Helicobacter pylori and Epstein–Barr Virus Co-Infection in Gastric Disease: What Is the Correlation with p53 Mutation, Genes Methylation and Microsatellite Instability in a Cohort of Sicilian Population?
Abstract
:1. Introduction
2. Results
- The group non-infected (NIG) comprised 45 patients without infection, with 44.44% males and 55.56% females, with ages in the range 22–87, with a mean of 57.67 y.o. and standard deviation (SD) of 18.02 y.o.;
- The group Hp comprised 18 patients with Hp infection only, with 27.78% males and 72.22% females, with ages in the range 31–80, with a mean of 58.53 y.o. and a standard deviation (SD) of 15.26 y.o.;
- The group EBV comprised 11 patients with EBV infection only, with 45.45% males and 54.55% females, with ages in the range 25–77, with a mean of 61.09 y.o. and a standard deviation (SD) of 14.31 y.o.;
- The group EBV-Hp comprised 26 patients with co-infection by EBV and Hp, with 26.92% males and 73.08% females, with ages in the range 20–87, with a mean of 58.58 y.o. and a standard deviation (SD) of 16.23 y.o.
3. Discussion
4. Materials and Methods
4.1. Patients and Sample Collection
4.2. Exclusion Criteria
4.3. Histology Analysis
4.4. Valuation of p53 Mutation and Single-Stranded Conformation Polymorphism [SSCP] Analysis
4.5. Bisulfite Modification and Methylation-Specific PCR [MSP]
4.6. Microsatellite Instability Analysis
4.7. Ethical Considerations
4.8. Statistical Analysis
- Infections: yes (including patients with Hp, EBV, or both) = 1, no = 0;
- Gender: male = 1, female = 0;
- Symptoms: yes (including active chronic gastritis, gastric cancer and MALT lymphoma) = 1; no (normal gastric mucosa) = 0;
- p53 mutation: yes (if among exon 5–9 there was a mutation) = 1, no = 0;
- Methylation status: yes (if among the genes CDH1, DAPK, COX2, hMLH1, CDKN2A there was a methylation) = 1, no = 0;
- Microsatellite instability: yes = 1, no = 0.
5. Conclusions
6. Limitations
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Vogelstein, B.; Papadopoulos, N.; Velculescu, V.E.; Zhou, S.; Diaz, L.A., Jr.; Kinzler, K.W. Cancer genome landscapes. Science 2013, 339, 1546–1558. [Google Scholar] [CrossRef] [PubMed]
- Gigek, C.O.; Chen, E.S.; Calcagno, D.Q.; Wisnieski, F.; Burbano, R.R.; Smith, M.A.C. Epigenetic mechanisms in gastric cancer. Epigenomics 2012, 4, 279–294. [Google Scholar] [CrossRef] [PubMed]
- Zang, Z.J.; Cutcutache, I.; Poon, S.L.; Zhang, S.L.; McPherson, J.R.; Tao, J.; Rajasegaran, V.; Heng, H.L.; Deng, N.; Gan, A.; et al. Exome sequencing of gastric adenocarcinoma identifies recurrent somatic mutations in cell adhesion and chromatin remodeling genes. Nat. Genet. 2012, 44, 570–574. [Google Scholar] [CrossRef] [PubMed]
- Correa, P. Human gastric carcinogenesis: A multistep and multifactorial process—First American Cancer Society award lecture on cancer epidemiology and prevention. Cancer Res. 1992, 52, 6735–6740. [Google Scholar]
- Forman, D. Gastric carcinogenesis: An overview. Eur. J. Gastroenterol. Hepatol. 1994, 6, 1073–1075. [Google Scholar] [CrossRef]
- Gareayaghi, N.; Akkus, S.; Saribas, S.; Demiryas, S.; Ozbey, D.; Kepil, N.; Demirci, M.; Dinc, H.O.; Akcin, R.; Uysal, O.; et al. Epstein-Barr Virus and Helicobacter pylori co-infection in patients with gastric cancer and duodenale ulcer. New Microbiol. 2021, 44, 217–226. [Google Scholar]
- Zullo, A.; Hassan, C.; Andriani, A.; Cristofari, F.; De Francesco, V.; Ierardi, E.; Tomao, S.; Morini, S.; Vaira, D. Eradication Therapy for Helicobacter pylori in Patients with Gastric MALT Lymphoma: A Pooled Data Analysis CME. Off. J. Am. Coll. Gastroenterol. AGG 2009, 104, 1932–1937. [Google Scholar] [CrossRef]
- Oh, J.; Kling-Bäckhed, H.; Giannakis, M.; Xu, J.; Fulton, R.; Fulton, L.; Cordum, H.; Wang, C.; Elliott, G.; Edwards, J.; et al. The complete genome sequence of a chronic atrophic gastritis Helicobacter pylori strain: Evolution during disease progression. Proc. Natl. Acad. Sci. USA 2006, 103, 9999–10004. [Google Scholar] [CrossRef] [Green Version]
- Rocco, A.; Nardone, G. Diet, H pylori infection and gastric cancer: Evidence and controversies. World J. Gastroenterol. WJG 2007, 13, 2901. [Google Scholar] [CrossRef]
- Zhou, X.; Zhang, C.; Wu, J.; Zhang, G. Association between Helicobacter pylori infection and diabetes mellitus: A meta-analysis of observational studies. Diabetes Res. Clin. Pract. 2013, 99, 200–208. [Google Scholar] [CrossRef]
- Shin, D.W.; Kwon, H.T.; Kang, J.M.; Park, J.H.; Choi, H.C.; Park, M.S.; Park, S.M.; Son, K.Y.; Cho, B. Association between metabolic syndrome and Helicobacter pylori infection diagnosed by histologic status and serological status. J. Clin. Gastroenterol. 2016, 46, 840–845. [Google Scholar] [CrossRef] [PubMed]
- Pellicano, R.; Franceschi, F.; Saracco, G.; Fagoonee, S.; Roccarina, D.; Gasbarrini, A. Helicobacters and extragastric diseases. Helicobacter 2009, 14, 58–68. [Google Scholar] [CrossRef] [PubMed]
- Zeng, M.; Mao, X.-H.; Li, J.-X.; Tong, W.-D.; Wang, B.; Zhang, Y.-J.; Guo, G.; Zhao, Z.-J.; Li, L.; Wu, D.-L.; et al. Efficacy, safety, and immunogenicity of an oral recombinant Helicobacter pylori vaccine in children in China: A randomised, double-blind, placebo-controlled, phase 3 trial. Lancet 2015, 386, 1457–1464. [Google Scholar] [CrossRef] [PubMed]
- Go, M.F. Natural history and epidemiology of Helicobacter pylori infection. Aliment. Pharmacol. Ther. 2002, 16, 3–15. [Google Scholar] [CrossRef]
- Maeda, S.; Mentis, A.F. Pathogenesis of Helicobacter pylori infection. Helicobacter 2007, 12, 10–14. [Google Scholar] [CrossRef]
- Brown, L.M. Helicobacter pylori epidemiology and routes of transmission. Epidemiol. Rev. 2000, 22, 283–297. [Google Scholar] [CrossRef]
- Rothenbacher, D.; Brenner, H. Burden of Helicobacter pylori and H. pylori-related diseases in developed countries: Recent developments and future implications. Microbes Infect. 2003, 5, 693–703. [Google Scholar] [CrossRef]
- Lee, J.H.; Kim, S.H.; Han, S.H.; An, J.S.; Lee, E.S.; Kim, Y.S. Clinicopathological and molecular characteristics of Epstein–Barr virus-associated gastric carcinoma: A meta-analysis. J. Gastroenterol. Hepatol. 2009, 24, 354–365. [Google Scholar] [CrossRef]
- Lopes, L.F.; Bacchi, M.M.; Elgui-de-Oliveira, D.; Zanati, S.G.; Alvarenga, M.; Bacchi, C.E. Epstein-Barr virus infection and gastric carcinoma in São Paulo State, Brazil. Braz. J. Med. Biol. Res. 2004, 37, 1707–1712. [Google Scholar] [CrossRef] [Green Version]
- Matsusaka, K.; Kaneda, A.; Nagae, G.; Ushiku, T.; Kikuchi, Y.; Hino, R.; Uozaki, H.; Seto, Y.; Takada, K.; Aburatani, H.; et al. Classification of Epstein–Barr Virus–Positive Gastric Cancers by Definition of DNA Methylation Epigenotypes Methylation in EBV+ Gastric Cancer. Cancer Res. 2011, 71, 7187–7197. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Liu, X.; Liu, M.; Che, K.; Luo, B. Methylation and expression of Epstein-Barr virus latent membrane protein 1, 2A and 2B in EBV-associated gastric carcinomas and cell lines. Dig. Liver Dis. 2016, 48, 673–680. [Google Scholar] [CrossRef] [PubMed]
- Katona, B.W.; Rustgi, A.K. Gastric Cancer Genomics: Advances and Future Directions. Cell. Mol. Gastroenterol. Hepatol. 2017, 3, 211–217. [Google Scholar] [CrossRef] [Green Version]
- Chomet, P.S. Cytosine methylation in gene-silencing mechanisms. Curr. Opin. Cell Biol. 1991, 3, 438–443. [Google Scholar] [CrossRef] [PubMed]
- Ye, P.; Shi, Y.; Li, A. Association between hMLH1 promoter methylation and risk of gastric cancer: A meta-analysisFront Physiol. Front. Physiol. 2018, 9, 368. [Google Scholar] [CrossRef] [Green Version]
- Saridaki, Z.; Souglakos, J.; Georgoulias, V. Prognostic and predictive significance of MSI in stages II/III colon cancer. World J. Gastroenterol. 2014, 20, 6809–6814. [Google Scholar] [CrossRef] [PubMed]
- Hoang, J.M.; Cottu, P.H.; Thuille, B.; Salmon, R.J.; Thomas, G.; Hamelin, R. BAT-26, an indicator of the replication error phenotype in colorectal cancers and cell lines. Cancer Res. 1997, 57, 300–303. [Google Scholar] [PubMed]
- Tayyab Hamid, M.; Mujtaba Yousef, A.S.; Hussain Ali, A.A.; Xu, H. Gastric Intestinal Metaplasia: An Intermediate PrecancerousbLesion in the Cascade of Gastric Carcinogenesis. J. Coll. Physicians Surg. Pak. 2017, 27, 166–172. [Google Scholar]
- Kodama, M.; Murakami, K.; Okimoto, T.; Sato, R.; Watanabe, K.; Fujioka, T. Expression of mutant type-p53 products in H pylori-associated chronic gastritis. World J. Gastroenterol. 2007, 13, 1541–1546. [Google Scholar] [CrossRef] [Green Version]
- Teh, M.; Bing Tan, K.; Leng Seet, B.; Guan Yeoh, K. Study of p53 immunostaining in the gastric epithelium of cagA-positive and cagA-negative Helicobacter pylori gastritis. Cancer 2002, 95, 499–505. [Google Scholar] [CrossRef]
- Lima, V.P.; de Lima, M.A.P.; André, A.R.; Ferreira, M.V.P.; Barros, M.A.P.; Rabenhorst, S.H.B. H. pylori (CagA) and Epstein-Barr virus infection in gastric carcinomas: Correlation with p53 mutation and c-Myc, Bcl-2 and Bax expression. World J. Gastroenterol. 2008, 14, 884–891. [Google Scholar] [CrossRef] [Green Version]
- Datta, J.; Da Silva, E.M.; Kandoth, C.; Song, T.; Russo, A.E.; Hernandez, J.M.; Taylor, B.S.; Janjigian, Y.Y.; Tang, L.H.; Solit, D.B.; et al. Poor survival after resection of early gastric cancer: Extremes of survivorship analysis reveal distinct genomic profile. Br. J. Surg. 2020, 107, 14–19. [Google Scholar] [CrossRef] [PubMed]
- Molinari, C.; Tedaldi, G.; Rebuzzi, F.; Morgagni, P.; Capelli, L.; Ravaioli, S.; Tumedei, M.M.; Scarpi, E.; Tomezzoli, A.; Bernasconi, R.; et al. Early Gastric Cancer: Identification of molecular markers able to distinguish submucosa-penetrating lesions with different prognosis. Gastric. Cancer 2021, 24, 392–401. [Google Scholar] [CrossRef] [PubMed]
- Cancer Genome Atlas Research Network. Comprehensive molecular characterization of gastric adenocarcinoma. Nature 2014, 513, 202–209. [CrossRef] [PubMed] [Green Version]
- Tedaldi, G.; Molinari, C.; José, C.S.; Barbosa-Matos, R.; André, A.; Danesi, R.; Arcangeli, V.; Ravegnani, M.; Saragoni, L.; Morgagni, P.; et al. Genetic and Epigenetic Alterations of CDH1 Regulatory Regions in Hereditary and Sporadic Gastric Cance. Pharmaceuticals 2021, 14, 457. [Google Scholar] [CrossRef]
- Kague, E.; Thomazini, C.M.; de Campo Moura Pardini, M.I.; de Carvalho, F.; Leite, C.V.; Pinheiro, N.A. Methylation status of CDH1 gene in samples of gastric mucous from Brazilian patients with chronic gastritis infected by Helicobacter pylori. Arq. Gastroenterol. 2010, 47, 7–12. [Google Scholar] [CrossRef] [Green Version]
- Mueller, D.; Tegtmeyer, N.; Brandt, S.; Yamaoka, Y.; De Poire, E.; Sgouras, D.; Wessler, S.; Torres, J.; Smolka, A.; Backert, S. c-Src and c-Abl kinases control hierarchic phosphorylation and function of the CagA effector protein in Western and East Asian Helicobacter pylori strains. J. Clin. Investig. 2012, 122, 1553–1566. [Google Scholar] [CrossRef] [Green Version]
- Murata-Kamiya, N.; Kurashima, Y.; Teishikata, Y.; Yamahashi, Y.; Saito, Y.; Higashi, H.; Aburatani, H.; Akiyama, T.; Peek, R.M., Jr.; Azuma, T.; et al. Helicobacter pylori CagA interacts with E-cadherin and deregulates the beta-catenin signal that promotes intestinal transdifferentiation in gastric epithelial cells. Oncogene 2007, 26, 4617–4626. [Google Scholar] [CrossRef] [Green Version]
- Teresa, F.; Serra, N.; Capra, G.; Mascarella, C.; Gagliardi, C.; Di Carlo, P.; Cannella, S.; Simonte, M.R.; Lipari, D.; Sciortino, M.; et al. Helicobacter pylori and Epstein –Barr Virus infection in Gastric disease: Correlation with IL-10 and IL1RN Polymorphism. J. Oncol. 2019, 2019, 1785132. [Google Scholar] [CrossRef] [Green Version]
- Alipov, G.; Nakayama, T.; Nakashima, M.; Wen, C.Y.; Niino, D.; Kondo, H.; Pruglo, Y.; Sekine, I. Epstein-Barr virus-associated gastric carcinoma in Kazakhstan. World J. Gastroenterol. 2005, 11, 27–30. [Google Scholar] [CrossRef]
- Trimeche, M.; Bonnet, C.; Korbi, S.; Boniver, J.; de Leval, L. Association between Epstein-Barr virus and Hodgkin’s lymphoma in Belgium: A pathological and virological study. Leuk. Lymphoma 2007, 48, 1323–1331. [Google Scholar] [CrossRef]
- Moss, S.F. The Clinical Evidence Linking Helicobacter pylori to Gastric Cancer. Cell. Mol. Gastroenterol. Hepatol. 2017, 3, 183–191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, B.; Wang, Y.; Wang, X.F.; Gao, Y.; Huang, B.H.; Zhao, P. Correlation of Epstein-Barr virus and its encoded proteins with Helicobacter pylori and expression of c-met and c-myc in gastric carcinoma. World J. Gastroenterol. 2006, 12, 1842–1848. [Google Scholar] [CrossRef] [PubMed]
- Mosaffa, F.; Kalalinia, F.; Lage, H.; Afshari, J.T.; Behravan, J. Pro-inflammatory cytokines interleukin-1 beta, inter-leukin 6, and tumor necrosis factor-alpha alter the expression and function of ABCG2 in cervix and gas-tric cancer cells. Mol. Cell Biochem. 2012, 363, 385–393. [Google Scholar] [CrossRef]
- Matsusaka, K.; Funata, S.; Fukayama, M.; Kaneda, A. DNA methylation in gastric cancer, related to Helicobacter pylori and Epstein-Barr virus. World J. Gas-Troenterol. 2014, 20, 3916–3926. [Google Scholar] [CrossRef] [PubMed]
- de Lima Silva-Fernandes, I.J.; de Oliveira, E.S.; Santos, J.C.; Ribeiro, M.L.; Ferrasi, A.C.; de Moura Campos Pardini, M.I.; Burbano, R.M.R.; Rabenhorst, S.H.B. The intricate interplay between MSI and polymorphisms of DNA repair enzymes in gastric cancer H. pylori associated. Mutagenesis 2017, 32, 471–478. [Google Scholar] [CrossRef] [Green Version]
- Anagnostopoulos, I.; Hummel, M. Epstein–Barr virus in tumors. Histopathology 1996, 29, 297–315. [Google Scholar] [CrossRef]
- Shinohara, K.; Miyazaki, K.; Noda, N.; Saitoh, D.; Terada, M.; Wakasugi, H. Gastric diseases related to Helicobacter pylori and Epstein– Barr virus infection. Microbiol. Immunol. 1998, 42, 415–421. [Google Scholar] [CrossRef]
- Kikuchi, T.; Itoh, F.; Toyota, M.; Suzuki, H.; Yamamoto, H.; Fujita, M.; Hosokawa, M.; Imai, K. Aberrant methylation and histone deacetylation of cyclooxygenase 2 in gastric cancer. Int. J. Cancer 2002, 97, 272–277. [Google Scholar] [CrossRef] [Green Version]
- Di Carlo, P.; Trizzino, M.; Titone, L.; Capra, G.; Colletti, P.; Mazzola, G.; Pistoia, D.; Sarno, C. Unusual MRI findings in an immunocompetent patient with EBV encephalitis: A case report. BMC Med. Imaging 2011, 11, 6. [Google Scholar] [CrossRef] [Green Version]
- Giardina, A.; Rizzo, A.; Ferrante, A.; Capra, G.; Triolo, G.; Ciccia, F. Giant cell arteritis associated with chronic active Epstein-Barr virus infection. Reumatismo 2013, 65, 36–39. [Google Scholar] [CrossRef] [Green Version]
- Edwards, R.H.; Raab-Traub, H. Alterations of the p53 Gene in Epstein-Barr Virus-Associated Immunodeficiency-Related Lymphomas. J. Virol. 1994, 68, 1309–1315. [Google Scholar] [CrossRef] [Green Version]
- Effert, P.; McCoy, R.; Abdel-Hamid, M.; Flynn, K.; Zhang, Q.; Busson, P.; Tursz, T.; Liu, E.; Raab-Traub, N. Alterations of the p53 gene in nasopharyngeal carcinoma. J. Virol. 1992, 66, 3768–3775. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Herman, J.G.; Graff, J.R.; Myöhänen, S.; Nelkin, B.D.; Baylin, S.B. Methylation-specific PCR: A novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA 1996, 93, 9821–9826. [Google Scholar] [CrossRef] [Green Version]
- Ferrasi, A.C.; Pinheiro, N.A.; Rabenhorst, S.H.B.; Caballero, O.L.; Rodrigues, M.A.M.; de Carvalho, F.; de Souza Leite, C.V.; Ferreira, M.V.P.; Barros, M.A.P.; Pardini, M.I.M.C. Helicobacter pylori and EBV in gastric carcinomas: Methylation status and microsatellite instability. World J. Gastroenterol. 2010, 16, 312–319. [Google Scholar] [CrossRef] [PubMed]
- Dietmaier, W.; Wallinger, S.; Bocker, T.; Kullmann, F.; Fishel, R.; Rüschoff, J. Diagnostic microsatellite instability: Definition and correlation with mismatch repair protein expression. Cancer Res. 1997, 57, 4749–4756. [Google Scholar] [PubMed]
- Sander, J.D.; Joung, J.K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 2014, 32, 347–355. [Google Scholar] [CrossRef] [PubMed]
| Parameters | Sample Data |
|---|---|
| Patients | 100 |
| Age | 58.43 ± 16.52 * |
| Gender | |
| Male | 37% |
| Female | 64% |
| Symptoms | |
| NGM | 25% |
| GCA | 25% |
| GC | 25% |
| ML | 25% |
| Analysis with PCR | |
| No infected | 45% |
| Infected by Hp | 18% |
| Infected by EBV | 11% |
| Co-infected | 26% |
| p53 mutation | |
| exon 5 | 2% |
| exon 6 | 8% |
| exon 7 | 1% |
| exon 8 | 13% |
| exon 9 | 2% |
| Parameters | No-Infected Group (n = 45) | Hp Group (n = 18) | EBV Group (n = 11) | Hp-EBV Group (n = 26) | Statistical Analysis among Groups p-Value (Test) |
|---|---|---|---|---|---|
| Age | p = 0.97 (KW) | ||||
| Mean ± SD | 57.67 ± 18.02 | 58.53 ± 15.26 | 61.09 ± 14.31 | 58.58 ± 16.23 | |
| Median (IQR) | 62 (42.75, 72) | 63 (41.75, 69.5) | 64 (58, 68.5) | 61.5 (52, 68) | |
| Gender | |||||
| Male | 44.44%[20] | 27.78%[5] | 45.45%[5] | 26.92%[7] | p = 0.36 (F) |
| Female | 55.56%[25] | 72.22%[13] | 54.55%[6] | 73.08%[19] | |
| p = 0.46 (B) | p = 0.06 (B) | p = 0.76 (B) | p = 0.0186 (B) * | ||
| Symptoms | |||||
| NGM | 52%[13] | 38.89%[7] | 9.09%[1] | 15.38%[4] | p = 0.66 (F) |
| GCA | 48%[12] | 16.67%[3] | 27.27%[3] | 26.92%[7] | |
| GC | 36%[9] | 16.67%[3] | 36.36%[4] | 34.62%[9] | |
| ML | 44%[11] | 27.78%[5] | 27.27%[3] | 23.08%[6] | |
| p = 0.85 (C) | p = 0.49 (C) | p = 0.63 (C) | p = 0.57 (C) | ||
| Methylation status | |||||
| CDH1 | 8.89%[4] | 16.67%[3] | 18.18%[2] | 19.23%[5] | p = 0.61 (F) |
| DAPK | 8.89%[4] | 16.67%[3] | 0.00%[0] | 7.69%[2] | |
| COX2 | 6.67%[3] | 16.67%[3] | 36.36%[4] | 46.15%[12] | |
| hMLH1 | 4.44%[2] | 11.11%[2] | 18.18%[2] | 15.38%[4] | |
| CDKN2A | 4.44%[2] | 5.56%[1] | 0.00%[0] | 23.08%[6] | |
| p = 0.86 (C) | p = 0.25 (C) | Test no realiable | p = 0.044 * (C) COX2 **, p = 0.0179 * (Z) | ||
| Microsatellite instability | |||||
| MSS | 95.56%[43] | 72.22%[13] | 90.91%[10] | 69.23%[18] | p = 0.0069 * (F) MSS (Hp-EBV) ***, p = 0.0458 (Z) |
| MSI | 4.44%[2] | 27.78%[5] | 9.09%[1] | 30.77%[8] | |
| p < 0.0001 * (B) | p = 0.059 (B) | p = 0.0067 * (B) | p = 0.0499 * (B) | ||
| p53 mutation | |||||
| exon 5 | 2.22%[1] | 0.00%[0] | 0.00%[0] | 3.85%[1] | p = 0.024 * (F) exon 8 (NIG) ***, p = 0.0298 (Z) exon 7 (Hp) ***, p = 0.0415 (Z) |
| exon 6 | 4.44%[2] | 5.56%[1] | 36.36%[4] | 3.85%[1] | |
| exon 7 | 0.0%[0] | 0.00%[0] | 0.00%[0] | 3.85%[1] | |
| exon 8 | 0.0%[0] | 5.56%[1] | 9.09%[1] | 42.31%[11] | |
| exon 9 | 0.0%[0] | 0.00%[0] | 0.00%[0] | 7.69%[2] | |
| Test not realiable | Test no realiable | Test no realiable | p < 0.0001 * (C) exon 8 **, p < 0.0001 * (Z) |
| Logistic Regression | Coefficient | Standard Error | OR | 95% CI | p-Value |
|---|---|---|---|---|---|
| Null model vs. full model | <0.0001 [C] | ||||
| Infection/p53 mutation | 1.83 | 0.69 | 6.21 | 1.6; 24.07 | 0.0082 * |
| Infection/methylation status | 1.33 | 0.50 | 3.78 | 1.43; 10.01 | 0.0075 * |
| Infections/microsatellite instability | 1.13 | 0.85 | 3.10 | 0.58–16.55 | 0.19 |
| Constant | –1.03 | 0.35 | 0.0034 * |
| Parameters | Infected | No Infected | p-Value (Test) |
|---|---|---|---|
| Infection/age | 59.1 ± 15.3 63 (48, 69) | 57.7 ± 18.0 62 (42.75, 72) | 0.85 (MW) |
| Infection/gender | 38F, 17M | 25F, 20M | 0.17 (C) |
| Infection/symptoms | 12 (no), 43 (yes) | 13 (no), 32 (yes) | 0.42 (C) |
| Infection/p53 mutation | 33 (no), 22 (yes) | 42 (no), 3 (yes) | 0.0001 * (F) |
| Infection/methylation status | 13 (no), 42 (yes) | 30 (no), 15 (yes) | <0.0001 * (C) |
| Infections/microsatellite instability | 41 (no), 14 (yes) | 43 (no), 2 (yes) | 0.0052 * (F) |
| Exon | Primer | Sequence | Fragment Length |
|---|---|---|---|
| P1 | GACGGAATTCGTCCCAAGCAATGGATGAT | 2.9 kb | |
| P2 | GTCAGTCGACCTTAGTACCTGAAGGGTGA | ||
| 5 | P3 | TTCCTCTTCCTGCAGTACT | 209 bp |
| P4 | AGCTGCTCACCATCGCTAT | ||
| 6 | P5 | GGCCTCTGATTCCTCACTGA | 170 bp |
| P6 | GCCACTGACAACCACCCTTA | ||
| 7 | P7 | TGTTGTCTCCTAGGTTGGCT | 139 bp |
| P8 | CAAGTGGCTCCTGACCTGGA | ||
| 8 | P9 | CCTATCCTGAGTAGTGGTAA | 164 bp |
| P10 | TCCTGCTTGCTTACCTCGCT | ||
| 9 | P9 | CCTATCCTGAGTAGTGGTAA | 320 bp |
| P2 | GTCAGTCGACCTTAGTACCTGAAGGGTGA |
| Gene | Primer [5′-3′] Forward | Primer [5′-3′] Reverse | Size [bp] |
|---|---|---|---|
| COX2 | M TTAGATACGGCGGCGGCGGC | TCTTTACCCGAACGCTTCCG | 161 |
| U ATAGATTAGATATGGTGGTGGTGGT | CACAATCTTTACCCAAACACTTCCA | 171 | |
| DAPK | M GGATAGTCGGATCGAGTTAACGTC | CCCTCCCAAACGCCGA | 98 |
| U GGAGGATAGTTGGATTGAGTTAATGTT | CAAATCCCTCCCAAACACCAA | 116 | |
| CDH1 | M TTAGGTTAGAGGGTTATCGCGT | TAACTAAAAATTCACCTACCGAC | 115 |
| U TAATTTTAGGTTAGAGGGTTATTGT | CACAACCAATCAACAACACA | 97 | |
| hMLH1 | M TATATCGTTCGTAGTATTCGTGT | ACCACCTCATCATAACTACCCACA | 153 |
| U TTTTGATGTAGATGTTTTATTAGGGTTGT | ACCACCTCATCATAACTACCCACA | 124 | |
| CDKN2A | M TTATTAGAGGGTGGGGCGGATCGC | GACCCCGAACCGCGACCGTAA | 150 |
| U TTATTAGAGGGTGGGGTGGATTGT | CAACCCCAAACCACAACCATAA | 151 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Giammanco, A.; Anzalone, R.; Serra, N.; Graceffa, G.; Vieni, S.; Scibetta, N.; Rea, T.; Capra, G.; Fasciana, T. Helicobacter pylori and Epstein–Barr Virus Co-Infection in Gastric Disease: What Is the Correlation with p53 Mutation, Genes Methylation and Microsatellite Instability in a Cohort of Sicilian Population? Int. J. Mol. Sci. 2023, 24, 8104. https://doi.org/10.3390/ijms24098104
Giammanco A, Anzalone R, Serra N, Graceffa G, Vieni S, Scibetta N, Rea T, Capra G, Fasciana T. Helicobacter pylori and Epstein–Barr Virus Co-Infection in Gastric Disease: What Is the Correlation with p53 Mutation, Genes Methylation and Microsatellite Instability in a Cohort of Sicilian Population? International Journal of Molecular Sciences. 2023; 24(9):8104. https://doi.org/10.3390/ijms24098104
Chicago/Turabian StyleGiammanco, Anna, Rita Anzalone, Nicola Serra, Giuseppa Graceffa, Salvatore Vieni, Nunzia Scibetta, Teresa Rea, Giuseppina Capra, and Teresa Fasciana. 2023. "Helicobacter pylori and Epstein–Barr Virus Co-Infection in Gastric Disease: What Is the Correlation with p53 Mutation, Genes Methylation and Microsatellite Instability in a Cohort of Sicilian Population?" International Journal of Molecular Sciences 24, no. 9: 8104. https://doi.org/10.3390/ijms24098104
APA StyleGiammanco, A., Anzalone, R., Serra, N., Graceffa, G., Vieni, S., Scibetta, N., Rea, T., Capra, G., & Fasciana, T. (2023). Helicobacter pylori and Epstein–Barr Virus Co-Infection in Gastric Disease: What Is the Correlation with p53 Mutation, Genes Methylation and Microsatellite Instability in a Cohort of Sicilian Population? International Journal of Molecular Sciences, 24(9), 8104. https://doi.org/10.3390/ijms24098104

