Functional Characterization of a Spectrum of Genetic Variants in a Family with Succinic Semialdehyde Dehydrogenase Deficiency
Abstract
1. Introduction
2. Results
2.1. SSADH Deficiency Patient Description
2.2. Molecular Characterization of the SSADH Deficiency Patient Variants
2.3. Bioinformatic Analyses of the SSADH Variants
2.4. Spectroscopic and Kinetic Features of the SSADH Variants
2.5. Folding Therapy Approaches for the SSADH Variants
3. Discussion
4. Materials and Methods
4.1. SSADH Deficiency Patient
4.2. Reagents
4.3. Site-Directed Mutagenesis of SSADH Expression Constructs
4.4. Eukaryotic Cell Culture
4.5. Generation of an SSADH-Deficient ALDH5A1 Knockout Flp-InTM-293 Cell Line
4.6. Generation of Stable SSADH Knock-in Cell Lines
4.7. Transient Overexpression
4.8. Treatment of the Cells with Betaine and Hsp-Inducing Agents
4.9. Western Blotting
4.10. SSADH Enzyme Activity
4.11. Immunocytochemistry
4.12. Bioinformatic Analyses
4.13. Expression, Purification, and Enzymatic Assays of the Recombinant SSADH Species
4.14. Spectroscopic Analyses and Determination of the Equilibrium Dissociation Constant for NAD+
4.15. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Didiasova, M.; Banning, A.; Brennenstuhl, H.; Jung-Klawitter, S.; Cinquemani, C.; Opladen, T.; Tikkanen, R. Succinic Semialdehyde Dehydrogenase Deficiency: An Update. Cells 2020, 9, 477. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.H.C.; McGinty, G.E.; Pearl, P.L.; Rotenberg, A. Understanding the Molecular Mechanisms of Succinic Semialdehyde Dehydrogenase Deficiency (SSADHD): Towards the Development of SSADH-Targeted Medicine. Int. J. Mol. Sci. 2022, 23, 2606. [Google Scholar] [CrossRef] [PubMed]
- Gibson, K.M.; Sweetman, L.; Nyhan, W.L.; Jakobs, C.; Rating, D.; Siemes, H.; Hanefeld, F. Succinic semialdehyde dehydrogenase deficiency: An inborn error of gamma-aminobutyric acid metabolism. Clin. Chim. Acta 1983, 133, 33–42. [Google Scholar] [CrossRef] [PubMed]
- Jakobs, C.; Bojasch, M.; Mönch, E.; Rating, D.; Siemes, H.; Hanefeld, F. Urinary excretion of gamma-hydroxybutyric acid in a patient with neurological abnormalities. The probability of a new inborn error of metabolism. Clin. Chim. Acta 1981, 111, 169–178. [Google Scholar] [CrossRef] [PubMed]
- Chambliss, K.L.; Caudle, D.L.; Hinson, D.D.; Moomaw, C.R.; Slaughter, C.A.; Jakobs, C.; Gibson, K.M. Molecular cloning of the mature NAD(+)-dependent succinic semialdehyde dehydrogenase from rat and human. cDNA isolation, evolutionary homology, and tissue expression. J. Biol. Chem. 1995, 270, 461–467. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chambliss, K.L.; Hinson, D.D.; Trettel, F.; Malaspina, P.; Novelletto, A.; Jakobs, C.; Gibson, K.M. Two exon-skipping mutations as the molecular basis of succinic semialdehyde dehydrogenase deficiency (4-hydroxybutyric aciduria). Am. J. Hum. Genet. 1998, 63, 399–408. [Google Scholar] [CrossRef]
- Martin, K.; McConnell, A.; Elsea, S.H. Assessing Prevalence and Carrier Frequency of Succinic Semialdehyde Dehydrogenase Deficiency. J. Child. Neurol. 2021, 36, 1218–1222. [Google Scholar] [CrossRef] [PubMed]
- Tokatly Latzer, I.; Roullet, J.B.; Afshar-Saber, W.; Lee, H.H.C.; Bertoldi, M.; McGinty, G.E.; DiBacco, M.L.; Arning, E.; Tsuboyama, M.; Rotenberg, A.; et al. Clinical and molecular outcomes from the 5-Year natural history study of SSADH Deficiency, a model metabolic neurodevelopmental disorder. J. Neurodev. Disord. 2024, 16, 21. [Google Scholar] [CrossRef]
- Pearl, P.L.; Acosta, M.T.; Theodore, W.H.; Novotny, E.J.; Bennett, H.D. Human SSADH Deficiency–Phenotype and Treatment. In Disease of Neurotransmission: From Bench to Bed; SPS Verlagsgesellschaft: Heilbronn, Germany, 2006. [Google Scholar]
- Pearl, P.L.; Gibson, K.M.; Acosta, M.T.; Vezina, L.G.; Theodore, W.H.; Rogawski, M.A.; Novotny, E.J.; Gropman, A.; Conry, J.A.; Berry, G.T.; et al. Clinical spectrum of succinic semialdehyde dehydrogenase deficiency. Neurology 2003, 60, 1413–1417. [Google Scholar] [CrossRef]
- Pearl, P.L.; Gibson, K.M.; Cortez, M.A.; Wu, Y.; Carter Snead, O., 3rd; Knerr, I.; Forester, K.; Pettiford, J.M.; Jakobs, C.; Theodore, W.H. Succinic semialdehyde dehydrogenase deficiency: Lessons from mice and men. J. Inherit. Metab. Dis. 2009, 32, 343–352. [Google Scholar] [CrossRef]
- Pearl, P.L.; Parviz, M.; Vogel, K.; Schreiber, J.; Theodore, W.H.; Gibson, K.M. Inherited disorders of gamma-aminobutyric acid metabolism and advances in ALDH5A1 mutation identification. Dev. Med. Child. Neurol. 2015, 57, 611–617. [Google Scholar] [CrossRef]
- Didiasova, M.; Banning, A.; Tikkanen, R. Development of precision therapies for rare inborn errors of metabolism: Functional investigations in cell culture models. J. Inherit. Metab. Dis. 2023. online ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Tokatly Latzer, I.; Bertoldi, M.; Blau, N.; DiBacco, M.L.; Elsea, S.H.; Garcia-Cazorla, A.; Gibson, K.M.; Gropman, A.L.; Hanson, E.; Hoffman, C.; et al. Consensus guidelines for the diagnosis and management of succinic semialdehyde dehydrogenase deficiency. Mol. Genet. Metab. 2024, 142, 108363. [Google Scholar] [CrossRef]
- Akaboshi, S.; Hogema, B.M.; Novelletto, A.; Malaspina, P.; Salomons, G.S.; Maropoulos, G.D.; Jakobs, C.; Grompe, M.; Gibson, K.M. Mutational spectrum of the succinate semialdehyde dehydrogenase (ALDH5A1) gene and functional analysis of 27 novel disease-causing mutations in patients with SSADH deficiency. Hum. Mutat. 2003, 22, 442–450. [Google Scholar] [CrossRef]
- Pop, A.; Smith, D.E.C.; Kirby, T.; Walters, D.; Gibson, K.M.; Mahmoudi, S.; van Dooren, S.J.M.; Kanhai, W.A.; Fernandez-Ojeda, M.R.; Wever, E.J.M.; et al. Functional analysis of thirty-four suspected pathogenic missense variants in ALDH5A1 gene associated with succinic semialdehyde dehydrogenase deficiency. Mol. Genet. Metab. 2020, 130, 172–178. [Google Scholar] [CrossRef]
- Tokatly Latzer, I.; Roullet, J.B.; Cesaro, S.; DiBacco, M.L.; Arning, E.; Rotenberg, A.; Lee, H.H.C.; Opladen, T.; Jeltsch, K.; Garcia-Cazorla, A.; et al. Phenotypic correlates of structural and functional protein impairments resultant from ALDH5A1 variants. Hum. Genet. 2023, 142, 1755–1776. [Google Scholar] [CrossRef] [PubMed]
- ClinVar Database. Available online: https://www.ncbi.nlm.nih.gov/clinvar (accessed on 7 March 2024).
- GnomAD Database. Available online: https://gnomad.broadinstitute.org (accessed on 7 March 2024).
- ALDH5A1 Variants GnomAD Database. Available online: https://gnomad.broadinstitute.org/gene/ALDH5A1?dataset=gnomad_r3 (accessed on 7 March 2024).
- Menduti, G.; Biamino, E.; Vittorini, R.; Vesco, S.; Puccinelli, M.P.; Porta, F.; Capo, C.; Leo, S.; Ciminelli, B.M.; Iacovelli, F.; et al. Succinic semialdehyde dehydrogenase deficiency: The combination of a novel ALDH5A1 gene mutation and a missense SNP strongly affects SSADH enzyme activity and stability. Mol. Genet. Metab. 2018, 124, 210–215. [Google Scholar] [CrossRef]
- Brennenstuhl, H.; Didiasova, M.; Assmann, B.; Bertoldi, M.; Molla, G.; Jung-Klawitter, S.; Kuseyri Hubschmann, O.; Schroter, J.; Opladen, T.; Tikkanen, R. Succinic Semialdehyde Dehydrogenase Deficiency: In Vitro and In Silico Characterization of a Novel Pathogenic Missense Variant and Analysis of the Mutational Spectrum of ALDH5A1. Int. J. Mol. Sci. 2020, 21, 8578. [Google Scholar] [CrossRef] [PubMed]
- O’Gorman, S.; Fox, D.T.; Wahl, G.M. Recombinase-mediated gene activation and site-specific integration in mammalian cells. Science 1991, 251, 1351–1355. [Google Scholar] [CrossRef]
- Kim, Y.G.; Lee, S.; Kwon, O.S.; Park, S.Y.; Lee, S.J.; Park, B.J.; Kim, K.J. Redox-switch modulation of human SSADH by dynamic catalytic loop. EMBO J. 2009, 28, 959–968. [Google Scholar] [CrossRef]
- Xiong, P.; Zhang, C.; Zheng, W.; Zhang, Y. BindProfX: Assessing Mutation-Induced Binding Affinity Change by Protein Interface Profiles with Pseudo-Counts. J. Mol. Biol. 2017, 429, 426–434. [Google Scholar] [CrossRef] [PubMed]
- Sehnal, D.; Bittrich, S.; Deshpande, M.; Svobodova, R.; Berka, K.; Bazgier, V.; Velankar, S.; Burley, S.K.; Koca, J.; Rose, A.S. Mol* Viewer: Modern web app for 3D visualization and analysis of large biomolecular structures. Nucleic Acids Res. 2021, 49, W431–W437. [Google Scholar] [CrossRef] [PubMed]
- Murtas, G.; Marcone, G.L.; Peracchi, A.; Zangelmi, E.; Pollegioni, L. Biochemical and Biophysical Characterization of Recombinant Human 3-Phosphoglycerate Dehydrogenase. Int. J. Mol. Sci. 2021, 22, 4231. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, F.E.; Al-Gazali, L.; Al-Jasmi, F.; Ali, B.R. Pharmaceutical Chaperones and Proteostasis Regulators in the Therapy of Lysosomal Storage Disorders: Current Perspective and Future Promises. Front. Pharmacol. 2017, 8, 448. [Google Scholar] [CrossRef]
- Parenti, G.; Andria, G.; Valenzano, K.J. Pharmacological Chaperone Therapy: Preclinical Development, Clinical Translation, and Prospects for the Treatment of Lysosomal Storage Disorders. Mol. Ther. 2015, 23, 1138–1148. [Google Scholar] [CrossRef] [PubMed]
- Parenti, G.; Moracci, M.; Fecarotta, S.; Andria, G. Pharmacological chaperone therapy for lysosomal storage diseases. Future Med. Chem. 2014, 6, 1031–1045. [Google Scholar] [CrossRef]
- Parenti, G.; Pignata, C.; Vajro, P.; Salerno, M. New strategies for the treatment of lysosomal storage diseases (review). Int. J. Mol. Med. 2013, 31, 11–20. [Google Scholar] [CrossRef]
- Banning, A.; Gulec, C.; Rouvinen, J.; Gray, S.J.; Tikkanen, R. Identification of Small Molecule Compounds for Pharmacological Chaperone Therapy of Aspartylglucosaminuria. Sci. Rep. 2016, 6, 37583. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Chen, L.; Jiralerspong, S.; Snowden, A.; Steinberg, S.; Braverman, N. Recovery of PEX1-Gly843Asp peroxisome dysfunction by small-molecule compounds. Proc. Natl. Acad. Sci. USA 2010, 107, 5569–5574. [Google Scholar] [CrossRef]
- Craig, S.A. Betaine in human nutrition. Am. J. Clin. Nutr. 2004, 80, 539–549. [Google Scholar] [CrossRef]
- Pfanner, N.; Warscheid, B.; Wiedemann, N. Mitochondrial proteins: From biogenesis to functional networks. Nat. Rev. Mol. Cell Biol. 2019, 20, 267–284. [Google Scholar] [CrossRef]
- Kirkegaard, T.; Gray, J.; Priestman, D.A.; Wallom, K.-L.; Atkins, J.; Olsen, O.D.; Klein, A.; Drndarski, S.; Petersen, N.H.T.; Ingemann, L.; et al. Heat shock protein-based therapy as a potential candidate for treating the sphingolipidoses. Sci. Transl. Med. 2016, 8, 355ra118. [Google Scholar] [CrossRef]
- Mengel, E.; Patterson, M.C.; Da Riol, R.M.; Del Toro, M.; Deodato, F.; Gautschi, M.; Grunewald, S.; Grønborg, S.; Harmatz, P.; Héron, B.; et al. Efficacy and safety of arimoclomol in Niemann-Pick disease type C: Results from a double-blind, randomised, placebo-controlled, multinational phase 2/3 trial of a novel treatment. J. Inherit. Metab. Dis. 2021, 44, 1463–1480. [Google Scholar] [CrossRef]
- Mu, T.-W.; Ong, D.S.T.; Wang, Y.-J.; Balch, W.E.; Yates, J.R.; Segatori, L.; Kelly, J.W. Chemical and biological approaches synergize to ameliorate protein-folding diseases. Cell 2008, 134, 769–781. [Google Scholar] [CrossRef]
- Hargitai, J.; Lewis, H.; Boros, I.; Racz, T.; Fiser, A.; Kurucz, I.; Benjamin, I.; Vigh, L.; Penzes, Z.; Csermely, P.; et al. Bimoclomol, a heat shock protein co-inducer, acts by the prolonged activation of heat shock factor-1. Biochem. Biophys. Res. Commun. 2003, 307, 689–695. [Google Scholar] [CrossRef]
- Kalmar, B.; Novoselov, S.; Gray, A.; Cheetham, M.E.; Margulis, B.; Greensmith, L. Late stage treatment with arimoclomol delays disease progression and prevents protein aggregation in the SOD1 mouse model of ALS. J. Neurochem. 2008, 107, 339–350. [Google Scholar] [CrossRef]
- Kieran, D.; Kalmar, B.; Dick, J.R.; Riddoch-Contreras, J.; Burnstock, G.; Greensmith, L. Treatment with arimoclomol, a coinducer of heat shock proteins, delays disease progression in ALS mice. Nat. Med. 2004, 10, 402–405. [Google Scholar] [CrossRef]
- Morimoto, R.I. Regulation of the heat shock transcriptional response: Cross talk between a family of heat shock factors, molecular chaperones, and negative regulators. Genes. Dev. 1998, 12, 3788–3796. [Google Scholar] [CrossRef]
- Vigh, L.; Literati, P.N.; Horvath, I.; Torok, Z.; Balogh, G.; Glatz, A.; Kovacs, E.; Boros, I.; Ferdinandy, P.; Farkas, B.; et al. Bimoclomol: A nontoxic, hydroxylamine derivative with stress protein-inducing activity and cytoprotective effects. Nat. Med. 1997, 3, 1150–1154. [Google Scholar] [CrossRef]
- Westerheide, S.D.; Bosman, J.D.; Mbadugha, B.N.; Kawahara, T.L.; Matsumoto, G.; Kim, S.; Gu, W.; Devlin, J.P.; Silverman, R.B.; Morimoto, R.I. Celastrols as inducers of the heat shock response and cytoprotection. J. Biol. Chem. 2004, 279, 56053–56060. [Google Scholar] [CrossRef]
- Petrovic, A.; Kaur, J.; Tomljanovic, I.; Nistri, A.; Mladinic, M. Pharmacological induction of Heat Shock Protein 70 by celastrol protects motoneurons from excitotoxicity in rat spinal cord in vitro. Eur. J. Neurosci. 2019, 49, 215–231. [Google Scholar] [CrossRef]
- Parfitt, D.A.; Aguila, M.; McCulley, C.H.; Bevilacqua, D.; Mendes, H.F.; Athanasiou, D.; Novoselov, S.S.; Kanuga, N.; Munro, P.M.; Coffey, P.J.; et al. The heat-shock response co-inducer arimoclomol protects against retinal degeneration in rhodopsin retinitis pigmentosa. Cell Death Dis. 2014, 5, e1236. [Google Scholar] [CrossRef]
- Paimela, T.; Hyttinen, J.M.; Viiri, J.; Ryhanen, T.; Karjalainen, R.O.; Salminen, A.; Kaarniranta, K. Celastrol regulates innate immunity response via NF-kappaB and Hsp70 in human retinal pigment epithelial cells. Pharmacol. Res. 2011, 64, 501–508. [Google Scholar] [CrossRef]
- Ciocca, D.R.; Calderwood, S.K. Heat shock proteins in cancer: Diagnostic, prognostic, predictive, and treatment implications. Cell Stress. Chaperones 2005, 10, 86–103. [Google Scholar] [CrossRef]
- Soderstrom, H.K.; Kauppi, J.T.; Oksala, N.; Paavonen, T.; Krogerus, L.; Rasanen, J.; Rantanen, T. Overexpression of HSP27 and HSP70 is associated with decreased survival among patients with esophageal adenocarcinoma. World J. Clin. Cases 2019, 7, 260–269. [Google Scholar] [CrossRef]
- Mussche, S.; Devreese, B.; Nagabhushan Kalburgi, S.; Bachaboina, L.; Fox, J.C.; Shih, H.J.; Van Coster, R.; Samulski, R.J.; Gray, S.J. Restoration of cytoskeleton homeostasis after gigaxonin gene transfer for giant axonal neuropathy. Hum. Gene Ther. 2013, 24, 209–219. [Google Scholar] [CrossRef]
- E-Crispr Tool. Available online: http://www.e-crisp.org (accessed on 23 April 2021).
- Consurf Server. Available online: https://consurf.tau.ac.il (accessed on 23 July 2023).
- Micsonai, A.; Moussong, E.; Wien, F.; Boros, E.; Vadaszi, H.; Murvai, N.; Lee, Y.H.; Molnar, T.; Refregiers, M.; Goto, Y.; et al. BeStSel: Webserver for secondary structure and fold prediction for protein CD spectroscopy. Nucleic Acids Res. 2022, 50, W90–W98. [Google Scholar] [CrossRef]
Substitution | Sequence |
---|---|
Val90Ala | F: CGCTCTGGGCATGGCAGCCGACTGCGGGG R: CCCCGCAGTCGGCTGCCATGCCCAGAGCG |
Cys93Phe | F: GGGCATGGTAGCCGACTTCGGGGTGCG R: CGCACCCCGAAGTCGGCTACCATGCCC |
His180Tyr | F: GTGTTTACGGAGACATTATCTACACCCCGGCAAAG R: CTTTGCCGGGGTGTAGATAATGTCTCCGTAAACAC |
Asn255Asp | F: GATTCCTTCAGGTGTATACGATGTTATTCCCTGTTCTCG R: CGAGAACAGGGAATAACATCGTATACACCTGAAGGAATC |
Substitution | Sequence |
---|---|
Val90Ala | F: GCTGGGCATGGCTGCGGATTGCGGTG R: CACCGCAATCCGCAGCCATGCCCAGC |
Cys93Phe | F: GCATGGTTGCGGATTTCGGTGTTCGTGAAGC R: GCTTCACGAACACCGAAATCCGCAACCATGC |
His180Tyr | F: GTTTATGGTGACATCATTTACACCCCGGCGAAGG R: CCTTCGCCGGGGTGTAAATGATGTCACCATAAAC |
Asn255Asp | F: GCGGCGTTTACGACGTGATTCCGTGCAG R: CTGCACGGAATCACGTCGTAAACGCCGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Didiasova, M.; Cesaro, S.; Feldhoff, S.; Bettin, I.; Tiegel, N.; Füssgen, V.; Bertoldi, M.; Tikkanen, R. Functional Characterization of a Spectrum of Genetic Variants in a Family with Succinic Semialdehyde Dehydrogenase Deficiency. Int. J. Mol. Sci. 2024, 25, 5237. https://doi.org/10.3390/ijms25105237
Didiasova M, Cesaro S, Feldhoff S, Bettin I, Tiegel N, Füssgen V, Bertoldi M, Tikkanen R. Functional Characterization of a Spectrum of Genetic Variants in a Family with Succinic Semialdehyde Dehydrogenase Deficiency. International Journal of Molecular Sciences. 2024; 25(10):5237. https://doi.org/10.3390/ijms25105237
Chicago/Turabian StyleDidiasova, Miroslava, Samuele Cesaro, Simon Feldhoff, Ilaria Bettin, Nana Tiegel, Vera Füssgen, Mariarita Bertoldi, and Ritva Tikkanen. 2024. "Functional Characterization of a Spectrum of Genetic Variants in a Family with Succinic Semialdehyde Dehydrogenase Deficiency" International Journal of Molecular Sciences 25, no. 10: 5237. https://doi.org/10.3390/ijms25105237
APA StyleDidiasova, M., Cesaro, S., Feldhoff, S., Bettin, I., Tiegel, N., Füssgen, V., Bertoldi, M., & Tikkanen, R. (2024). Functional Characterization of a Spectrum of Genetic Variants in a Family with Succinic Semialdehyde Dehydrogenase Deficiency. International Journal of Molecular Sciences, 25(10), 5237. https://doi.org/10.3390/ijms25105237