Qi, J.; Zhang, Q.; He, Y. Pax3 and Pax7 Exhibit Distinct and Overlapping Functions in Marking Muscle Satellite Cells and Muscle Repair in a Marine Teleost, Sebastes schlegelii. Int. J. Mol. Sci. 2021, 22, 3769. [Google Scholar] [CrossRef]
- Noecker, C.; Eng, A.; Srinivasan, S.; Theriot, C.M.; Young, V.B.; Jansson, J.K.; Fredricks, D.N.; Borenstein, E. Metabolic Model-Based Integration of Microbiome Taxonomic and Metabolomic Profiles Elucidates Mechanistic Links between Ecological and Metabolic Variation. mSystems 2016, 1, e00013-15. [Google Scholar] [CrossRef]






| Group | TB | CB | 
|---|---|---|
| W0 (g) | 1.33 ± 0.09 | 1.33 ± 0.09 | 
| Wt/Body weight (g) | 2.40 ± 0.13 a | 4.33 ± 0.21 c | 
| Body length (cm) | 6.15 ± 0.41 a | 7.91 ± 0.55 c | 
| Body thickness (cm) | 1.13 ± 0.04 a | 1.25 ± 0.07 b | 
| Body depth (cm) | 2.05 ± 0.11 a | 2.32 ± 0.08 b | 
| WGR (%) | 80.45 ± 3.89 a | 225.56 ± 15.37 b | 
| SGR (%/d) | 1.96 ± 0.10 a | 3.93 ± 0.25 c | 
| FCR (%) | 1.53 ± 0.04 a | 1.40 ± 0.05 b | 
| Group | Shannon | Ace | PD | 
|---|---|---|---|
| CB_60d | 2.42 ± 0.32 a | 704.28 ± 107.45 a | 24.89 ± 3.96 a | 
| TB_60d | 0.81 ± 0.09 c | 237.62 ± 67.67 c | 8.54 ± 2.57 c | 
| Gene Name | Primers | Sequences (5′-3′) | 
|---|---|---|
| ghr | F-ghr-q | ACCGTCACTTCAGCAACTTCCA | 
| R-ghr-q | CCACAGGCGTCAGGTCACAT | |
| jak2 | F-jak2-q | CCAGAGGTTGCGTCTCGTTGA | 
| R-jak2-q | CAGCGGCTTGTCTCGTGTCT | |
| shc1 | F-shc1-q | GTGGAGGTGCTACAGTCAATGC | 
| R-shc1-q | ACGTCAGACAGCGAGAGGAAG | |
| kras | F-kras-q | TGCCATCAACAACACCAAGTCC | 
| R-kras-q | GTGCTCAGGTCGCTCTTATTCC | |
| mapk1 | F-mapk1-q | GGCACGGCACATTGACAACA | 
| R-mapk1-q | CGCAGGATCTGGTAGAGGAAGT | |
| egfr | F-egfr-q | CAGAACGGAGTCTCGGATGTGA | 
| R-egfr-q | TTGGAGGTGAGCGGGAGGAT | |
| sos1 | F-sos1-q | AGGTAAGGCGATGAGGAAGTGG | 
| R-sos1-q | TCTGGAAGGTGATGCTGTGACT | |
| stat3 | F-stat3-q | GGTGTGGCTGGACAACATCATT | 
| R-stat3-q | CCTCCTTGCTGCTCTCACTGAA | |
| socs1 | F-socs1-q | CAGCGGTCAGCCTGATGTCT | 
| R-socs1-q | TGAGCAGAGCGAAGAGTGATGT | |
| cdkn1a (p21) | F-cdkn1a-q | CTTCTGCCATCTCTATCCTCCT | 
| R-cdkn1a-q | TGGTCCTGTGGTTGATGTTGA | |
| β-actin | F-β-actin-q | TACGAGCTGCCTGACGGACA | 
| R-β-actin-q | GGCTGTGATCTCCTTCTGC | 
| Gene Name | Primers | Sequences (5′-3′) | 
|---|---|---|
| ghr | F-ghr-ISH | ATTTAGGTGACACTATAGAAGAGGCCGACTACCAAGCCAGGAA | 
| R-ghr-ISH | TAATACGACTCACTATAGGGAGAGCTGAGGTCCAGAGGAGTTCTT | |
| jak2 | F-jak2-y | ATTTAGGTGACACTATAGAAGAGAGCCTACGCATCGACTTGT | 
| R-jak2-y | TAATACGACTCACTATAGGGAGATTCAGCAACATCACCTTCAACA | |
| kras | F-kras-ISH | ATTTAGGTGACACTATAGAAGAGGAGACCAACCGCAGCAACAAG | 
| R-kras-ISH | TAATACGACTCACTATAGGGAGACGGACTCTGCACATTGGATGGA | |
| mapk1 | F-mapk1-ISH | ATTTAGGTGACACTATAGAAGAGGGCACGGCACATTGACAACA | 
| R-mapk1-ISH | TAATACGACTCACTATAGGGAGATTGAGGTCGCAGGTGGTGTT | |
| egfr | F-egfr-ISH | ATTTAGGTGACACTATAGAAGAGCTCACCTCCAACGGCACAGT | 
| R-egfr-ISH | TAATACGACTCACTATAGGGAGAAACGGAAAGCTGCACAAAGTGT | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kong, M.; Zhao, W.; Wang, C.; Qi, J.; Liu, J.; Zhang, Q. A Well-Established Gut Microbiota Enhances the Efficiency of Nutrient Metabolism and Improves the Growth Performance of Trachinotus ovatus. Int. J. Mol. Sci. 2024, 25, 5525. https://doi.org/10.3390/ijms25105525
Kong M, Zhao W, Wang C, Qi J, Liu J, Zhang Q. A Well-Established Gut Microbiota Enhances the Efficiency of Nutrient Metabolism and Improves the Growth Performance of Trachinotus ovatus. International Journal of Molecular Sciences. 2024; 25(10):5525. https://doi.org/10.3390/ijms25105525
Chicago/Turabian StyleKong, Miao, Wendong Zhao, Cong Wang, Jie Qi, Jinxiang Liu, and Quanqi Zhang. 2024. "A Well-Established Gut Microbiota Enhances the Efficiency of Nutrient Metabolism and Improves the Growth Performance of Trachinotus ovatus" International Journal of Molecular Sciences 25, no. 10: 5525. https://doi.org/10.3390/ijms25105525
APA StyleKong, M., Zhao, W., Wang, C., Qi, J., Liu, J., & Zhang, Q. (2024). A Well-Established Gut Microbiota Enhances the Efficiency of Nutrient Metabolism and Improves the Growth Performance of Trachinotus ovatus. International Journal of Molecular Sciences, 25(10), 5525. https://doi.org/10.3390/ijms25105525
 
        


 
       