Influence of Leptin on the Secretion of Growth Hormone in Ewes under Different Photoperiodic Conditions
Abstract
1. Introduction
2. Results
2.1. The Effect of Leptin and Photoperiod on the Plasma Concentration of GH
2.2. Gene Expression
2.2.1. The Effect of Leptin on the Relative Expression of HPS Axis-Associated Genes in the ARC and PVN
2.2.2. The Effect of Leptin on the Relative Expression of HPS Axis-Associated Genes in the AP
3. Discussion
4. Material and Methods
4.1. Animals
- Control—intravenously treated with 0.9% w/v NaCl (Baxter, Deerfield, IL, USA) in a volume equal to that used in the experimental group;
- LEP—intravenously injected with ovine recombinant leptin (Protein Laboratories Rehovot (PLR) Ltd., Rehovot, Israel) at a dose of 20 µg/kg body weight suspended in saline (0.9% w/v NaCl, Baxter, Deerfield, IL, USA). The leptin dose was selected based on the dose used by Maciel et al. [56] for growing beef heifers.
4.2. Real-Time (RT)-PCR Assay
4.3. Radioimmunological Assay
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wójcik, M.; Krawczyńska, A.; Antushevich, H.; Herman, A. Post-Receptor Inhibitors of the GHR-JAK2-STAT Pathway in the Growth Hormone Signal Transduction. IJMS 2018, 19, 1843. [Google Scholar] [CrossRef] [Scilit]
- Tannenbaum, G.S.; Gurd, W.; Lapointe, M. Leptin Is a Potent Stimulator of Spontaneous Pulsatile Growth Hormone (GH) Secretion and the GH Response to GH-Releasing Hormone. Endocrinology 1998, 139, 3871–3875. [Google Scholar] [CrossRef]
- Zieba, D.; Amstalden, M.; Morton, S.; Gallino, J.; Edwards, J.; Harms, P.; Williams, G. Effects of Leptin on Basal and GHRH-Stimulated GH Secretion from the Bovine Adenohypophysis Are Dependent upon Nutritional Status. J. Endocrinol. 2003, 178, 83–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fietta, P. Focus on Leptin, a Pleiotropic Hormone. Minerva Med. 2005, 96, 65–75. [Google Scholar] [PubMed]
- Obradovic, M.; Sudar-Milovanovic, E.; Soskic, S.; Essack, M.; Arya, S.; Stewart, A.J.; Gojobori, T.; Isenovic, E.R. Leptin and Obesity: Role and Clinical Implication. Front. Endocrinol. 2021, 12, 585887. [Google Scholar] [CrossRef] [Scilit]
- Watanobe, H.; Habu, S. Leptin Regulates Growth Hormone-Releasing Factor, Somatostatin, and α-Melanocyte-Stimulating Hormone But Not Neuropeptide Y Release in Rat Hypothalamus In Vivo: Relation with Growth Hormone Secretion. J. Neurosci. 2002, 22, 6265–6271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gruzdeva, O.; Borodkina, D.; Uchasova, E.; Dyleva, Y.; Barbarash, O. Leptin Resistance: Underlying Mechanisms and Diagnosis. Diabetes Metab. Syndr. Obes. Targets Ther. 2019, 12, 191–198. [Google Scholar] [CrossRef] [Scilit]
- Walton, J.C.; Weil, Z.M.; Nelson, R.J. Influence of Photoperiod on Hormones, Behavior, and Immune Function. Front. Neuroendocrinol. 2011, 32, 303–319. [Google Scholar] [CrossRef] [Scilit]
- Webster, J.R.; Corson, I.D.; Littlejohn, R.P.; Stuart, S.K.; Suttie, J.M. Effects of Season and Nutrition on Growth Hormone and Insulin-like Growth Factor-I in Male Red Deer. Endocrinology 1996, 137, 698–704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wójcik, M.; Herman, A.P.; Zieba, D.A.; Krawczyńska, A. The Impact of Photoperiod on the Leptin Sensitivity and Course of Inflammation in the Anterior Pituitary. IJMS 2020, 21, 4153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Molik, E.; Misztal, T.; Romanowicz, K.; Zieba, D. Short-Day and Melatonin Effects on Milking Parameters, Prolactin Profiles and Growth-Hormone Secretion in Lactating Sheep. Small Rumin. Res. 2013, 109, 182–187. [Google Scholar] [CrossRef] [Scilit]
- Misztal, T.; Romanowicz, K.; Barcikowski, B. Seasonal Changes of Melatonin Secretionin Relation to the Reproductive Cycle in Sheep. J. Anim. Feed Sci. 1996, 5, 35–48. [Google Scholar] [CrossRef] [Scilit]
- Szczesna, M.; Zieba, D.A. Phenomenon of Leptin Resistance in Seasonal Animals: The Failure of Leptin Action in the Brain. Domest. Anim. Endocrinol. 2015, 52, 60–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zieba, D.A.; Klocek, B.; Williams, G.L.; Romanowicz, K.; Boliglowa, L.; Wozniak, M. In Vitro Evidence That Leptin Suppresses Melatonin Secretion during Long Days and Stimulates Its Secretion during Short Days in Seasonal Breeding Ewes. Domest. Anim. Endocrinol. 2007, 33, 358–365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szczesna, M.; Zieba, D.A.; Klocek-Gorka, B.; Misztal, T.; Stepien, E. Seasonal Effects of Central Leptin Infusion and Prolactin Treatment on Pituitary SOCS-3 Gene Expression in Ewes. J. Endocrinol. 2011, 208, 81–88. [Google Scholar] [CrossRef] [Scilit]
- Buonfiglio, D.; Parthimos, R.; Dantas, R.; Cerqueira Silva, R.; Gomes, G.; Andrade-Silva, J.; Ramos-Lobo, A.; Amaral, F.G.; Matos, R.; Sinésio, J.; et al. Melatonin Absence Leads to Long-Term Leptin Resistance and Overweight in Rats. Front. Endocrinol. 2018, 9, 122. [Google Scholar] [CrossRef] [Scilit]
- Buonfiglio, D.; Tchio, C.; Furigo, I.; Donato, J.; Baba, K.; Cipolla-Neto, J.; Tosini, G. Removing Melatonin Receptor Type 1 Signaling Leads to Selective Leptin Resistance in the Arcuate Nucleus. J. Pineal. Res. 2019, 67, e12580. [Google Scholar] [CrossRef] [Scilit]
- Luque, R.M.; Huang, Z.H.; Shah, B.; Mazzone, T.; Kineman, R.D. Effects of Leptin Replacement on Hypothalamic-Pituitary Growth Hormone Axis Function and Circulating Ghrelin Levels in Ob/Ob Mice. Am. J. Physiol.-Endocrinol. Metab. 2007, 292, E891–E899. [Google Scholar] [CrossRef] [Scilit]
- Nagatani, S.; Zeng, Y.; Keisler, D.H.; Foster, D.L.; Jaffe, C.A. Leptin Regulates Pulsatile Luteinizing Hormone and Growth HormoneSecretion in the Sheep**This Work Was Supported by a V.A. Merit Award (to C.A.J.), NIH Grants HD-18258 and HD-18394 (to D.L.F.), and Michigan Diabetes Research and Training Center Grant 2P60-DK-20572-21. A Preliminary Report of This Work Was Presented at the 82nd Annual Meeting of The Endocrine Society. Endocrinology 2000, 141, 3965–3975. [Google Scholar] [CrossRef]
- Chen, C.; Roh, S.-G.; Nie, G.-Y.; Loneragan, K.; Xu, R.-W.; Ruan, M.; Clarke, I.J.; Goding, J.W.; Gertler, A. The In Vitro Effect of Leptin on Growth Hormone Secretion from Primary Cultured Ovine Somatotrophs. ENDO 2001, 14, 073–078. [Google Scholar] [CrossRef] [Scilit]
- Mizuno, I.; Okimura, Y.; Takahashi, Y.; Kaji, H.; Abe, H.; Chihara, K. Leptin Stimulates Basal and GHRH-Induced GH Release from Cultured Rat Anterior Pituitary Cells in Vitro. Kobe J. Med. Sci. 1999, 45, 221–227. [Google Scholar] [PubMed]
- Roh, S.-G.; Nie, G.-Y.; Loneragan, K.; Gertler, A.; Chen, C. Direct Modification of Somatotrope Function by Long-Term Leptin Treatment of Primary Cultured Ovine Pituitary Cells. Endocrinology 2001, 142, 5167–5171. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Zhong, Y.; Pei, J.; Zhu, Y.; Hu, Y.; Chi, S.; Kaye, A.D. Inhibitory Effect of Leptin on Growth Hormone Secretion of GH3 Cells: Involvement of Cell Proliferation, Apoptosis and Intracellular Free Ca2+. Cytokine 2009, 46, 245–250. [Google Scholar] [CrossRef] [Scilit]
- Roh, S.-G.; Clarke, I.J.; Xu, R.-W.; Goding, J.W.; Loneragan, K.; Chen, C. The in Vitro Effect of Leptin OnBasal and Growth Hormone-Releasing Hormone-StimulatedGrowth Hormone Secretion from TheOvine Pituitary Gland. Neuroendocrinology 1998, 68, 361–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krawczyńska, A.; Herman, A.P.; Antushevich, H.; Bochenek, J.; Wojtulewicz, K.; Zieba, D.A. The Effect of Leptin on the Blood Hormonal Profile (Cortisol, Insulin, Thyroid Hormones) of the Ewe in Acute Inflammation in Two Different Photoperiodical Conditions. IJMS 2022, 23, 8109. [Google Scholar] [CrossRef] [Scilit]
- Marie, M.; Findlay, P.; Thomas, L.; Adam, C. Daily Patterns of Plasma Leptin in Sheep: Effects of Photoperiod and Food Intake. J. Endocrinol. 2001, 170, 277–286. [Google Scholar] [CrossRef] [Scilit]
- Szczesna, M.; Zieba, D.A.; Klocek-Gorka, B.; Keisler, D.H. Interactive in Vitro Effect of Prolactin, Growth Hormone and Season on Leptin Secretion by Ovine Adipose Tissue. Small Rumin. Res. 2011, 100, 177–183. [Google Scholar] [CrossRef] [Scilit]
- Jin, L.; Burguera, B.G.; Couce, M.E.; Scheithauer, B.W.; Lamsan, J.; Eberhardt, N.L.; Kulig, E.; Lloyd, R.V. Leptin and Leptin Receptor Expression in Normal and Neoplastic Human Pituitary: Evidence of a Regulatory Role for Leptin on Pituitary Cell Proliferation. J. Clin. Endocrinol. Metab. 1999, 84, 2903–2911. [Google Scholar] [CrossRef] [Scilit]
- Allensworth-James, M.L.; Odle, A.; Haney, A.; Childs, G. Sex Differences in Somatotrope Dependency on Leptin Receptors in Young Mice: Ablation of LEPR Causes Severe Growth Hormone Deficiency and Abdominal Obesity in Males. Endocrinology 2015, 156, 3253–3264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faouzi, M.; Leshan, R.; Björnholm, M.; Hennessey, T.; Jones, J.; Münzberg, H. Differential Accessibility of Circulating Leptin to Individual Hypothalamic Sites. Endocrinology 2007, 148, 5414–5423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Spiezio, A.; Sandin, E.S.; Dore, R.; Müller-Fielitz, H.; Storck, S.E.; Bernau, M.; Mier, W.; Oster, H.; Jöhren, O.; Pietrzik, C.U.; et al. The LepR-Mediated Leptin Transport across Brain Barriers Controls Food Reward. Mol. Metab. 2018, 8, 13–22. [Google Scholar] [CrossRef] [Scilit]
- Zlokovic, B.V.; Jovanovic, S.; Miao, W.; Samara, S.; Verma, S.; Farrell, C.L. Differential Regulation of Leptin Transport by the Choroid Plexus and Blood-Brain Barrier and High Affinity Transport Systems for Entry into Hypothalamus and across the Blood-Cerebrospinal Fluid Barrier. Endocrinology 2000, 141, 1434–1441. [Google Scholar] [CrossRef]
- Banks, W.A.; Kastin, A.J.; Huang, W.; Jaspan, J.B.; Maness, L.M. Leptin Enters the Brain by a Saturable System Independent of Insulin. Peptides 1996, 17, 305–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balland, E.; Dam, J.; Langlet, F.; Caron, E.; Steculorum, S.; Messina, A.; Rasika, S.; Falluel-Morel, A.; Anouar, Y.; Dehouck, B.; et al. Hypothalamic Tanycytes Are an ERK-Gated Conduit for Leptin into the Brain. Cell. Metab. 2014, 19, 293–301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hileman, S.M.; Pierroz, D.D.; Masuzaki, H.; Bjørbaek, C.; El-Haschimi, K.; Banks, W.A.; Flier, J.S. Characterizaton of Short Isoforms of the Leptin Receptor in Rat Cerebral Microvessels and of Brain Uptake of Leptin in Mouse Models of Obesity. Endocrinology 2002, 143, 775–783. [Google Scholar] [CrossRef] [PubMed]
- Banks, W.A.; Niehoff, M.L.; Martin, D.; Farrell, C.L. Leptin Transport across the Blood-Brain Barrier of the Koletsky Rat Is Not Mediated by a Product of the Leptin Receptor Gene. Brain Res. 2002, 950, 130–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tavares, M.R.; Frazao, R.; Donato, J. Understanding the Role of Growth Hormone in Situations of Metabolic Stress. J. Endocrinol. 2023, 256, e220159. [Google Scholar] [CrossRef] [Scilit]
- Donato, J.; Wasinski, F.; Furigo, I.C.; Metzger, M.; Frazão, R. Central Regulation of Metabolism by Growth Hormone. Cells 2021, 10, 129. [Google Scholar] [CrossRef] [Scilit]
- Hull, K.; Harvey, S. GH as a Co-Gonadotropin: The Relevance of Correlative Changes in GH Secretion and Reproductive State. J. Endocrinol. 2002, 172, 1–19. [Google Scholar] [CrossRef] [Scilit]
- Zieba, D.A.; Biernat, W.; Szczesna, M.; Kirsz, K.; Barć, J.; Misztal, T. Changes in Expression of the Genes for the Leptin Signaling in Hypothalamic-Pituitary Selected Areas and Endocrine Responses to Long-Term Manipulation in Body Weight and Resistin in Ewes. IJMS 2020, 21, 4238. [Google Scholar] [CrossRef] [Scilit]
- Shi, Z.; Pelletier, N.E.; Wong, J.; Li, B.; Sdrulla, A.D.; Madden, C.J.; Marks, D.L.; Brooks, V.L. Leptin Increases Sympathetic Nerve Activity via Induction of Its Own Receptor in the Paraventricular Nucleus. eLife 2020, 9, e55357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, Z.; Brooks, V.L. Leptin Differentially Increases Sympathetic Nerve Activity and Its Baroreflex Regulation in Female Rats: Role of Oestrogen: Leptin Increases Sympathetic Nerve Activity in Females. J. Physiol. 2015, 593, 1633–1647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, M.G.; Amstalden, M.; Hallford, D.M.; Silver, G.A.; Garcia, M.D.; Keisler, D.H.; Williams, G.L. Dynamics of GHRH in Third-Ventricle Cerebrospinal Fluid of Cattle: Relationship with Serum Concentrations of GH and Responses to Appetite-Regulating Peptides. Domest. Anim. Endocrinol. 2009, 37, 196–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cocchi, D.; De Gennaro Colonna, V.; Bagnasco, M.; Bonacci, D.; Muller, E. Leptin Regulates GH Secretion in the Rat by Acting on GHRH and Somatostatinergic Functions. J. Endocrinol. 1999, 162, 95–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Córdoba-Chacón, J.; Gahete, M.D.; Culler, M.D.; Castaño, J.P.; Kineman, R.D.; Luque, R.M. Somatostatin Dramatically Stimulates Growth Hormone Release from Primate Somatotrophs Acting at Low Doses Via Somatostatin Receptor 5 and Cyclic AMP: Direct Effects of Somatostatin on GH Release. J. Neuroendocrinol. 2012, 24, 453–463. [Google Scholar] [CrossRef] [Scilit]
- Kumar, U.; Laird, D.; Srikant, C.B.; Escher, E.; Patel, Y.C. Expression of the Five Somatostatin Receptor (SSTR1-5) Subtypes in Rat Pituitary Somatotrophes: Quantitative Analysis by Double-Label Immunofluorescence Confocal Microscopy. Endocrinology 1997, 138, 4473–4476. [Google Scholar] [CrossRef]
- Ben-Shlomo, A.; Pichurin, O.; Khalafi, R.; Zhou, C.; Chesnokova, V.; Ren, S.-G.; Liu, N.-A.; Melmed, S. Constitutive Somatostatin Receptor Subtype 2 Activity Attenuates GH Synthesis. Endocrinology 2013, 154, 2399–2409. [Google Scholar] [CrossRef] [Scilit]
- Shimon, I.; Taylor, J.E.; Dong, J.Z.; Bitonte, R.A.; Kim, S.; Morgan, B.; Coy, D.H.; Culler, M.D.; Melmed, S. Somatostatin Receptor Subtype Specificity in Human Fetal Pituitary Cultures. Differential Role of SSTR2 and SSTR5 for Growth Hormone, Thyroid-Stimulating Hormone, and Prolactin Regulation. J. Clin. Investig. 1997, 99, 789–798. [Google Scholar] [CrossRef] [Scilit]
- Eigler, T.; Ben-Shlomo, A.; Zhou, C.; Khalafi, R.; Ren, S.-G.; Melmed, S. Constitutive Somatostatin Receptor Subtype-3 Signaling Suppresses Growth Hormone Synthesis. Mol. Endocrinol. 2014, 28, 554–564. [Google Scholar] [CrossRef] [Scilit]
- Zheng, H.; Bailey, A.; Jiang, M.-H.; Honda, K.; Chen, H.Y.; Trumbauer, M.E.; Van der Ploeg, L.H.T.; Schaeffer, J.M.; Leng, G.; Smith, R.G. Somatostatin Receptor Subtype 2 Knockout Mice Are Refractory to Growth Hormone-Negative Feedback on Arcuate Neurons. Mol. Endocrinol. 1997, 11, 1709–1717. [Google Scholar] [CrossRef]
- Norman, M.; Moldovan, S.; Seghers, V.; Wang, X.-P.; DeMayo, F.J.; Brunicardi, F.C. Sulfonylurea Receptor Knockout Causes Glucose Intolerance in Mice That Is Not Alleviated by Concomitant Somatostatin Subtype Receptor 5 Knockout. Ann. Surg. 2002, 235, 767–774. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luque, R.M.; Gahete, M.D.; Hochgeschwender, U.; Kineman, R.D. Evidence That Endogenous SST Inhibits ACTH and Ghrelin Expression by Independent Pathways. Am. J. Physiol.-Endocrinol. Metab. 2006, 291, E395–E403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kreienkamp, H.J.; Akgün, E.; Baumeister, H.; Meyerhof, W.; Richter, D. Somatostatin Receptor Subtype 1 Modulates Basal Inhibition of Growth Hormone Release in Somatotrophs. FEBS Lett. 1999, 462, 464–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Modarai, S.R.; Opdenaker, L.M.; Viswanathan, V.; Fields, J.Z.; Boman, B.M. Somatostatin Signaling via SSTR1 Contributes to the Quiescence of Colon Cancer Stem Cells. BMC Cancer 2016, 16, 941. [Google Scholar] [CrossRef] [Scilit]
- Schäfer, J.; Meyerhof, W. Sst1 MRNA Is the Prominent Somatostatin Receptor MRNA in the Rat Gastrointestinal Tract: Reverse Transcription Polymerase Chain Reaction and in Situ-Hybridization Study. Neuropeptides 1999, 33, 457–463. [Google Scholar] [CrossRef] [Scilit]
- Maciel, M.N.; Zieba, D.A.; Amstalden, M.; Keisler, D.H.; Neves, J.P.; Williams, G.L. Chronic Administration of Recombinant Ovine Leptin in Growing Beef Heifers: Effects on Secretion of LH, Metabolic Hormones, and Timing of Puberty1. J. Anim. Sci. 2004, 82, 2930–2936. [Google Scholar] [CrossRef] [Scilit]
- Przybył, B.; Wójcik-Gładysz, A.; Gajewska, A.; Szlis, M. Brain-Derived Neurotrophic Factor (BDNF) Affects Somatotrophicaxis Activity in Sheep. J. Anim. Feed Sci. 2021, 30, 329–339. [Google Scholar] [CrossRef] [Scilit]
- Szczepkowska, A.; Bochenek, J.; Wójcik, M.; Tomaszewska-Zaremba, D.; Antushevich, H.; Tomczyk, M.; Skipor, J.; Herman, A. Effect of Caffeine on Adenosine and Ryanodine Receptorgene Expression in the Hypothalamus, Pituitary, and Choroidplexus in Ewes under Basal and LPS Challenge Conditions. J. Anim. Feed Sci. 2022, 32, 17–25. [Google Scholar] [CrossRef] [Scilit]
- Krawczyńska, A.; Herman, A.P.; Antushevich, H.; Bochenek, J.; Wojtulewicz, K.; Zięba, D.A. The Influence of Photoperiod on the Action of Exogenous Leptin on Gene Expression of Proinflammatory Cytokines and Their Receptors in the Thoracic Perivascular Adipose Tissue (PVAT) in Ewes. Mediat. Inflamm. 2019, 2019, 7129476. [Google Scholar] [CrossRef] [Scilit]
- Krawczyńska, A.; Antushevich, H.; Bochenek, J.; Wojtulewicz, K.; Pawlina, B.; Herman, A.; Zięba, D. Photoperiodic Conditions as a Factor Modulating Leptin Influence on Pro-Inflammatory Cytokines and Their Receptors Gene Expression in Ewe’s Aorta. J. Anim. Feed. Sci. 2019, 28, 128–137. [Google Scholar] [CrossRef] [Scilit]
- Haziak, K.; Herman, A.P.; Tomaszewska-Zaremba, D. Effects of Central Injection of Anti-LPS Antibody and Blockade of TLR4 on GnRH/LH Secretion during Immunological Stress in Anestrous Ewes. Mediat. Inflamm. 2014, 2014, 867170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dvorak, P.; Becka, S.; Krejci, P.; Chrpova, M. Radioimmunoassay of Bovine Growth Hormone. Radiochem. Radioanal. Lett. 1978, 34, 155–159. [Google Scholar]

| Hypothalamic Structure | Gene | Control SD | Leptin SD | Control LD | Leptin LD |
|---|---|---|---|---|---|
| Arcuate nucleus (ARC) | GHRH | 1 ± 0.08 A | 1.2 ± 0.04 A | 1.54 ± 0.11 B | 1.72 ± 0.14 B |
| LEPR | 1 ± 0.24 B | 0.95 ± 0.17 B | 0.58 ± 0.03 A | 0.66 ± 0.09 A | |
| Paraventricular nucleus (PVN) | SST | 1 ± 0.09 A | 1.17 ± 0.15 AB | 1.81 ± 0.4 B | 1.3 ± 0.19 AB |
| LEPR | 1 ± 0.13 B | 1.31 ± 0.11 C | 0.91 ± 0.03 B | 0.6 ± 0.08 A |
| Gene | Anterior Pituitary | |||
|---|---|---|---|---|
| Control SD | Leptin SD | Control LD | Leptin LD | |
| GHRHR | 1 ± 0.06 | 0.92 ± 0.1 | 0.90 ± 0.10 | 1.00 ± 0.08 |
| SSTR1 | 1 ± 0.07 B | 1.19 ± 0.13 B | 0.37 ± 0.03 A | 0.43 ± 0.05 A |
| SSTR2 | 1 ± 0.32 A | 0.69 ± 0.13 A | 5.45 ± 0.77 B | 7.51 ± 0.61 C |
| SSTR3 | 1 ± 0.08 | 0.90 ± 0.07 | 1.01 ± 0.09 | 1.03 ± 0.04 |
| SSTR5 | 1 ± 0.08 | 0.90 ± 0.07 | 1.01 ± 0.09 | 1.03 ± 0.04 |
| GH | 1 ± 0.06 B | 1.05 ± 0.03 B | 0.81 ± 0.06 A | 0.7 ± 0.05 A |
| LEPR | 1 ± 0.19 B | 1 ± 0.12 B | 0.57 ± 0.14 A | 0.55 ± 0.08 A |
| Gene Symbol | Primer | Gene Bank Accession Number | References | |
|---|---|---|---|---|
| Forward | Reverse | |||
| GH | TTCCTCAGCAGAGTCTTCACC | GGGGTAACATCTTCCAGCTC | XM_027973953.1 | Originally designed |
| GHR | ACTGTTAGCCCAAGTATTCC | ATATGGCAAGTTCAGTGAGG | XM_012096677.3 | Originally designed |
| GHRH | CCTCTCAGGATTCCACGGTA | CGTACCTTTGCTCCTTGCTC | XM_027976451.1 | Originally designed |
| GHRHR | CTTCTCTCACTTCAGCTTGG | GGATTTCTCCTTCAGTCAGC | NM_001009454.3 | Originally designed |
| SST | CTCCATCGTCCTGGCTCTT | AGTACTTGGCCAGTTCCTGTTT | XM_027966037.1 | Originally designed |
| SSTR1 | ACTCCATGGTCATCTACGTG | GAAGCAATGTGGAGGTGAC | XM_012098844.3 | Originally designed |
| SSTR2 | TCTCTCTGCTGGTCATCTTG | CGTAGATGATGAACCCTGTG | XM_004013144.4 | Originally designed |
| SSTR3 | CACTGGTCTATCTGGTGGTG | TTGAGGATGTAGACATTGGTG | XM_004006732.4 | Originally designed |
| SSTR5 | TGGTCATCTATGTGGTCCTG | AGTAGGAGATGGCGTTTTG | NM_001009265.1 | Originally designed |
| LEPR | CTGTGCCAACAGCCAAACT | GTGGATCAGGCTTCACAACA | NM_001009763.1 | [59] |
| ACTB | GCCAACCGTGAGAAGATGAC | TCCATCACGATGCCAGTG | NM_001009784.2 | [60] |
| GAPDH | TGACCCCTTCATTGACCTTC | GATCTCGCTCCTGGAAGATG | NM_001190390.1 | [61] |
| HDAC1 | CTGGGGACCTACGGGATATT | GACATGACCGGCTTGAAAAT | XM_004005023.3 | [58] |
| PPIC | TGGCACTGGTGGTATAAGCA | GGGCTTGGTCAAGGTGATAA | XM_004008676.5 | [61] |
| B2M | CTTCTGTCCCACGCTGAGTT | GGTGCTTAGAGGTCTCG | XM_012180604.3 | Originally designed |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wójcik, M.; Krawczyńska, A.; Zieba, D.A.; Antushevich, H.; Herman, A.P. Influence of Leptin on the Secretion of Growth Hormone in Ewes under Different Photoperiodic Conditions. Int. J. Mol. Sci. 2023, 24, 8036. https://doi.org/10.3390/ijms24098036
Wójcik M, Krawczyńska A, Zieba DA, Antushevich H, Herman AP. Influence of Leptin on the Secretion of Growth Hormone in Ewes under Different Photoperiodic Conditions. International Journal of Molecular Sciences. 2023; 24(9):8036. https://doi.org/10.3390/ijms24098036
Chicago/Turabian StyleWójcik, Maciej, Agata Krawczyńska, Dorota Anna Zieba, Hanna Antushevich, and Andrzej Przemysław Herman. 2023. "Influence of Leptin on the Secretion of Growth Hormone in Ewes under Different Photoperiodic Conditions" International Journal of Molecular Sciences 24, no. 9: 8036. https://doi.org/10.3390/ijms24098036
APA StyleWójcik, M., Krawczyńska, A., Zieba, D. A., Antushevich, H., & Herman, A. P. (2023). Influence of Leptin on the Secretion of Growth Hormone in Ewes under Different Photoperiodic Conditions. International Journal of Molecular Sciences, 24(9), 8036. https://doi.org/10.3390/ijms24098036

