Development of Rapid Detection Methods for Fusarium oysporum f. sp. melonis in Melon Seeds
Abstract
1. Introduction
2. Results
2.1. The Specificity Test of the Primers
2.2. The Sensitivity Test of the Primers
2.3. Comparing the Reproducibility of the Molecular Detection Systems
2.4. Comparing the Molecular Detection Results from the Different Extraction Systems
2.5. Molecular Detection Results of Pod-Inoculated Seeds
3. Discussion
4. Materials and Methods
4.1. Pathogen Isolates and Growth Condition
4.2. Primer and TaqMan Probe Design
4.3. Sensitivity Assays
4.4. Preparation of Artificially Inoculated Seeds
4.5. Preparation of Fom Pod-Inoculation
4.6. DNA Extraction Methods from Seed Sample
4.7. Molecular Detection Assays
4.8. Validations Data from the Molecular Detection Assays
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhu, Q.; Wu, C.; Sikandar, A.; Liu, S.; Gao, P.; Wang, X.; MA, H.; Zu, Z.; Luan, F. Genome−wide association study of powdery mildew resistance in a worldwide collection of melon (Cucumis melo L.) germplasm. In Proceedings of the Cucurbitaceae XIth Eucarpia Meeting on Cucurbit Genetics & Breeding, Warsaw, Poland, 24–28 July 2016; pp. 50–53. [Google Scholar]
- FAOSTAT. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 15 January 2024).
- Skottrup, P.; Frøkiær, H.; Hearty, S.; O’Kennedy, R.; Hejgaard, J.; Nicolaisen, M.; Justesen, A.F. Monoclonal antibodies for the detection of Puccinia striiformis urediniospores. Mycol. Res. 2007, 111, 332–338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luongo, L.; Vitale, S.; Haegi, A.; Belisario, A. Development of SCAR markers and PCR assay for Fusarium oxysporum f. sp. melonis race 2−specific detection. J. Plant Pathol. 2012, 94, 193–199. [Google Scholar]
- Ramos, B.; López, G.; Molina, A. Development of a Fusarium oxysporum f. sp. melonis functional GFP fluorescence tool to assist melon resistance breeding programmes. Plant Pathol. 2015, 64, 1349–1357. [Google Scholar] [CrossRef] [Scilit]
- Tsay, J.G.; Chen, R.S.; Tung, B.K. Race 2 of Fusarium oxysporum f. sp. melonis in Taiwan. Plant Prot. Bull. 1999, 41, 139–143. [Google Scholar]
- Kurt, S.; Baran, B.; Sari, N.; Yeisir, H. Physiologic races of Fusarium oxysporum f. sp. melonis in the southeastern anatolia region of turkey and varietal reactions to races of the pathogen. Phytoparasitica 2002, 30, 395–402. [Google Scholar] [CrossRef] [Scilit]
- López−Mondéjar, R.; Beaulieu, R.; Ros, M.; Pascual, J.A. SCAR−based real−time TaqMan PCR for early detection of Fusarium oxysporum in melon seedlings under greenhouse nursery conditions. Crop Prot. 2012, 33, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Punja, Z.K.; Parker, M.; Elmhirst, J.F. Fusarium wilt of field−grown muskmelon in British Columbia. Can. J. Plant Pathol. 2001, 23, 403–410. [Google Scholar] [CrossRef] [Scilit]
- Tsedaley, B. Review on seed health tests and detection method of seedborne diseases. J. Biol. Agr. Healthc. 2015, 5, 176–184. [Google Scholar]
- Liu, A.W.; Villar−Briones, A.; Luscombe, N.M.; Plessy, C. Automated phenol−chloroform extraction of high molecular weight genomic DNA for use in long−read single−molecule sequencing. F1000Research 2022, 11, 240. [Google Scholar] [CrossRef] [Scilit]
- Kumar, R.; Gupta, A.; Srivastava, S.; Devi, G.; Singh, V.K.; Goswami, S.K.; Gurjar, M.S.; Aggarwal, R. Diagnosis and detection of seed−borne fungal phytopathogens. In Seed−Borne Diseases of Agricultural Crops: Detection, Diagnosis & Managemen; Kumar, R., Gupta, A., Eds.; Springer: Singapore, 2020; pp. 107–142. [Google Scholar]
- Mancini, V.; Murolo, S.; Romanazzi, G. Diagnostic methods for detecting fungal pathogens on vegetable seeds. Plant Pathol. 2016, 65, 691–703. [Google Scholar] [CrossRef] [Scilit]
- Walcott, R.R. Detection of seedborne pathogens. HortTechnology 2003, 13, 40–47. [Google Scholar] [CrossRef] [Scilit]
- Lievens, B.; Rep, M.; Thomma, B.P. Recent developments in the molecular discrimination of formae speciales of Fusarium oxysporum. Pest Manag. Sci. 2008, 64, 781–788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Sousa, M.V.; Machado, J.D.C.; Simmons, H.E.; Munkvold, G.P. Real−time quantitative PCR assays for the rapid detection and quantification of Fusarium oxysporum f. sp. phaseoli in Phaseolus vulgaris (common bean) seeds. Plant Pathol. 2015, 64, 478–488. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.H.; Su, C.C.; Chao, C.P.; Chen, C.Y.; Chang, C.J.; Huang, J.W.; Chang, P.F.L. A molecular diagnosis method using real−time PCR for quantification and detection of Fusarium oxysporum f. sp. cubense race 4. Eur. J. Plant Pathol. 2013, 135, 395–405. [Google Scholar] [CrossRef] [Scilit]
- Chang, T.D.; Wu, Z.B.; Su, S.M.; Lin, Y.H. Comparison of the efficiency of PCR−based methods for detecting Fusarium oxysporum f. sp. melonis seeds and seedlings in Taiwan. J. Plant Med. 2020, 62, 1–11. [Google Scholar]
- Almasi, M.A. Development of a colorimetric loop−mediated isothermal amplification assay for the visual detection of Fusarium oxysporum f. sp. melonis. Hortic. Plant J. 2019, 5, 129–136. [Google Scholar] [CrossRef] [Scilit]
- Haegi, A.; Catalano, V.; Luongo, L.; Vitale, S.; Scotton, M.; Ficcadenti, N.; Belisario, A. A newly developed real−time PCR assay for detection and quantification of Fusarium oxysporum and its use in compatible and incompatible interactions with grafted melon genotypes. Phytopathology 2013, 103, 802–810. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.H.; Shen, S.M.; Wen, C.J.; Lin, Y.J.; Chang, T.D.; Chu, S.C. Molecular detection assays for rapid field−detection of rice sheath blight. Front. Plant Sci. 2021, 11, 552916. [Google Scholar] [CrossRef] [Scilit]
- Edel, V.; Steinberg, C.; Gautheron, N.; Alabouvette, C. Ribosomal DNA−targeted oligonucleotide probe and PCR assay specific for Fusarium oxysporum. Mycol. Res. 2000, 104, 518–526. [Google Scholar] [CrossRef] [Scilit]
- Petkar, A.; Ji, P. Infection courts in watermelon plants leading to seed infestation by Fusarium oxysporum f. sp. niveum. Phytopathology 2017, 107, 828–833. [Google Scholar] [CrossRef] [Scilit]
- Gao, L.; Feng, C.; Li, B.; Liu, T.; Liu, B.; Chen, W. Detection of Tilletia controversa using immunofluorescent monoclonal antibodies. J. Appl. Microbiol. 2015, 118, 497–505. [Google Scholar] [CrossRef] [Scilit]
- Schena, L.; Li Destri Nicosia, M.G.; Sanzani, S.M.; Faedda, R.; Ippolito, A.; Cacciola, S.O. Development of quantitative PCR detection methods for phytopathogenic fungi and oomycetes. J. Plant Pathol. 2013, 95, 7–24. [Google Scholar]
- 2022 Agricultural Statistics Yearbook. Available online: https://agrstat.moa.gov.tw/sdweb/public/book/Book.aspx (accessed on 15 January 2024).
- Zhao, X.; Huang, Y.; Li, X.; Yang, W.; Lv, Y.; Sun, W.; Huang, J.; Mi, S. Full integration of nucleic acid extraction and detection into a centrifugal microfluidic chip employing chitosan−modified microspheres. Talanta 2022, 250, 123711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, R.; Lewis, R.S.; Panthee, D.R. Filter paper−based spin column method for cost−efficient DNA or RNA purification. PLoS ONE 2018, 13, e0203011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal rRNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; Volume 38, pp. 315–322. [Google Scholar]
- Chang, T.D.; Huang, L.N.; Lin, Y.J.; Wu, Z.B.; Tsai, S.H.; Lin, Y.H. Rapid detection of Fusarium oxysporum using insulated isothermal PCR and a rapid, simple DNA preparation protocol. Int. J. Mol. Sci. 2022, 23, 13253. [Google Scholar] [CrossRef] [Scilit]
- Cutrín, J.M.; Olveira, J.G.; Bandín, I.; Dopazo, C.P. Validation of real time RT−PCR applied to cell culture for diagnosis of any known genotype of viral haemorrhagic septicaemia virus. J. Virol. Methods 2009, 162, 155–162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kubista, M.; Andrade, J.M.; Bengtsson, M.; Forootan, A.; Jonák, J.; Lind, K.; Sindelka, R.; Sjöback, R.; Sjögreen, B.; Strömbom, L.; et al. The real−time polymerase chain reaction. Mol. Asp. Med. 2006, 27, 95–125. [Google Scholar] [CrossRef] [Scilit]
- Ramakers, C.; Ruijter, J.M.; Deprez, R.H.L.; Moorman, A.F. Assumption−free analysis of quantitative real−time polymerase chain reaction (PCR) data. Neurosci. Lett. 2003, 339, 62–66. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez, A.; Rodríguez, M.; Luque, M.I.; Justesen, A.F.; Córdoba, J.J. Quantification of ochratoxin A−producing molds in food products by SYBR Green and TaqMan real−time PCR methods. Int. J. Food Microbiol. 2011, 149, 226–235. [Google Scholar] [CrossRef] [Scilit]
- Kang, T.S. Basic principles for developing real−time PCR methods used in food analysis: A review. Trends Food Sci. Technol. 2019, 91, 574–585. [Google Scholar] [CrossRef] [Scilit]
- Demeke, T.; Jenkins, G.R. Influence of DNA extraction methods, PCR inhibitors and quantification methods on real−time PCR assay of biotechnology−derived traits. Anal. Bioanal. Chem. 2010, 396, 1977–1990. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Samant, S.K.; Rege, D.V. Carbohydrate composition of some cucurbit seeds. J. Food Comp. Anal. 1989, 2, 149–156. [Google Scholar] [CrossRef] [Scilit]
- de Melo, M.L.S.; Narain, N.; Bora, P.S. Characterisation of some nutritional constituents of melon (Cucumis melo hybrid AF−522) seeds. Food Chem. 2000, 68, 411–414. [Google Scholar] [CrossRef] [Scilit]
- Monteiro, L.; Bonnemaison, D.; Vekris, A.; Petry, K.G.; Bonnet, J.; Vidal, R.; Cabrita, J.; Mégraud, F. Complex polysaccharides as PCR inhibitors in feces: Helicobacter pylori model. J. Clin. Microbiol. 1997, 35, 995–998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hartman, L.J.; Coyne, S.R.; Norwood, D.A. Development of a novel internal positive control for Taqman® based assays. Mol. Cell. Probes. 2005, 19, 51–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nash, S.M.; Snyder, W.C. Quantitative estimations by plate counts of propagules of the bean root rot Fusarium in field soils. Phytopathology 1962, 52, 567–572. [Google Scholar]
- Lin, Y.H.; Chang, J.Y.; Liu, E.T.; Chao, C.P.; Huang, J.W.; Chang, P.F.L. Development of a molecular marker for specific detection of Fusarium oxysporum f. sp. cubense race 4. Eur. J. Plant Pathol. 2009, 123, 353–365. [Google Scholar] [CrossRef] [Scilit]
- Porebski, S.; Bailey, L.G.; Baum, B.R. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol. Biol. Rep. 1997, 15, 8–15. [Google Scholar] [CrossRef] [Scilit]


| Fungal Pathogens/Diseases | Code Number | Original Hosts | Geographic Location | PCR Specificity Assays | ||
|---|---|---|---|---|---|---|
| ITS1/ITS4 a | Fa15F/Fa15R b | TDCP2F/TDCP2R c | ||||
| Fusarium oxysporum f. sp. melonis (Fom)/Fusarium wilt of melon (FWM) | PM-TDC-F006 | Melon (Cucumis melo L.) (M) | Kaohsiung city, Taiwan | + d | + | + |
| Fom/FWM | PM-TDC-F007 | M | Kaohsiung city, Taiwan | + | + | + |
| Fom/FWM | PM-TDC-F008 | M | Kaohsiung city, Taiwan | + | + | + |
| Fom/FWM | PM-TDC-F009 | M | Kaohsiung city, Taiwan | + | + | + |
| Fom/FWM | PM-TDC-F010 | M | Kaohsiung city, Taiwan | + | + | + |
| Fom/FWM | PM-TDC-F011 | M | Kaohsiung city, Taiwan | + | + | + |
| Fom/FWM | PM-YJL-F053 | M | Kaohsiung city, Taiwan | + | + | + |
| Fom/FWM | PM-YJL-F054 | M | Kaohsiung city, Taiwan | + | + | + |
| F. oxysporum f. sp. tracheiphilum/Fusarium wilt of aspparagus bean | PM-YHL-F003 | Asparagus bean (Vigna unguiculata) | Taichung city, Taiwan | + | − | − |
| F. oxysporum f. sp. gladioli/Fusarium wilt of gladiolus | PM-YHL-F019 | Gladiolus (Gladiolus alatus) | Taichung city, Taiwan | + | − | − |
| F. oxysporum f. sp. lactucae (Fol)/Fusarium wilt of lettuce (FWL) | PM-YHL-F031 | Lettuce (Lactuca sativa L.) (L) | Yunlin county, Taiwan | + | − | − |
| Fol/FWL | ATCC76616 | L | Texas state, USA | + | − | − |
| F. oxysporum f. sp. lilii/Fusarium wilt of lily | PM-YHL-F035 | Lily (Lilium candidum) | Taichung city, Taiwan | + | − | − |
| F. oxysporum f. sp. lycopersici/Fusarium wilt of tomato | PM-YHL-F042 | Tomato (Solanum lycopersicum) | Taichung city, Taiwan | + | − | − |
| F. oxysporum f. sp. niveum/Fusarium wilt of watermelon | ATCC62940 | Watermelon (Citrullus lanatus) | Texas state, USA | + | − | − |
| F. oxysporum f. sp. cubense (Foc)/Fusarium wilt of banana (FWB) | PM-YJL-F040 | Banana (Musa sp.) (B) | Pingtung city, Taiwan | + | − | − |
| Foc/FWB | ATCC38741 | B | Texas state, USA | + | − | − |
| Foc/FWB | ATCC76243 | B | Texas state, USA | + | − | − |
| Foc/FWB | ATCC96285 | B | Texas state, USA | + | − | − |
| F. oxysporum f. sp. anoectochili/Stem rot of anoectochilus | PM-YHL-F002 | Anoectochilus (Anoectochilus formosanus) | Nantow county, Taiwan | + | − | − |
| F. oxysporum (Fo)/Endophyte | PM-YJL-F056 | M | Taichung city, Taiwan | + | − | − |
| Fo/Saprophyte | PM-TDC-F012 | Soils (S) | Kaohsiung city, Taiwan | + | − | − |
| F. solani/Saprophyte | PM-YJL-F055 | S | Taichung city, Taiwan | + | − | − |
| F. acuminatum/Fusarium blight | PM-YHL-F018 | Bermuda grass (Cynodon dactylon L.) | Taichung city, Taiwan | + | − | − |
| F. verticilliodes/Bakanae disease of rice | PM-YHL-F056 | Rice (Oryza sativa L.) | Taichung city, Taiwan | + | − | − |
| Colletotrichum gloeosporioides (Cg)/Anthracnose of melon | PM-TDC-F013 | M | Pingtung county, Taiwan | + | − | − |
| Cg/Anthracnose of melon | PM-TDC-F014 | M | Pingtung county, Taiwan | + | − | − |
| Alternaria sp./Alternaria leaf spot of melon | PM-TDC-F016 | M | Pingtung county, Taiwan | + | − | − |
| Molecular Detection Assays | Detection Protocols | |||
|---|---|---|---|---|
| Intraday † Mean CVs § (%) | Interday ‡ Mean CVs § (%) | |||
| Commercial DNA extraction kit d | Rapid DNA extraction method e | Commercial DNA extraction kit | Rapid DNA extraction method | |
| Conventional PCR ‖ | ||||
| Fa15F/Fa15R | 56.10 ± 7.14 e¶ | 59.14 ± 1.79 ef | 52.75 ± 2.25 j | 42.31 ± 1.69 i |
| TDCP2F/TDCP2R | 15.59 ± 5.28 c | 63.77 ± 6.56 f | 13.92 ± 3.77 g | 59.39 ± 4.63 k |
| Probe-qPCR | ||||
| Fa15F/Fa15R | 3.87 ± 0.11 a | ND †† | 8.35 ± 5.18 def | ND |
| TDCP2F/TDCP2R | 0.78 ± 0.24 a | 1.74 ± 0.17 a | 1.50 ± 0.37 ab | 0.99 ± 0.03 a |
| Molecular Detection Assays | Ratio of Fom-Inoculated Seeds a (%) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 25 | 10 | 5 | 2.5 | 1 | 0.5 | 0.25 | 0 | P b | N c | |
| Conventional PCR d | ||||||||||
| Fa15F/Fa15R | + e(9/9) | +(9/9) | +(9/9) | +(8/9) | +(7/9) | +(4/9) | +(3/9) | −(0/9) | + | − |
| TDCP2F/TDCP2R | +(9/9) | +(9/9) | +(9/9) | +(7/9) | +(7/9) | +(4/9) | +(3/9) | −(0/9) | + | − |
| Probe-qPCR | ||||||||||
| Fa15F/Fa15R | +(9/9) | +(9/9) | +(9/9) | +(8/9) | +(8/9) | +(7/9) | +(7/9) | −(0/9) | + | − |
| TDCP2F/TDCP2R | +(9/9) | +(9/9) | +(9/9) | +(9/9) | +(9/9) | +(9/9) | +(9/9) | −(0/9) | + | − |
| Molecular Detection Assays | Ratio of Fom-Inoculated Seeds a (%) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 25 | 10 | 5 | 2.5 | 1 | 0.5 | 0.25 | 0 | P b | N c | |
| Conventional PCR d | ||||||||||
| Fa15F/Fa15R | + e(9/9) | +(9/9) | +(9/9) | +(8/9) | +(6/9) | +(2/9) | +(3/9) | −(0/9) | + | − |
| TDCP2F/TDCP2R | +(9/9) | +(9/9) | +(9/9) | +(8/9) | +(5/9) | +(2/9) | +(2/9) | −(0/9) | + | − |
| Probe-qPCR | ||||||||||
| Fa15F/Fa15R | +(1/9) | −(0/9) | −(0/9) | −(0/9) | −(0/9) | −(0/9) | −(0/9) | −(0/9) | + | − |
| TDCP2F/TDCP2R | +(9/9) | +(9/9) | +(9/9) | +(9/9) | +(9/9) | +(9/9) | +(9/9) | −(0/9) | + | − |
| Protocols | Precision a | Recall b | Accuracy c | F1 Score d |
|---|---|---|---|---|
| Fa15F/Fa15 | ||||
| Column DNA extraction protocol_cPCR | 1.000 | 0.778 | 0.806 | 0.875 |
| Column DNA extraction protocol_Probe-qPCR | 1.000 | 0.905 | 0.917 | 0.950 |
| Rapid DNA extraction protocol_cPCR | 1.000 | 0.730 | 0.764 | 0.844 |
| Rapid DNA extraction protocol_Probe-qPCR | 1.000 | 0.016 | 0.139 | 0.031 |
| TDCP2F/TDCP2R | ||||
| Column DNA extraction protocol_cPCR | 1.000 | 0.762 | 0.792 | 0.865 |
| Column DNA extraction protocol_Probe-qPCR | 1.000 | 1.000 | 1.000 | 1.000 |
| Rapid DNA extraction protocol_cPCR | 1.000 | 0.698 | 0.736 | 0.822 |
| Rapid DNA extraction protocol_Probe-qPCR | 1.000 | 1.000 | 1.000 | 1.000 |
| Days after Incubation | Isolation | Molecular Detection | |||
|---|---|---|---|---|---|
| Commercial DNA Extraction Kit | Rapid DNA Extraction Method | ||||
| Fa15 cPCR | TDCP2 Probe-qPCR | Fa15 cPCR | TDCP2 Probe-qPCR | ||
| 0 | − a (0/6) | −(0/6) | +(6/6) | −(0/6) | +(4/6) |
| 1 | +(4/6) | −(0/6) | +(6/6) | −(0/6) | +(5/6) |
| 3 | +(4/6) | −(0/6) | +(6/6) | −(0/6) | +(5/6) |
| 7 | +(4/6) | −(0/6) | +(6/6) | −(0/6) | +(5/6) |
| 14 | +(6/6) | −(0/6) | +(6/6) | −(0/6) | +(6/6) |
| 21 | +(6/6) | −(0/6) | +(6/6) | −(0/6) | +(6/6) |
| Primers Name | Target | Target Gene/Accession Number | Sequences (5’-3’) | Amplicon Size (bp) | Annealing Temperature | Reference |
|---|---|---|---|---|---|---|
| ITS1 | All fungal | Internal transcribed spacer (ITS)/AY188919 | TCCGTAGGTGAACCTGCGG (nt 1–19) | ≈550 | 54 °C | [34] |
| ITS4 | All fungal | ITS/AY188919 | TCCTCCGCTTATTGATATGC (nt 525–544) | |||
| Fa15F | Fusarium oxysporum f. sp. melonis (Fom) | Translation elongation factor 1-α (TEF-1α)/JN183059 | TAGGGATGATAGCGGTCTGG (nt 1–20) | 301 | 60 °C | [19] |
| Fa15R | Fom | Tef-1α/JN183059 | GCTAGTTCGAGGCAATTGGA (nt 282–301) | |||
| TDCP2F a | Fom | Tef-1α/JN183059 | TGGGATGGGAAATACCATGAC (nt 18–38) | 114 | 64 °C | This study |
| TDCP2R a | Fom | Tef-1α/JN183059 | ACTGCCAGTTACGTGGCTTGT (nt 111–131) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chang, T.-D.; Xu, Y.-Z.; Wang, Y.-F.; Wang, X.-R.; Tsai, S.-H.; Wu, Z.-B.; Tzean, Y.; Lin, Y.-H. Development of Rapid Detection Methods for Fusarium oysporum f. sp. melonis in Melon Seeds. Int. J. Mol. Sci. 2024, 25, 5371. https://doi.org/10.3390/ijms25105371
Chang T-D, Xu Y-Z, Wang Y-F, Wang X-R, Tsai S-H, Wu Z-B, Tzean Y, Lin Y-H. Development of Rapid Detection Methods for Fusarium oysporum f. sp. melonis in Melon Seeds. International Journal of Molecular Sciences. 2024; 25(10):5371. https://doi.org/10.3390/ijms25105371
Chicago/Turabian StyleChang, Tsai-De, Ya-Zhen Xu, Yu-Fen Wang, Xing-Ru Wang, Shang-Han Tsai, Zhong-Bin Wu, Yuh Tzean, and Ying-Hong Lin. 2024. "Development of Rapid Detection Methods for Fusarium oysporum f. sp. melonis in Melon Seeds" International Journal of Molecular Sciences 25, no. 10: 5371. https://doi.org/10.3390/ijms25105371
APA StyleChang, T.-D., Xu, Y.-Z., Wang, Y.-F., Wang, X.-R., Tsai, S.-H., Wu, Z.-B., Tzean, Y., & Lin, Y.-H. (2024). Development of Rapid Detection Methods for Fusarium oysporum f. sp. melonis in Melon Seeds. International Journal of Molecular Sciences, 25(10), 5371. https://doi.org/10.3390/ijms25105371

