FHL2 Inhibits SARS-CoV-2 Replication by Enhancing IFN-β Expression through Regulating IRF-3
Abstract
1. Introduction
2. Results
2.1. Infection of Caco2 Cells with SARS-CoV-2 Resulted in Increased FHL2 Protein Levels
2.2. Knockdown of FHL2 Promotes SARS-CoV-2 Proliferation
2.3. Overexpression of FHL2 Inhibits SARS-CoV-2 Proliferation
2.4. FHL2 Promotes IFN-β Transcription
2.5. FHL2 Supports the Expression and Phosphorylation of IRF-3
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Transfection
4.2. Viruses
4.3. Virus Infection
4.4. Plasmid Construction
4.5. shRNA
4.6. Nuclear and Cytoplasmic Extraction
4.7. Western Blot (WB)
4.8. Quantitative Real-Time PCR
4.9. TCID50
4.10. Bioinformatic Analyses
4.11. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gorbalenya, A.E.; Baker, S.C.; Baric, R.S.; de Groot, R.J.; Drosten, C.; Gulyaeva, A.A.; Haagmans, B.L.; Lauber, C.; Leontovich, A.M.; Neuman, B.W.; et al. The species Severe acute respiratory syndrome-related coronavirus: Classifying 2019-nCoV and naming it SARS-CoV-2. Nat. Microbiol. 2020, 5, 536–544. [Google Scholar]
- Zhang, Y.Z.; Holmes, E.C. A Genomic Perspective on the Origin and Emergence of SARS-CoV-2. Cell 2020, 181, 223–227. [Google Scholar] [CrossRef] [Scilit]
- Lu, R.; Zhao, X.; Li, J.; Niu, P.; Yang, B.; Wu, H.; Wang, W.; Song, H.; Huang, B.; Zhu, N.; et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: Implications for virus origins and receptor binding. Lancet 2020, 395, 565–574. [Google Scholar] [CrossRef] [Scilit]
- Perlman, S.; Netland, J. Coronaviruses post-SARS: Update on replication and pathogenesis. Nat. Rev. Microbiol. 2009, 7, 439–450. [Google Scholar] [CrossRef] [Scilit]
- Gralinski, L.E.; Menachery, V.D. Return of the Coronavirus: 2019-nCoV. Viruses 2020, 12, 135. [Google Scholar] [CrossRef] [Scilit]
- Ziegler, C.; Allon, S.J.; Nyquist, S.K.; Mbano, I.M.; Miao, V.N.; Tzouanas, C.N.; Cao, Y.; Yousif, A.S.; Bals, J.; Hauser, B.M.; et al. SARS-CoV-2 Receptor ACE2 Is an Interferon-Stimulated Gene in Human Airway Epithelial Cells and Is Detected in Specific Cell Subsets across Tissues. Cell 2020, 181, 1016–1035.e19. [Google Scholar] [CrossRef] [Scilit]
- Xiao, F.; Tang, M.; Zheng, X.; Liu, Y.; Li, X.; Shan, H. Evidence for Gastrointestinal Infection of SARS-CoV-2. Gastroenterology 2020, 158, 1831–1833.e3. [Google Scholar] [CrossRef] [Scilit]
- Wu, F.; Zhao, S.; Yu, B.; Chen, Y.-M.; Wang, W.; Song, Z.-G.; Hu, Y.; Tao, Z.-W.; Tian, J.-H.; Pei, Y.-Y.; et al. A new coronavirus associated with human respiratory disease in China. Nature 2020, 579, 265–269. [Google Scholar] [CrossRef] [Scilit]
- Zhou, P.; Yang, X.-L.; Wang, X.-G.; Hu, B.; Zhang, L.; Zhang, W.; Si, H.-R.; Zhu, Y.; Li, B.; Huang, C.-L.; et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020, 579, 270–273. [Google Scholar] [CrossRef] [Scilit]
- Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280.e8. [Google Scholar] [CrossRef] [Scilit]
- Ivashkiv, L.B.; Donlin, L.T. Regulation of type I interferon responses. Nat. Rev. Immunol. 2014, 14, 36–49. [Google Scholar] [CrossRef] [Scilit]
- Kawai, T.; Takahashi, K.; Sato, S.; Coban, C.; Kumar, H.; Kato, H.; Ishii, K.J.; Takeuchi, O.; Akira, S. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat. Immunol. 2005, 6, 981–988. [Google Scholar] [CrossRef] [Scilit]
- Hensley, L.E.; Fritz, L.E.; Jahrling, P.B.; Karp, C.L.; Huggins, J.W.; Geisbert, T.W. Interferon-beta 1a and SARS coronavirus replication. Emerg. Infect. Dis. 2004, 10, 317–319. [Google Scholar] [CrossRef] [Scilit]
- Omrani, A.S.; Saad, M.M.; Baig, K.; Bahloul, A.; Abdul-Matin, M.; Alaidaroos, A.Y.; Almakhlafi, G.A.; Albarrak, M.M.; Memish, Z.A.; Albarrak, A.M. Ribavirin and interferon alfa-2a for severe Middle East respiratory syndrome coronavirus infection: A retrospective cohort study. Lancet Infect. Dis. 2014, 14, 1090–1095. [Google Scholar] [CrossRef] [Scilit]
- Cinatl, J.; Morgenstern, B.; Bauer, G.; Chandra, P.; Rabenau, H.; Doerr, H. Treatment of SARS with human interferons. Lancet 2003, 362, 293–294. [Google Scholar] [CrossRef] [Scilit]
- Li, J.Y.; Zhou, Z.J.; Wang, Q.; He, Q.N.; Zhao, M.Y.; Qiu, Y.; Ge, X.Y. Innate Immunity Evasion Strategies of Highly Pathogenic Coronaviruses: SARS-CoV, MERS-CoV, and SARS-CoV-2. Front. Microbiol. 2021, 12, 770656. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Ye, F.; Zhu, N.; Wang, W.; Deng, Y.; Zhao, Z.; Tan, W. Middle East respiratory syndrome coronavirus ORF4b protein inhibits type I interferon production through both cytoplasmic and nuclear targets. Sci. Rep. 2015, 5, 17554. [Google Scholar] [CrossRef] [Scilit]
- Shin, D.; Mukherjee, R.; Grewe, D.; Bojkova, D.; Baek, K.; Bhattacharya, A.; Schulz, L.; Widera, M.; Mehdipour, A.R.; Tascher, G.; et al. Papain-like protease regulates SARS-CoV-2 viral spread and innate immunity. Nature 2020, 587, 657–662. [Google Scholar] [CrossRef] [Scilit]
- Fung, S.Y.; Siu, K.L.; Lin, H.; Yeung, M.L.; Jin, D.Y. SARS-CoV-2 main protease suppresses type I interferon production by preventing nuclear translocation of phosphorylated IRF3. Int. J. Biol. Sci. 2021, 17, 1547–1554. [Google Scholar] [CrossRef] [Scilit]
- Sui, L.; Zhao, Y.; Wang, W.; Wu, P.; Wang, Z.; Yu, Y.; Hou, Z.; Tan, G.; Liu, Q. SARS-CoV-2 Membrane Protein Inhibits Type I Interferon Production Through Ubiquitin-Mediated Degradation of TBK1. Front. Immunol. 2021, 12, 662989. [Google Scholar] [CrossRef] [Scilit]
- Yuen, C.-K.; Lam, J.-Y.; Wong, W.-M.; Mak, L.-F.; Wang, X.; Chu, H.; Cai, J.-P.; Jin, D.-Y.; To, K.K.-W.; Chan, J.F.-W.; et al. SARS-CoV-2 nsp13, nsp14, nsp15 and orf6 function as potent interferon antagonists. Emerg. Microbes Infect. 2020, 9, 1418–1428. [Google Scholar] [CrossRef] [Scilit]
- Xia, H.; Cao, Z.; Xie, X.; Zhang, X.; Chen, J.Y.; Wang, H.; Menachery, V.D.; Rajsbaum, R.; Shi, P.Y. Evasion of Type I Interferon by SARS-CoV-2. Cell Rep. 2020, 33, 108234. [Google Scholar] [CrossRef] [Scilit]
- Konno, Y.; Kimura, I.; Uriu, K.; Fukushi, M.; Irie, T.; Koyanagi, Y.; Sauter, D.; Gifford, R.J.; Nakagawa, S.; Sato, K. SARS-CoV-2 ORF3b Is a Potent Interferon Antagonist Whose Activity Is Increased by a Naturally Occurring Elongation Variant. Cell Rep. 2020, 32, 108185. [Google Scholar] [CrossRef] [Scilit]
- Johannessen, M.; Møller, S.; Hansen, T.; Moens, U.; Van Ghelue, M. The multifunctional roles of the four-and-a-half-LIM only protein FHL2. Cell. Mol. Life Sci. 2006, 63, 268–284. [Google Scholar] [CrossRef] [Scilit]
- Purcell, N.H.; Darwis, D.; Bueno, O.F.; Müller, J.M.; Schüle, R.; Molkentin, J.D. Extracellular Signal-Regulated Kinase 2 Interacts with and Is Negatively Regulated by the LIM-Only Protein FHL2 in Cardiomyocytes. Mol. Cell. Biol. 2004, 24, 1081–1095. [Google Scholar] [CrossRef] [Scilit]
- Müller, J.M.; Isele, U.; Metzger, E.; Rempel, A.; Moser, M.; Pscherer, A.; Breyer, T.; Holubarsch, C.; Buettner, R.; Schüle, R. FHL2, a novel tissue-specific coactivator of the androgen receptor. EMBO J. 2000, 19, 359–369. [Google Scholar] [CrossRef] [Scilit]
- Wei, Y.; Renard, C.A.; Labalette, C.; Wu, Y.; Levy, L.; Neuveut, C.; Prieur, X.; Flajolet, M.; Prigent, S.; Buendia, M.A. Identification of the LIM protein FHL2 as a coactivator of beta-catenin. J. Biol. Chem. 2003, 278, 5188–5194. [Google Scholar] [CrossRef] [Scilit]
- Chen, D.; Xu, W.; Bales, E.; Colmenares, C.; Conacci-Sorrell, M.; Ishii, S.; Stavnezer, E.; Campisi, J.; Fisher, D.E.; Ben-Ze’Ev, A.; et al. SKI activates Wnt/beta-catenin signaling in human melanoma. Cancer Res. 2003, 63, 6626–6634. [Google Scholar]
- Morlon, A.; Sassone-Corsi, P. The LIM-only protein FHL2 is a serum-inducible transcriptional coactivator of AP-1. Proc. Natl. Acad. Sci. 2003, 100, 3977–3982. [Google Scholar] [CrossRef] [Scilit]
- Samson, T.; Smyth, N.; Janetzky, S.; Wendler, O.; Muller, J.M.; Schule, R.; von der Mark, H.; von der Mark, K.; Wixler, V. The LIM-only proteins FHL2 and FHL3 interact with alpha- and beta-subunits of the muscle alpha7beta1 integrin receptor. J. Biol. Chem. 2004, 279, 28641–28652. [Google Scholar] [CrossRef] [Scilit]
- Sun, L.; Yu, S.; Xu, H.; Zheng, Y.; Lin, J.; Wu, M.; Wang, J.; Wang, A.; Lan, Q.; Furnari, F.; et al. FHL2 interacts with EGFR to promote glioblastoma growth. Oncogene 2018, 37, 1386–1398. [Google Scholar] [CrossRef] [Scilit]
- Verset, L.; Feys, L.; Trepant, A.L.; De Wever, O.; Demetter, P. FHL2: A scaffold protein of carcinogenesis, tumour-stroma interactions and treatment response. Histol. Histopathol. 2016, 31, 469–478. [Google Scholar] [PubMed]
- Jin, X.; Jiao, X.; Jiao, J.; Zhang, T.; Cui, B. Increased expression of FHL2 promotes tumorigenesis in cervical cancer and is correlated with poor prognosis. Gene 2018, 669, 99–106. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Tsai, H.; Tsai, S.; Chu, P.; Huang, P.; Chen, J.; Lin, S. Deletion of the FHL2 gene attenuates intima-media thickening in a partially ligated carotid artery ligated mouse model. J. Cell. Mol. Med. 2019, 24, 160–173. [Google Scholar] [CrossRef] [Scilit]
- Van de Pol, V.; Vos, M.; DeRuiter, M.C.; Goumans, M.J.; de Vries, C.; Kurakula, K. LIM-only protein FHL2 attenuates inflammation in vascular smooth muscle cells through inhibition of the NFkappaB pathway. Vasc. Pharmacol. 2020, 125–126, 106634. [Google Scholar] [CrossRef] [Scilit]
- Clemente-Olivo, M.P.; Habibe, J.J.; Vos, M.; Ottenhoff, R.; Jongejan, A.; Herrema, H.; Zelcer, N.; Kooijman, S.; Rensen, P.C.; van Raalte, D.H.; et al. Four-and-a-half LIM domain protein 2 (FHL2) deficiency protects mice from diet-induced obesity and high FHL2 expression marks human obesity. Metabolism 2021, 121, 154815. [Google Scholar] [CrossRef] [Scilit]
- Dahan, J.; Nouet, Y.; Jouvion, G.; Levillayer, F.; Adib-Conquy, M.; Cassard-Doulcier, A.M.; Tebbi, A.; Blanc, F.; Remy, L.; Chen, J.; et al. LIM-only protein FHL2 activates NF-kappaB signaling in the control of liver regeneration and hepatocarcinogenesis. Mol. Cell Biol. 2013, 33, 3299–3308. [Google Scholar] [CrossRef] [Scilit]
- Wong, C.; Mak, G.W.; Li, M.; Tsui, S.K. The LIM-only protein FHL2 regulates interleukin-6 expression through p38 MAPK mediated NF-κB pathway in muscle cells. Cytokine 2012, 59, 286–293. [Google Scholar] [CrossRef] [Scilit]
- Labalette, C.; Renard, C.-A.; Neuveut, C.; Buendia, M.-A.; Wei, Y. Interaction and Functional Cooperation between the LIM Protein FHL2, CBP/p300, and β-Catenin. Mol. Cell. Biol. 2004, 24, 10689–10702. [Google Scholar] [CrossRef] [Scilit]
- Nordhoff, C.; Hillesheim, A.; Walter, B.M.; Haasbach, E.; Planz, O.; Ehrhardt, C.; Ludwig, S.; Wixler, V. The adaptor protein FHL2 enhances the cellular innate immune response to influenza A virus infection. Cell. Microbiol. 2012, 14, 1135–1147. [Google Scholar] [CrossRef] [Scilit]
- Liu, Q.; Wang, H.; Zhang, H.; Sui, L.; Li, L.; Xu, W.; Du, S.; Hao, P.; Jiang, Y.; Chen, J.; et al. The global succinylation of SARS-CoV-2-infected host cells reveals drug targets. Proc. Natl. Acad. Sci. USA 2022, 119, e2123065119. [Google Scholar] [CrossRef] [Scilit]
- Miciak, J.; Bunz, F. Long story short: p53 mediates innate immunity. Biochim. Biophys. Acta (BBA) Rev. Cancer 2016, 1865, 220–227. [Google Scholar] [CrossRef] [Scilit]
- Christofides, A.; Konstantinidou, E.; Jani, C.; Boussiotis, V.A. The role of peroxisome proliferator-activated receptors (PPAR) in immune responses. Metabolism 2020, 114, 154338. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Guan, W.J.; Qiu, Z.E.; Xu, J.B.; Bai, X.; Hou, X.C.; Sun, J.; Qu, S.; Huang, Z.X.; Lei, T.L.; et al. SARS-CoV-2 nucleocapsid protein triggers hyperinflammation via protein-protein interaction-mediated intracellular Cl− accumulation in respiratory epithelium. Signal Transduct. Target. Ther. 2022, 7, 255. [Google Scholar] [CrossRef] [Scilit]
- Lei, X.; Dong, X.; Ma, R.; Wang, W.; Xiao, X.; Tian, Z.; Wang, C.; Wang, Y.; Li, L.; Ren, L.; et al. Activation and evasion of type I interferon responses by SARS-CoV-2. Nat. Commun. 2020, 11, 3810. [Google Scholar] [CrossRef] [Scilit]
- Hornung, V.; Ellegast, J.; Kim, S.; Brzózka, K.; Jung, A.; Kato, H.; Poeck, H.; Akira, S.; Conzelmann, K.-K.; Schlee, M.; et al. 5’-Triphosphate RNA Is the Ligand for RIG-I. Science 2006, 314, 994–997. [Google Scholar] [CrossRef] [Scilit]
- Randall, R.E.; Goodbourn, S. Interferons and viruses: An interplay between induction, signalling, antiviral responses and virus countermeasures. J. Gen. Virol. 2008, 89, 1–47. [Google Scholar] [CrossRef] [Scilit]
- Chams, N.; Chams, S.; Badran, R.; Shams, A.; Araji, A.; Raad, M.; Mukhopadhyay, S.; Stroberg, E.; Duval, E.J.; Barton, L.M.; et al. COVID-19: A Multidisciplinary Review. Front. Public Health 2020, 8, 383. [Google Scholar] [CrossRef] [Scilit]
- Davis, H.E.; McCorkell, L.; Vogel, J.M.; Topol, E.J. Long COVID: Major findings, mechanisms and recommendations. Nat. Rev. Microbiol. 2023, 21, 133–146. [Google Scholar] [CrossRef] [Scilit]
- Kindler, E.; Thiel, V. SARS-CoV and IFN: Too Little, Too Late. Cell Host Microbe 2016, 19, 139–141. [Google Scholar] [CrossRef] [Scilit]
- Arunachalam, P.S.; Wimmers, F.; Mok, C.K.P.; Perera, R.A.P.M.; Scott, M.; Hagan, T.; Sigal, N.; Feng, Y.; Bristow, L.; Tsang, O.T.-Y.; et al. Systems biological assessment of immunity to mild versus severe COVID-19 infection in humans. Science 2020, 369, 1210–1220. [Google Scholar] [CrossRef] [Scilit]
- Shang, C.; Zhuang, X.; Zhang, H.; Li, Y.; Zhu, Y.; Lu, J.; Ge, C.; Cong, J.; Li, T.; Tian, M.; et al. Inhibitors of endosomal acidification suppress SARS-CoV-2 replication and relieve viral pneumonia in hACE2 transgenic mice. Virol. J. 2021, 18, 46. [Google Scholar] [CrossRef] [Scilit]
- Wu, T.; Hu, E.; Xu, S.; Chen, M.; Guo, P.; Dai, Z.; Feng, T.; Zhou, L.; Tang, W.; Zhan, L.; et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation 2021, 2, 100141. [Google Scholar] [CrossRef] [Scilit]






| Class | Primer | Sequence (5′-3′) | Gene Name |
|---|---|---|---|
| PCR | FHL2F | GAATTCATGACTGAGCGCTTTGACTGCCA | FHL2 |
| FHLR | CTCGAGTCAATGGTGATGGTGATGGTGGATGTCTTTCCCACA | ||
| MF | GGTACCATGGCAGATTCCAACGGTACTATTACCG | M | |
| MR | CTCGAGTTACTTTTCGAACTGCGGGTGGCTCCACTGTACAAGCAAAGC | ||
| NF | GGTACCATGTCTGATAATGGACCCCAAAATCAGCG | N | |
| NR | TCTAGATTACTTTTCGAACTGCGGGTGGCTCCAGGCCTGAGTTGAGTC | ||
| qRT- PCR | qFHL2F | CTGCCACCATTGCAACGAAT | FHL2 |
| qFHL2R | AGACAAGTCCTTGCAGTCACA | ||
| qGAPDHF | CTTTGGTATCGTGGAAGGACTC | GAPDH | |
| qGAPDHR | GTAGAGGCAGGGATGATGTTCT | ||
| qIFN-βF | TCTCCTGTTGTGCTTCTCCAC | IFN-β | |
| qIFN-βR | GCCTCCCATTCAATTGCCAC | ||
| qIRF-3F | AGAGGCTCGTGATGGTCAAG | IRF-3 | |
| qIRF-3R | AGGTCCACAGTATTCTCCAGG | ||
| qNF | GGGGAACTTCTCCTGCTAGAA | N | |
| qNR | CAGACATTTTGCTCTCAAGCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, Z.; Tian, M.; Tan, Q.; Hao, P.; Gao, Z.; Li, C.; Jin, N. FHL2 Inhibits SARS-CoV-2 Replication by Enhancing IFN-β Expression through Regulating IRF-3. Int. J. Mol. Sci. 2024, 25, 353. https://doi.org/10.3390/ijms25010353
Xu Z, Tian M, Tan Q, Hao P, Gao Z, Li C, Jin N. FHL2 Inhibits SARS-CoV-2 Replication by Enhancing IFN-β Expression through Regulating IRF-3. International Journal of Molecular Sciences. 2024; 25(1):353. https://doi.org/10.3390/ijms25010353
Chicago/Turabian StyleXu, Zhiqiang, Mingyao Tian, Qihan Tan, Pengfei Hao, Zihan Gao, Chang Li, and Ningyi Jin. 2024. "FHL2 Inhibits SARS-CoV-2 Replication by Enhancing IFN-β Expression through Regulating IRF-3" International Journal of Molecular Sciences 25, no. 1: 353. https://doi.org/10.3390/ijms25010353
APA StyleXu, Z., Tian, M., Tan, Q., Hao, P., Gao, Z., Li, C., & Jin, N. (2024). FHL2 Inhibits SARS-CoV-2 Replication by Enhancing IFN-β Expression through Regulating IRF-3. International Journal of Molecular Sciences, 25(1), 353. https://doi.org/10.3390/ijms25010353

