Evaluation of Immune Response to Mucosal Immunization with an Oral Probiotic-Based Vaccine in Mice: Potential for Prime-Boost Immunization against SARS-CoV-2
Abstract
:1. Introduction
2. Results
2.1. Study of the Persistence of Modified Enterococcus in the Gastrointestinal Tract of Mice
2.2. Study of the Immunogenicity of the Coronavirus Protein S in the Composition of L3-SARS
2.3. Probiotic Vaccine in the Prime-Boost Method: Investigating the Effect of Vaccination on Subsequent Single Parenteral Administration of a Homologous Antigen
3. Discussion
4. Materials and Methods
4.1. Bacterial Cultures
4.2. Animal Procedures
4.3. Immunization Schemes
4.4. Enzyme-Linked Immunosorbent Assay (ELISA)
4.5. Serum Processing for Specific IgG Analysis
4.6. Evaluation of IFN-γ Production
4.7. Evaluation of L3-SARS in Mice Feces
- K1: TTGCATATGGGTTTCCAACCCACT (Forward)
- K2: GTAGAATTCGTTGTTGACATGTTCA (Reverse)
- B1: TGAGTGAACCACAGCCAGAA (Forward)
4.8. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Almond, J.; Hacker, J.; Harwood, C.; Pizza, M.; Rappuoli, R.; Ron, E.Z.; Sansonetti, P.; Vanderslott, S.; Wieler, L.H. Development of vaccines at the time of COVID-19. microLife 2020, 1, uqaa003. [Google Scholar] [CrossRef] [PubMed]
- Possas, C.; de Souza Antunes, A.M.; de Oliveira, A.M.; de Souza Mendes Santos, C.D.; Ramos, M.P.; de Oliveira Rodrigues Schumacher, S.; Homma, A. Vaccine Innovation for Pandemic Preparedness: Patent Landscape, Global Sustainability, and Circular Bioeconomy in Post-COVID-19 era. Circ. Econ. Sustain. 2021, 1, 1439–1461. [Google Scholar] [CrossRef] [PubMed]
- Cavaillon, J.M.; Osuchowski, M.F. COVID-19 and earlier pandemics, sepsis, and vaccines: A historical perspective. J. Intensive Med. 2021, 1, 4–13. [Google Scholar] [CrossRef] [PubMed]
- Soleimanpour, S.; Yaghoubi, A. COVID-19 vaccine: Where are we now and where should we go? Infect. Dis. Immun. 2021, 20, 43–51. [Google Scholar] [CrossRef]
- Li, T.; Zhang, T.; Gu, Y.; Li, S.; Xia, N. Current progress and challenges in the design and development of a successful COVID-19 vaccine. Fundam. Res. 2021, 1, 139–150. [Google Scholar] [CrossRef]
- Jiang, H.D.; Li, J.X.; Zhang, P.; Huo, X.; Zhu, F.C. The COVID-19 Vaccine in Clinical Trials: Where Are We Now? Infect. Dis. Immun. 2021, 1, 43–51. [Google Scholar] [CrossRef]
- Hanney, S.R.; Wooding, S.; Sussex, J.; Grant, J. From COVID-19 research to vaccine application: Why might it take 17 months not 17 years and what are the wider lessons? Health Res. Policy Syst. 2020, 18, 61. [Google Scholar] [CrossRef]
- Logunov, D.Y.; Dolzhikova, I.V.; Shcheblyakov, D.V.; Tukhvatulin, A.I.; Zubkova, O.V.; Dzharullaeva, A.S.; Kovyrshina, A.V.; Lubenets, N.L.; Grousova, D.M.; Erokhova, A.S.; et al. Safety and efficacy of an rAd26 and rAd5 vector-based heterologous prime-boost COVID-19 vaccine: An interim analysis of a randomised controlled phase 3 trial in Russia. Lancet 2021, 397, 671–681. [Google Scholar] [CrossRef]
- Logunov, D.Y.; Dolzhikova, I.V.; Zubkova, O.V.; Tukhvatullin, A.I.; Shcheblyakov, D.V.; Dzharullaeva, A.S.; Grousova, D.M.; Erokhova, A.S.; Kovyrshina, A.V.; Botikov, A.G.; et al. Safety and immunogenicity of an rAd26 and rAd5 vector-based heterologous prime-boost COVID-19 vaccine in two formulations: Two open, non-randomised phase 1/2 studies from Russia. Lancet 2020, 396, 887–897. [Google Scholar] [CrossRef]
- Nagy, A.; Alhatlani, B. An overview of current COVID-19 vaccine platforms. Comput. Struct. Biotechnol. J. 2021, 19, 2508–2517. [Google Scholar] [CrossRef]
- Cihan, P. Forecasting fully vaccinated people against COVID-19 and examining future vaccination rate for herd immunity in the US, Asia, Europe, Africa, South America, and the World. Appl. Soft Comput. 2021, 111, 107708. [Google Scholar] [CrossRef]
- Funk, C.D.; Laferrière, C.; Ardakani, A. Target Product Profile Analysis of COVID-19 Vaccines in Phase III Clinical Trials and Beyond: An Early 2021 Perspective. Viruses 2021, 13, 418. [Google Scholar] [CrossRef]
- Polack, P.; Thomas, S.J.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Perez, J.L.; Pérez Marc, G.; Moreira, E.D.; Zerbini, C.; et al. Safety and efficacy of the BNT162b2 mRNA Covid-19 vaccine. N. Engl. J. Med. 2020, 383, 2603–2615. [Google Scholar] [CrossRef] [PubMed]
- Voysey, M.; Clemens, S.A.C.; Madhi, S.A.; Weckx, L.Y.; Folegatti, P.M.; Aley, P.K.; Angus, B.; Baillie, V.L.; Barnabas, S.L.; Bhorat, Q.E.; et al. Safety and efficacy ofthe ChAdOx1 nCoV-19 vaccine (AZD1222) against SARS-CoV-2: An interimanalysis of four randomised controlled trials in Brazil, South Africa, and the UK. Lancet 2021, 397, 99–111. [Google Scholar] [CrossRef] [PubMed]
- Olliaro, P.; Torreele, E.; Vaillant, M. COVID-19 vaccine efficacy and effectiveness—The elephant (not) in the room. Lancet Microbe 2021, 2, e279–e280. [Google Scholar] [CrossRef] [PubMed]
- Yan, Y.; Pang, Y.; Lyu, Z.; Wang, R.; Wu, X.; You, C.; Zhao, H.; Manickam, S.; Lester, E.; Wu, T.; et al. The COVID-19 vaccines: Recent development, challenges and prospects. Vaccines 2021, 9, 349. [Google Scholar] [CrossRef] [PubMed]
- Feikin, D.R.; Higdon, M.M.; Abu-Raddad, L.J.; Andrews, N.; Araos, R.; Goldberg, Y.; Groome, M.J.; Huppert, A.; O’Brien, K.L.; Smith, P.G.; et al. Duration of effectiveness of vaccines against SARS-CoV-2 infection and COVID-19 disease: Results of a systematic review and meta-regression. Lancet 2022, 399, 924–944. [Google Scholar] [CrossRef] [PubMed]
- Seegers, J.F. Lactobacilli as live vaccine delivery vectors: Progress and prospects. Trends Biotechnol. 2002, 20, 508–515. [Google Scholar] [CrossRef]
- Xin, K.Q.; Hoshino, Y.; Toda, Y.; Igimi, S.; Kojima, Y.; Jounai, N.; Ohba, K.; Kushiro, A.; Kiwaki, M.; Hamajima, K.; et al. Immunogenicity and protective efficacy of orally administered recombinant Lactococcus lactis expressing surface-bound HIV Env. Blood 2003, 102, 223–228. [Google Scholar] [CrossRef]
- Lee, J.S.; Poo, H.Y.; Han, D.P.; Hong, S.P.; Kim, K.; Cho, M.W.; Kim, E.; Sung, M.H.; Kim, C.J. Mucosal immunization with surface-displayed severe acute respiratory syndrome coronavirus spike protein on Lactobacillus casei induces neutralizing antibodies in mice. J. Virol. 2006, 80, 4079–4087. [Google Scholar] [CrossRef]
- del Rio, B.; Dattwyler, R.J.; Aroso, M.; Neves, V.; Meirelles, L.; Seegers, J.F.; Gomes-Solecki, M. Oral immunization with recombinant lactobacillus plantarum induces a protective immune response in mice with Lyme disease. Clin. Vaccine Immunol. CVI 2008, 15, 1429–1435. [Google Scholar] [CrossRef] [PubMed]
- Gupalova, T.; Leontieva, G.; Kramskaya, T.; Grabovskaya, K.; Bormotova, E.; Korjevski, D.; Suvorov, A. Development of experimental GBS vaccine for mucosal immunization. PLoS ONE 2018, 13, e0196564. [Google Scholar] [CrossRef] [PubMed]
- Gupalova, T.; Leontieva, G.; Kramskaya, T.; Grabovskaya, K.; Kuleshevich, E.; Suvorov, A. Development of experimental pneumococcal vaccine for mucosal immunization. PLoS ONE 2019, 14, e0218679. [Google Scholar] [CrossRef] [PubMed]
- Plaza-Diaz, J.; Ruiz-Ojeda, F.J.; Gil-Campos, M.; Gil, A. Mechanisms of Action of Probiotics. Adv. Nutr. 2019, 10 (Suppl. S1), S49–S66. [Google Scholar] [CrossRef] [PubMed]
- Suvorov, A.; Gupalova, T.; Desheva, Y.; Kramskaya, T.; Bormotova, E.; Koroleva, I.; Kopteva, O.; Leontieva, G. Construction of the Enterococcal Strain Expressing Immunogenic Fragment of SARS-CoV-2 Virus. Front. Pharmacol. 2022, 12, 807256. [Google Scholar] [CrossRef] [PubMed]
- Suvorov, A.; Loginova, S.; Leontieva, G.; Gupalova, T.; Desheva, Y.; Korzhevskii, D.; Kramskaya, T.; Bormotova, E.; Koroleva, I.; Kopteva, O.; et al. SARS-CoV-2 Spike Protein-Expressing Enterococcus for Oral Vaccination: Immunogenicity and Protection. Vaccines 2023, 11, 1714. [Google Scholar] [CrossRef] [PubMed]
- Bok, K.; Sitar, S.; Graham, B.S.; Mascola, J.R. Accelerated COVID-19 vaccine development: Milestones, lessons, and prospects. Immunity 2021, 54, 1636–1651. [Google Scholar] [CrossRef] [PubMed]
- Gao, Q.; Bao, L.; Mao, H.; Wang, L.; Xu, K.; Yang, M.; Li, Y.; Zhu, L.; Wang, N.; Lv, Z.; et al. Development of an inactivated vaccine candidate for SARS-CoV-2. Science 2020, 369, 77–81. [Google Scholar] [CrossRef]
- Hanniffy, S.B.; Carter, A.T.; Hitchin, E.; Wells, J.M. Mucosal delivery of a pneumococcal vaccine using Lactococcus lactis affords protection against respiratory infection. J. Infect. Dis. 2007, 195, 185–193. [Google Scholar] [CrossRef]
- Taghinezhad-S, S.; Mohseni, A.H.; Bermúdez-Humarán, L.G.; Casolaro, V.; Cortes-Perez, N.G.; Keyvani, H.; Simal-Gandara, J. Probiotic-Based Vaccines May Provide Effective Protection against COVID-19 Acute Respiratory Disease. Vaccines 2021, 9, 466. [Google Scholar] [CrossRef]
- Taghinezhad-Saroukalaei, S.; Keyvani, H.; Bermúdez-Humarán, L.G.; Donders, G.G.; Fu, X.; Mohseni, A.H. Twenty years of research on HPV vaccines based on genetically modified lactic acid bacteria: An overview on the gut-vagina axis. Cell. Mol. Life Sci. 2020, 78, 1191–1206. [Google Scholar] [CrossRef] [PubMed]
- Taghinezhad, S.S.; Mohseni, A.H.; Keyvani, H.; Razavilar, V. Protection against human papillomavirus type 16-induced tumors in C57BL/6 mice by mucosal vaccination with Lactococcus lactis NZ9000 expressing E6 oncoprotein. Microb. Pathog. 2019, 126, 149–156. [Google Scholar] [CrossRef] [PubMed]
- Kawana, K.; Adachi, K.; Kojima, S.; Taguchi, A.; Tomio, K.; Yamashita, A.; Nishida, H.; Nagasaka, K.; Arimoto, T.; Yokoyama, T.; et al. Oral vaccination against HPV E7 for treatment of cervical intraepithelial neoplasia grade 3 (CIN3) elicits E7-specific mucosal immunity in the cervix of CIN3 patients. Vaccine 2014, 32, 6233–6239. [Google Scholar] [CrossRef] [PubMed]
- Park, Y.C.; Ouh, Y.T.; Sung, M.H.; Park, H.G.; Kim, T.J.; Cho, C.H.; Park, J.S.; Lee, J.K. A phase 1/2a, dose-escalation, safety and preliminary efficacy study of oral therapeutic vaccine in subjects with cervical intraepithelial neoplasia 3. J. Gynecol. Oncol. 2019, 30, e88. [Google Scholar] [CrossRef] [PubMed]
- Taghinezhad, S.S.; Mohseni, A.H.; Keyvani, H.; Razavi, M.R. Phase 1 Safety and Immunogenicity Trial of Recombinant Lactococcus lactis Expressing Human Papillomavirus Type 16 E6 Oncoprotein Vaccine. Mol. Ther. Methods Clin. Dev. 2019, 15, 40–51. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.H.; Hou, X.L.; Yu, L.Y.; Liu, J.K.; Wei, C.H. Studies on Mucosal Immunity Induced by Transmissible Gastroenteritis Virus Nucleocapsid Protein Recombinant Lactobacillus casei in Mice and Sow. Agric. Sci. China 2009, 8, 231–237. [Google Scholar] [CrossRef]
- Mezhenskaya, D.; Isakova-Sivak, I.; Gupalova, T.; Bormotova, E.; Kuleshevich, E.; Kramskaya, T.; Leontieva, G.; Rudenko, L.; Suvorov, A. A Live Probiotic Vaccine Prototype Based on Conserved Influenza a Virus Antigens Protect Mice against Lethal Influenza Virus Infection. Biomedicines 2021, 9, 1515. [Google Scholar] [CrossRef]
- Desheva, Y.; Leontieva, G.; Kramskaya, T.; Gupalova, T.; Losev, I.; Kuleshevich, E.; Bormotova, E.; Kopteva, O.; Kudar, P.; Suvorov, A. Developing a Live Probiotic Vaccine Based on the Enterococcus faecium L3 Strain Expressing Influenza Neuraminidase. Microorganisms 2021, 9, 2446. [Google Scholar] [CrossRef]
- Pant, N.; Hultberg, A.; Zhao, Y.; Svensson, L.; Pan-Hammarstrom, Q.; Johansen, K.; Pouwels, P.H.; Ruggeri, F.M.; Hermans, P.; Frenken, L.; et al. Lactobacilli expressing variable domain of llama heavy-chain antibody fragments (lactobodies) confer protection against rotavirus-induced diarrhea. J. Infect. Dis. 2006, 194, 1580–1588. [Google Scholar] [CrossRef]
- Yoon, S.W.; Lee, T.Y.; Kim, S.J.; Lee, I.H.; Sung, M.H.; Park, J.S.; Poo, H. Oral administration of HPV-16 L2 displayed on Lactobacillus casei induces systematic and mucosal cross-neutralizing effects in Balb/c mice. Vaccine 2012, 30, 3286–3294. [Google Scholar] [CrossRef]
- Zeng, M.Y.; Cisalpino, D.; Varadarajan, S.; Hellman, J.; Warren, H.S.; Cascalho, M.; Inohara, N.; Núñez, G. Gut Microbiota-Induced Immunoglobulin G Controls Systemic Infection by Symbiotic Bacteria and Pathogens. Immunity 2016, 44, 647–658. [Google Scholar] [CrossRef]
- Pabst, O. New concepts in the generation and functions of IgA. Nat. Rev. Immunol. 2012, 12, 821–832. [Google Scholar] [CrossRef] [PubMed]
- Fagarasan, S.; Kinoshita, K.; Muramatsu, M.; Ikuta, K.; Honjo, T. In situ class switching and differentiation to IgA-producing cells in the gut lamina propria. Nature 2001, 413, 639–643. [Google Scholar] [CrossRef] [PubMed]
- Bunker, J.J.; Bendelac, A. IgA Responses to Microbiota. Immunity 2018, 49, 211–224. [Google Scholar] [CrossRef] [PubMed]
- Pabst, O.; Cerovic, V.; Hornef, M. Secretory IgA in the Coordination of Establishment and Maintenance of the Microbiota. Trends Immunol. 2016, 37, 287–296. [Google Scholar] [CrossRef]
- Kawamoto, S.; Maruya, M.; Kato, L.M.; Suda, W.; Atarashi, K.; Doi, Y.; Tsutsui, Y.; Qin, H.; Honda, K.; Okada, T.; et al. Foxp3+ T cells regulate immunoglobulin a selection and facilitate diversification of bacterial species responsible for immune homeostasis. Immunity 2014, 41, 152–165. [Google Scholar] [CrossRef]
- Quan, C.P.; Berneman, A.; Pires, R.; Avrameas, S.; Bouvet, J.P. Natural polyreactive secretory immunoglobulin A autoantibodies as a possible barrier to infection in humans. Infect. Immun. 1997, 65, 3997–4004. [Google Scholar] [CrossRef]
- Wijburg, O.L.; Uren, T.K.; Simpfendorfer, K.; Johansen, F.E.; Brandtzaeg, P.; Strugnell, R.A. Innate secretory antibodies protect against natural Salmonella typhimurium infection. J. Exp. Med. 2006, 203, 21–26. [Google Scholar] [CrossRef]
- Notkins, A.L. Polyreactivity of antibody molecules. Trends Immunol. 2004, 25, 174–179. [Google Scholar] [CrossRef]
- Mouquet, H.; Nussenzweig, M.C. Polyreactive antibodies in adaptive immune responses to viruses. Cell. Mol. Life Sci. 2012, 69, 1435–1445. [Google Scholar] [CrossRef]
- Wines, B.D.; Hogarth, P.M. IgA Receptors in Health and Disease. Tissue Antigens 2006, 68, 103–114. [Google Scholar] [CrossRef] [PubMed]
- Breedveld, A.; van Egmond, M. IgA and FcaRI: Pathological Roles and Therapeutic Opportunities. Front. Immunol. 2019, 10, 553. [Google Scholar] [CrossRef] [PubMed]
- Iversen, R.; Snir, O.; Stensland, M.; Kroll, J.E.; Steinsbø, O.; Korponay-Szabò, I.R.; Lundin, K.E.; de Souza, G.A.; Sollid, L.M. Strong clonal relatedness between Serum and Gut IgA despite different plasma cell origins. Cell Rep. 2017, 20, 2357–2367. [Google Scholar] [CrossRef] [PubMed]
- Okuya, K.; Yoshida, R.; Manzoor, R.; Saito, S.; Suzuki, T.; Sasaki, M.; Saito, T.; Kida, Y.; Mori-Kajihara, A.; Kondoh, T.; et al. Potential role of Nonneutralizing IgA antibodies in cross-protective immunity against Influenza A viruses of multiple hemagglutinin subtypes. J. Virol. 2020, 94, e00408–e00420. [Google Scholar] [CrossRef] [PubMed]
- Fox, A.; Marino, J.; Amanat, F.; Krammer, F.; Hahn-Holbrook, J.; Zolla-Pazner, S.; Powell, R.L. Robust and Specific Secretory IgA Against SARS-CoV-2 Detected in Human Milk. iScience 2020, 23, 101735. [Google Scholar] [CrossRef] [PubMed]
- Quinti, I.; Mortari, E.P.; Fernandez Salinas, A.; Milito, C.; Carsetti, R. IgA Antibodies and IgA Deficiency in SARS-CoV-2 Infection. Front. Cell. Infect. Microbiol. 2021, 11, 655896. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Bi, Y.; Xiao, H.; Yao, Y.; Liu, X.; Hu, Z.; Duan, J.; Yang, Y.; Li, Z.; Li, Y.; et al. A novel DNA and protein combination COVID-19 vaccine formulation provides full protection against SARS-CoV-2 in rhesus macaques. Emerg. Microbes Infect. 2021, 10, 342–355. [Google Scholar] [CrossRef] [PubMed]
- Lu, S. Heterologous prime-boost vaccination. Curr. Opin. Immunol. 2009, 21, 346–351. [Google Scholar] [CrossRef]
- Pan, Y.; Jia, R.; Li, J.; Wang, M.; Chen, S.; Liu, M.; Zhu, D.; Zhao, X.; Wu, Y.; Yang, Q.; et al. Heterologous prime-boost: An important candidate immunization strategy against Tembusu virus. Virol. J. 2020, 17, 67. [Google Scholar] [CrossRef]
- Zhang, J.; He, Q.; An, C.; Mao, Q.; Gao, F.; Bian, L.; Wu, X.; Wang, Q.; Liu, P.; Song, L.; et al. Boosting with heterologous vaccines effectively improves protective immune responses of the inactivated SARS-CoV-2 vaccine. Emerg. Microbes Infect. 2021, 10, 1598–1608. [Google Scholar] [CrossRef]
- He, Q.; Mao, Q.; An, C.; Zhang, J.; Gao, F.; Bian, L.; Li, C.; Liang, Z.; Xu, M.; Wang, J. Heterologous prime-boost: Breaking the protective immune response bottleneck of COVID-19 vaccine candidates. Emerg. Microbes Infect. 2021, 10, 629–637. [Google Scholar] [CrossRef] [PubMed]
- Lavelle, E.C.; Ward, R.W. Mucosal vaccines—Fortifying the frontiers. Nat. Rev. Immunol. 2022, 22, 236–250. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Cai, L.; Hufnagel, S.; Cui, Z. Intranasal vaccine: Factors to consider in research and development. Int. J. Pharm. 2021, 609, 121180. [Google Scholar] [CrossRef] [PubMed]
- Baker, J.R., Jr.; Farazuddin, M.; Wong, P.T.; O’Konek, J.J. The unfulfilled potential of mucosal immunization. J. Allergy Clin. Immunol. 2022, 150, 1–11. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Leontieva, G.; Gupalova, T.; Desheva, Y.; Kramskaya, T.; Bormotova, E.; Koroleva, I.; Kopteva, O.; Suvorov, A. Evaluation of Immune Response to Mucosal Immunization with an Oral Probiotic-Based Vaccine in Mice: Potential for Prime-Boost Immunization against SARS-CoV-2. Int. J. Mol. Sci. 2024, 25, 215. https://doi.org/10.3390/ijms25010215
Leontieva G, Gupalova T, Desheva Y, Kramskaya T, Bormotova E, Koroleva I, Kopteva O, Suvorov A. Evaluation of Immune Response to Mucosal Immunization with an Oral Probiotic-Based Vaccine in Mice: Potential for Prime-Boost Immunization against SARS-CoV-2. International Journal of Molecular Sciences. 2024; 25(1):215. https://doi.org/10.3390/ijms25010215
Chicago/Turabian StyleLeontieva, Galina, Tatiana Gupalova, Yulia Desheva, Tatiana Kramskaya, Elena Bormotova, Irina Koroleva, Olga Kopteva, and Alexander Suvorov. 2024. "Evaluation of Immune Response to Mucosal Immunization with an Oral Probiotic-Based Vaccine in Mice: Potential for Prime-Boost Immunization against SARS-CoV-2" International Journal of Molecular Sciences 25, no. 1: 215. https://doi.org/10.3390/ijms25010215
APA StyleLeontieva, G., Gupalova, T., Desheva, Y., Kramskaya, T., Bormotova, E., Koroleva, I., Kopteva, O., & Suvorov, A. (2024). Evaluation of Immune Response to Mucosal Immunization with an Oral Probiotic-Based Vaccine in Mice: Potential for Prime-Boost Immunization against SARS-CoV-2. International Journal of Molecular Sciences, 25(1), 215. https://doi.org/10.3390/ijms25010215