Oleuropein Stimulates Migration of Human Trophoblast Cells and Expression of Invasion-Associated Markers
Abstract
1. Introduction
2. Results
2.1. Viability of Oleuropein Treated HTR-8/SVneo Cells Determined by Crystal Violet Assay
2.2. Effects of Oleuropein on the Proliferation of HTR-8/SVneo Cells
2.3. Effect of Oleuropein on the Substrate-Dependent Adhesion of HTR-8/SVneo Cells to Plastic, Collagen and Matrigel
2.4. Effect of Oleuropein on the Relative mRNA Expression of Matrix Metalloproteinases 2 and 9 and Integrin Subunits α1, α5 and β1 in HTR-8/SVneo Cells
2.5. Effect of Oleuropein on the Expression of Integrin Subunits α1 and β1 in HTR-8/SVneo Cells at the Protein Level
2.6. Effect of Oleuropein on the Expression of Cyclooxygenase 2 in HTR-8/SVneo Cells at the Protein Level
2.7. Effect of Oleuropein on JNK Signaling Pathway in HTR-8/SVneo Cells
2.8. Effect of Oleuropein on HTR-8/SVneo Cell Migration
3. Discussion
4. Materials and Methods
4.1. Cell Line
4.2. Preparation of Oleuropein for Cell Treatment
4.3. Cell Viability Assay
4.4. Cell Proliferation Assay
4.5. Functional Test of Cell Adhesion In Vitro
4.6. Cell Migration Assay
4.7. Determination of Gene Expression Using the Quantitative Real-Time PCR Method
MMP2 F: TGCGACCACAGCCAACTACG MMP2 R: ACAGACGGAAGTTCTTGGTGTAGG |
MMP9 F: TGACAGCGACAAGAAGTG MMP9 R: CAGTGAAGCGGTACATAGG |
ITGA1 F: GGTTCCTACTTTGGCAGTATT ITGA1 R: AACCTTGTCTGATTGAGAGCA |
ITGA5 F: GGCAGCTATGGCGTCCCACTGTGG ITGA5 R: GGCATCAGAGGTGGCTGGAGGCTT |
ITGB1 F: GTGGTTGCTGGAATTGTTCTTATT ITGB1 R: TTTTCCCTCATACTTCGGATTGAC |
GAPDH F: GAAGGTGAAGGTCGGAGT GAPDH R: GAAGATGGTGATGGGATTTC |
4.8. Western Blot Protein Analysis
4.9. Determination of Protein Expression Using the CELISA (CELL-BASED ELISA) Method
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Huang, C.-C.; Hsueh, Y.-W.; Chang, C.-W.; Hsu, H.-C.; Yang, T.-C.; Lin, W.-C.; Chang, H.-M. Establishment of the Fetal-Maternal Interface: Developmental Events in Human Implantation and Placentation. Front. Cell Dev. Biol. 2023, 11, 1200330. [Google Scholar] [CrossRef] [PubMed]
- Knöfler, M.; Haider, S.; Saleh, L.; Pollheimer, J.; Gamage, T.K.J.B.; James, J. Human Placenta and Trophoblast Development: Key Molecular Mechanisms and Model Systems. Cell. Mol. Life Sci. 2019, 76, 3479–3496. [Google Scholar] [CrossRef] [PubMed]
- Lawless, L.; Qin, Y.; Xie, L.; Zhang, K. Trophoblast Differentiation: Mechanisms and Implications for Pregnancy Complications. Nutrients 2023, 15, 3564. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Guo, Y.; Yang, Y.; Du, Z.; Fan, Y.; Zhao, Y.; Yuan, S. Oxidative Stress on Vessels at the Maternal-Fetal Interface for Female Reproductive System Disorders: Update. Front. Endocrinol. 2023, 14, 1118121. [Google Scholar] [CrossRef] [PubMed]
- Hussain, T.; Murtaza, G.; Metwally, E.; Kalhoro, D.H.; Kalhoro, M.S.; Rahu, B.A.; Sahito, R.G.A.; Yin, Y.; Yang, H.; Chughtai, M.I.; et al. The Role of Oxidative Stress and Antioxidant Balance in Pregnancy. Mediators Inflamm. 2021, 2021, 9962860. [Google Scholar] [CrossRef] [PubMed]
- Nacka-Aleksić, M.; Pirković, A.; Vilotić, A.; Bojić-Trbojević, Ž.; Jovanović Krivokuća, M.; Giampieri, F.; Battino, M.; Dekanski, D. The Role of Dietary Polyphenols in Pregnancy and Pregnancy-Related Disorders. Nutrients 2022, 14, 5246. [Google Scholar] [CrossRef] [PubMed]
- Prins, J.R.; Schoots, M.H.; Wessels, J.I.; Campmans-Kuijpers, M.J.E.; Navis, G.J.; van Goor, H.; Robertson, S.A.; van der Beek, E.M.; Sobrevia, L.; Gordijn, S.J. The Influence of the Dietary Exposome on Oxidative Stress in Pregnancy Complications. Mol. Asp. Med. 2022, 87, 101098. [Google Scholar] [CrossRef]
- Reijnders, I.F.; Mulders, A.G.M.G.J.; van der Windt, M.; Steegers, E.A.P.; Steegers-Theunissen, R.P.M. The Impact of Periconceptional Maternal Lifestyle on Clinical Features and Biomarkers of Placental Development and Function: A Systematic Review. Hum. Reprod. Update 2019, 25, 72–94. [Google Scholar] [CrossRef]
- Woods, L.; Perez-Garcia, V.; Hemberger, M. Regulation of Placental Development and Its Impact on Fetal Growth—New Insights From Mouse Models. Front. Endocrinol. 2018, 9, 570. [Google Scholar] [CrossRef]
- Rouissi, M.; Jean-Denis, F.; Belan, M.; Baillargeon, J.-P. A Preconception lifestyle intervention improves some gestational outcomes and neonatal markers of adiposity in women with obesity and infertility. Fertil. Steril. 2020, 114, e466–e467. [Google Scholar] [CrossRef]
- Belan, M.; Carranza-Mamane, B.; AinMelk, Y.; Pesant, M.-H.; Duval, K.; Jean-Denis, F.; Langlois, M.-F.; Lavoie, H.; Waddell, G.; Baillargeon, J.-P. A Lifestyle Intervention Targeting Women with Obesity and Infertility Improves Their Fertility Outcomes, Especially in Women with PCOS: A Randomized Controlled Trial. Fertil. Steril. 2019, 112, e40. [Google Scholar] [CrossRef]
- Amati, F.; Hassounah, S.; Swaka, A. The Impact of Mediterranean Dietary Patterns During Pregnancy on Maternal and Offspring Health. Nutrients 2019, 11, 1098. [Google Scholar] [CrossRef] [PubMed]
- Suárez-Martínez, C.; Yagüe-Guirao, G.; Santaella-Pascual, M.; Peso-Echarri, P.; Vioque, J.; Morales, E.; García-Marcos, L.; Martínez-Graciá, C. Adherence to the Mediterranean Diet and Determinants among Pregnant Women: The NELA Cohort. Nutrients 2021, 13, 1248. [Google Scholar] [CrossRef] [PubMed]
- Suresh, K. Nutriepigenomics: Need of the Day to Integrate Genetics, Epigenetics and Environment towards Nutritious Food for Healthy Life. Food Sci. Nutr. Technol. 2020, 5, 1–13. [Google Scholar] [CrossRef]
- Banaszewska, B.; Wrotyńska-Barczyńska, J.; Spaczynski, R.Z.; Pawelczyk, L.; Duleba, A.J. Effects of Resveratrol on Polycystic Ovary Syndrome: A Double-Blind, Randomized, Placebo-Controlled Trial. J. Clin. Endocrinol. Metab. 2016, 101, 4322–4328. [Google Scholar] [CrossRef] [PubMed]
- Summerhill, V.; Karagodin, V.; Grechko, A.; Myasoedova, V.; Orekhov, A. Vasculoprotective Role of Olive Oil Compounds via Modulation of Oxidative Stress in Atherosclerosis. Front. Cardiovasc. Med. 2018, 5, 188. [Google Scholar] [CrossRef] [PubMed]
- Pojero, F.; Aiello, A.; Gervasi, F.; Caruso, C.; Ligotti, M.E.; Calabrò, A.; Procopio, A.; Candore, G.; Accardi, G.; Allegra, M. Effects of Oleuropein and Hydroxytyrosol on Inflammatory Mediators: Consequences on Inflammaging. Int. J. Mol. Sci. 2022, 24, 380. [Google Scholar] [CrossRef]
- Deckmann, I.; Santos-Terra, J.; Martel, F.; Vieira Carletti, J. Common Pregnancy Complications and Polyphenols Intake: An Overview. Crit. Rev. Food Sci. Nutr. 2023, 3, 1–34. [Google Scholar] [CrossRef]
- Ahamad, J.; Toufeeq, I.; Khan, M.A.; Ameen, M.S.M.; Anwer, E.T.; Uthirapathy, S.; Mir, S.R.; Ahmad, J. Oleuropein: A Natural Antioxidant Molecule in the Treatment of Metabolic Syndrome. Phyther. Res. 2019, 33, 3112–3128. [Google Scholar] [CrossRef]
- Sun, W.; Frost, B.; Liu, J. Oleuropein, Unexpected Benefits! Oncotarget 2017, 8, 17409. [Google Scholar] [CrossRef]
- Romero-Márquez, J.M.; Forbes-Hernández, T.Y.; Navarro-Hortal, M.D.; Quirantes-Piné, R.; Grosso, G.; Giampieri, F.; Lipari, V.; Sánchez-González, C.; Battino, M.; Quiles, J.L. Molecular Mechanisms of the Protective Effects of Olive Leaf Polyphenols against Alzheimer’s Disease. Int. J. Mol. Sci. 2023, 24, 4353. [Google Scholar] [CrossRef] [PubMed]
- Barbaro, B.; Toietta, G.; Maggio, R.; Arciello, M.; Tarocchi, M.; Galli, A.; Balsano, C. Effects of the Olive-Derived Polyphenol Oleuropein on Human Health. Int. J. Mol. Sci. 2014, 15, 18508–18524. [Google Scholar] [CrossRef]
- Park, Y.; Cho, Y.J.; Sung, N.; Park, M.J.; Guan, X.; Gibbons, W.E.; O’Malley, B.W.; Han, S.J. Oleuropein Suppresses Endometriosis Progression and Improves the Fertility of Mice with Endometriosis. J. Biomed. Sci. 2022, 29, 100. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Zhao, H.; Wang, A. Oleuropein Alleviates Gestational Diabetes Mellitus by Activating AMPK Signaling. Endocr. Connect. 2021, 10, 45–53. [Google Scholar] [CrossRef] [PubMed]
- Pirković, A.; Vilotić, A.; Borozan, S.; Nacka-Aleksić, M.; Bojić-Trbojević, Ž.; Krivokuća, M.J.; Battino, M.; Giampieri, F.; Dekanski, D. Oleuropein Attenuates Oxidative Stress in Human Trophoblast Cells. Antioxidants 2023, 12, 197. [Google Scholar] [CrossRef] [PubMed]
- Jung, K.-Y.; Uprety, L.P.; Jang, Y.-J.; Yang, J.I. Pro-Inflammatory Mediators and Signaling Proteins in the Decidua of Pre-Eclampsia. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 12016–12024. [Google Scholar] [CrossRef] [PubMed]
- Ozmen, A.; Guzeloglu-Kayisli, O.; Tabak, S.; Guo, X.; Semerci, N.; Nwabuobi, C.; Larsen, K.; Wells, A.; Uyar, A.; Arlier, S.; et al. Preeclampsia Is Associated With Reduced ISG15 Levels Impairing Extravillous Trophoblast Invasion. Front. Cell Dev. Biol. 2022, 10, 898088. [Google Scholar] [CrossRef] [PubMed]
- Yi, Y.; Cheng, J.-C.; Klausen, C.; Leung, P.C.K. TGF-Β1 Inhibits Human Trophoblast Cell Invasion by Upregulating Cyclooxygenase-2. Placenta 2018, 68, 44–51. [Google Scholar] [CrossRef]
- Weiss, G.; Sundl, M.; Glasner, A.; Huppertz, B.; Moser, G. The Trophoblast Plug during Early Pregnancy: A Deeper Insight. Histochem. Cell Biol. 2016, 146, 749–756. [Google Scholar] [CrossRef]
- Zhang, S.; Mesalam, A.; Joo, M.-D.; Lee, K.-L.; Hwang, J.-Y.; Xu, L.; Song, S.-H.; Koh, P.-O.; Yuan, Y.-G.; Lv, W.; et al. Matrix Metalloproteinases Improves Trophoblast Invasion and Pregnancy Potential in Mice. Theriogenology 2020, 151, 144–150. [Google Scholar] [CrossRef]
- Bischoff, P.; Meisser, A.; Campana, A. Paracrine and Autocrine Regulators of Trophoblast Invasion—A Review. Placenta 2000, 21, S55–S60. [Google Scholar] [CrossRef] [PubMed]
- Neale, D.; Demasio, K.; Illuzi, J.; Chaiworapongsa, T.; Romero, R.; Mor, G. Maternal Serum of Women with Pre-Eclampsia Reduces Trophoblast Cell Viability: Evidence for an Increased Sensitivity to Fas-Mediated Apoptosis. J. Matern. Neonatal Med. 2003, 13, 39–44. [Google Scholar] [CrossRef] [PubMed]
- Jena, M.K.; Sharma, N.R.; Petitt, M.; Maulik, D.; Nayak, N.R. Pathogenesis of Preeclampsia and Therapeutic Approaches Targeting the Placenta. Biomolecules 2020, 10, 953. [Google Scholar] [CrossRef] [PubMed]
- Kaufmann, P.; Black, S.; Huppertz, B. Endovascular Trophoblast Invasion: Implications for the Pathogenesis of Intrauterine Growth Retardation and Preeclampsia. Biol. Reprod. 2003, 69, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, I.; Dhar, R.; Singh, S.; Sharma, J.B.; Nag, T.C.; Mridha, A.R.; Jaiswal, P.; Biswas, S.; Karmakar, S. Oxidative Stress-Induced Impairment of Trophoblast Function Causes Preeclampsia through the Unfolded Protein Response Pathway. Sci. Rep. 2021, 11, 18415. [Google Scholar] [CrossRef] [PubMed]
- Bolnick, A.D.; Bolnick, J.M.; Kohan-Ghadr, H.-R.; Kilburn, B.A.; Pasalodos, O.J.; Singhal, P.K.; Dai, J.; Diamond, M.P.; Armant, D.R.; Drewlo, S. Enhancement of Trophoblast Differentiation and Survival by Low Molecular Weight Heparin Requires Heparin-Binding EGF-like Growth Factor. Hum. Reprod. 2017, 32, 1218–1229. [Google Scholar] [CrossRef] [PubMed]
- Zou, Y.; Zuo, Q.; Huang, S.; Yu, X.; Jiang, Z.; Zou, S.; Fan, M.; Sun, L. Resveratrol Inhibits Trophoblast Apoptosis through Oxidative Stress in Preeclampsia-Model Rats. Molecules 2014, 19, 20570–20579. [Google Scholar] [CrossRef] [PubMed]
- Khera, A.; Vanderlelie, J.J.; Holland, O.; Perkins, A.V. Overexpression of Endogenous Anti-Oxidants with Selenium Supplementation Protects Trophoblast Cells from Reactive Oxygen Species-Induced Apoptosis in a Bcl-2-Dependent Manner. Biol. Trace Elem. Res. 2017, 177, 394–403. [Google Scholar] [CrossRef]
- Tannetta, D.S.; Sargent, I.L.; Linton, E.A.; Redman, C.W.G. Vitamins C and E Inhibit Apoptosis of Cultured Human Term Placenta Trophoblast. Placenta 2008, 29, 680–690. [Google Scholar] [CrossRef]
- Guo, X.; Dilidaxi, D.; Li, L.; Wang, C.; Ma, X.; Sang, F.; Pei, G.; Li, W. Aspirin Protects Human Trophoblast HTR-8/SVneo Cells from H2O2-Induced Oxidative Stress via NADPH/ROS Pathway. Placenta 2023, 144, 55–63. [Google Scholar] [CrossRef]
- Merino-Casallo, F.; Gomez-Benito, M.J.; Hervas-Raluy, S.; Garcia-Aznar, J.M. Unravelling Cell Migration: Defining Movement from the Cell Surface. Cell Adh. Migr. 2022, 16, 25–64. [Google Scholar] [CrossRef] [PubMed]
- Kisanga, E.P.; Tang, Z.; Guller, S.; Whirledge, S. In Vitro Assays to Evaluate the Migration, Invasion, and Proliferation of Immortalized Human First-Trimester Trophoblast Cell Lines. J. Vis. Exp. 2019, 145, e58942. [Google Scholar] [CrossRef]
- Moran, J.M.; Leal-Hernandez, O.; Canal-Macías, M.L.; Roncero-Martin, R.; Guerrero-Bonmatty, R.; Aliaga, I.; Zamorano, J.D.P. Antiproliferative Properties of Oleuropein in Human Osteosarcoma Cells. Nat. Prod. Commun. 2016, 11, 1934578X1601100. [Google Scholar] [CrossRef]
- Bossio, S.; Perri, A.; Malivindi, R.; Giordano, F.; Rago, V.; Mirabelli, M.; Salatino, A.; Brunetti, A.; Greco, E.A.; Aversa, A. Oleuropein Counteracts Both the Proliferation and Migration of Intra- and Extragonadal Seminoma Cells. Nutrients 2022, 14, 2323. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Wang, J.; Huang, B.; Chen, A.; Li, X. Oleuropein Inhibits the Proliferation and Invasion of Glioma Cells via Suppression of the AKT Signaling Pathway. Oncol. Rep. 2016, 36, 2009–2016. [Google Scholar] [CrossRef]
- Soundararajan, R.; Rao, A.J. Trophoblast “Pseudo-Tumorigenesis”: Significance and Contributory Factors. Reprod. Biol. Endocrinol. 2004, 2, 15. [Google Scholar] [CrossRef]
- Ferretti, C.; Bruni, L.; Dangles-Marie, V.; Pecking, A.P.; Bellet, D. Molecular Circuits Shared by Placental and Cancer Cells, and Their Implications in the Proliferative, Invasive and Migratory Capacities of Trophoblasts. Hum. Reprod. Update 2006, 13, 121–141. [Google Scholar] [CrossRef]
- Touihri-Barakati, I.; Kallech-Ziri, O.; Morjen, M.; Marrakchi, N.; Luis, J.; Hosni, K. Inhibitory Effect of Phenolic Extract from Squirting Cucumber (Ecballium elaterium (L.) A. Rich) Seed Oil on Integrin-Mediated Cell Adhesion, Migration and Angiogenesis. RSC Adv. 2022, 12, 31747–31756. [Google Scholar] [CrossRef]
- Ebegboni, V.J.; Balahmar, R.M.; Dickenson, J.M.; Sivasubramaniam, S.D. The Effects of Flavonoids on Human First Trimester Trophoblast Spheroidal Stem Cell Self-Renewal, Invasion and JNK/P38 MAPK Activation: Understanding the Cytoprotective Effects of These Phytonutrients against Oxidative Stress. Biochem. Pharmacol. 2019, 164, 289–298. [Google Scholar] [CrossRef]
- Fiaschi, T.; Cozzi, G.; Raugei, G.; Formigli, L.; Ramponi, G.; Chiarugi, P. Redox Regulation of β-Actin during Integrin-Mediated Cell Adhesion. J. Biol. Chem. 2006, 281, 22983–22991. [Google Scholar] [CrossRef]
- Zhou, J.; Chen, Y.; Lang, J.-Y.; Lu, J.-J.; Ding, J. Salvicine Inactivates Β1 Integrin and Inhibits Adhesion of MDA-MB-435 Cells to Fibronectin via Reactive Oxygen Species Signaling. Mol. Cancer Res. 2008, 6, 194–204. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, I.; Biswas, S.; Singh, S.; Talukdar, J.; Alqahtani, M.S.; Abbas, M.; Nag, T.C.; Mridha, A.R.; Gupta, S.; Sharma, J.B.; et al. Monosodium Glutamate Perturbs Human Trophoblast Invasion and Differentiation through a Reactive Oxygen Species-Mediated Pathway: An In-Vitro Assessment. Antioxidants 2023, 12, 634. [Google Scholar] [CrossRef] [PubMed]
- Johnson, G.L.; Nakamura, K. The C-Jun Kinase/Stress-Activated Pathway: Regulation, Function and Role in Human Disease. Biochim. Biophys. Acta—Mol. Cell Res. 2007, 1773, 1341–1348. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Liu, T.; Zhang, A.; Huo, X.; Luo, Q.; Chen, Z.; Yu, L.; Li, Q.; Liu, L.; Lun, Z.; et al. Reactive Oxygen Species-Triggered Trophoblast Apoptosis Is Initiated by Endoplasmic Reticulum Stress via Activation of Caspase-12, CHOP, and the JNK Pathway in Toxoplasma Gondii Infection in Mice. Infect. Immun. 2012, 80, 2121–2132. [Google Scholar] [CrossRef]
- Cindrova-Davies, T.; Spasic-Boskovic, O.; Jauniaux, E.; Charnock-Jones, D.S.; Burton, G.J. Nuclear Factor-ΚB, P38, and Stress-Activated Protein Kinase Mitogen-Activated Protein Kinase Signaling Pathways Regulate Proinflammatory Cytokines and Apoptosis in Human Placental Explants in Response to Oxidative Stress. Am. J. Pathol. 2007, 170, 1511–1520. [Google Scholar] [CrossRef]
- Bačenková, D.; Trebuňová, M.; Čížková, D.; Hudák, R.; Dosedla, E.; Findrik-Balogová, A.; Živčák, J. In Vitro Model of Human Trophoblast in Early Placentation. Biomedicines 2022, 10, 904. [Google Scholar] [CrossRef]
- Bachawaty, T.; Washington, S.L.; Walsh, S.W. Neutrophil Expression of Cyclooxygenase 2 in Preeclampsia. Reprod. Sci. 2010, 17, 465–470. [Google Scholar] [CrossRef][Green Version]
- Adu-Gyamfi, E.A.; Ding, Y.-B.; Wang, Y.-X. Regulation of Placentation by the Transforming Growth Factor Beta Superfamily†. Biol. Reprod. 2020, 102, 18–26. [Google Scholar] [CrossRef]
- Yamada, N.; Matsushima-Nishiwaki, R.; Masue, A.; Taguchi, K.; Kozawa, O. Olive Oil Polyphenols Suppress the TGF-α-induced Migration of Hepatocellular Carcinoma Cells. Biomed. Rep. 2019, 11, 19–26. [Google Scholar] [CrossRef]
- Han, S.; Hou, H.; Zhang, Y.; Fang, Z.; Li, Y.; Zhang, L.; Wang, Y.; Zhang, S.; Zhang, H.; Jin, Q.; et al. Oleuropein and Its Hydrolysate from Extra Virgin Olive Oil Inhibit Breast Cancer Cells Proliferation Interfering with the PI3K-AKT Signal Pathway. J. Funct. Foods 2023, 110, 105880. [Google Scholar] [CrossRef]
- Erdoğan, İ.; Bayraktar, O.; Uslu, M.E.; Tuncel, Ö. Wound Healing Effects of Various Fractions of Olive Leaf Extract (OLE) on Mouse Fibroblasts. Rom. Biotechnol. Lett. 2018. [Google Scholar] [CrossRef]
- Utami, N.D.; Nordin, A.; Katas, H.; Bt Hj Idrus, R.; Fauzi, M.B. Molecular Action of Hydroxytyrosol in Wound Healing: An In Vitro Evidence-Based Review. Biomolecules 2020, 10, 1397. [Google Scholar] [CrossRef] [PubMed]
- Zrelli, H.; Kusunoki, M.; Miyazaki, H. Role of Hydroxytyrosol-dependent Regulation of HO-1 Expression in Promoting Wound Healing of Vascular Endothelial Cells via Nrf2 de novo Synthesis and Stabilization. Phyther. Res. 2015, 29, 1011–1018. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Qu, Z.; Fu, X.; Jiang, Q.; Fei, J. Hydroxytyrosol Contributes to Cell Proliferation and Inhibits Apoptosis in Pulsed Electromagnetic Fields Treated Human Umbilical Vein Endothelial Cells in vitro. Mol. Med. Rep. 2017, 16, 8826–8832. [Google Scholar] [CrossRef] [PubMed]
- Wätjen, W.; Michels, G.; Steffan, B.; Niering, P.; Chovolou, Y.; Kampkötter, A.; Tran-Thi, Q.-H.; Proksch, P.; Kahl, R. Low Concentrations of Flavonoids Are Protective in Rat H4IIE Cells Whereas High Concentrations Cause DNA Damage and Apoptosis. J. Nutr. 2005, 135, 525–531. [Google Scholar] [CrossRef]
- Kyselova, Z. Toxicological Aspects of the Use of Phenolic Compounds in Disease Prevention. Interdiscip. Toxicol. 2011, 4, 173–183. [Google Scholar] [CrossRef]
- Scicchitano, S.; Vecchio, E.; Battaglia, A.M.; Oliverio, M.; Nardi, M.; Procopio, A.; Costanzo, F.; Biamonte, F.; Faniello, M.C. The Double-Edged Sword of Oleuropein in Ovarian Cancer Cells: From Antioxidant Functions to Cytotoxic Effects. Int. J. Mol. Sci. 2023, 24, 842. [Google Scholar] [CrossRef]
- Bruić, M.; Pirković, A.; Vilotić, A.; Jovanović-Krivokuća, M.; Spremo-Potparević, B. Cytoprotective and Genoprotective Effects of Taxifolin against Oxidative Damage in HTR-8/SVneo Human Trophoblast Cells. Mutagenesis 2022, 38, 64–70. [Google Scholar] [CrossRef]
- Huang, H.-L.; Yang, H.-L.; Lai, Z.-Z.; Yang, S.-L.; Li, M.-Q.; Li, D.-J. Decidual IDO+ Macrophage Promotes the Proliferation and Restricts the Apoptosis of Trophoblasts. J. Reprod. Immunol. 2021, 148, 103364. [Google Scholar] [CrossRef]
- Hyytiäinen, M.; Keski-Oja, J. Latent TGF-β Binding Protein LTBP-2 Decreases Fibroblast Adhesion to Fibronectin. J. Cell Biol. 2003, 163, 1363–1374. [Google Scholar] [CrossRef]
- Liu, C.; Liu, X.; Yang, N.; Wang, Q. Quercetin Inhibits the Expression of MiRNA-155 and Improves the Functions of Lipopolysaccharide-Induced Human Extravillous. Food Sci. Technol. 2022, 42, e92221. [Google Scholar] [CrossRef]
- Jovanović, M.; Vićovac, L. Interleukin-6 Stimulates Cell Migration, Invasion and Integrin Expression in HTR-8/SVneo Cell Line. Placenta 2009, 30, 320–328. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pirković, A.; Jovanović Krivokuća, M.; Vilotić, A.; Nacka-Aleksić, M.; Bojić-Trbojević, Ž.; Dekanski, D. Oleuropein Stimulates Migration of Human Trophoblast Cells and Expression of Invasion-Associated Markers. Int. J. Mol. Sci. 2024, 25, 500. https://doi.org/10.3390/ijms25010500
Pirković A, Jovanović Krivokuća M, Vilotić A, Nacka-Aleksić M, Bojić-Trbojević Ž, Dekanski D. Oleuropein Stimulates Migration of Human Trophoblast Cells and Expression of Invasion-Associated Markers. International Journal of Molecular Sciences. 2024; 25(1):500. https://doi.org/10.3390/ijms25010500
Chicago/Turabian StylePirković, Andrea, Milica Jovanović Krivokuća, Aleksandra Vilotić, Mirjana Nacka-Aleksić, Žanka Bojić-Trbojević, and Dragana Dekanski. 2024. "Oleuropein Stimulates Migration of Human Trophoblast Cells and Expression of Invasion-Associated Markers" International Journal of Molecular Sciences 25, no. 1: 500. https://doi.org/10.3390/ijms25010500
APA StylePirković, A., Jovanović Krivokuća, M., Vilotić, A., Nacka-Aleksić, M., Bojić-Trbojević, Ž., & Dekanski, D. (2024). Oleuropein Stimulates Migration of Human Trophoblast Cells and Expression of Invasion-Associated Markers. International Journal of Molecular Sciences, 25(1), 500. https://doi.org/10.3390/ijms25010500