Methylation of Immune Gene Promoters in Oral and Oropharyngeal Cancer
Abstract
:1. Introduction
2. Results
3. Discussion
4. Material and Methods
4.1. Study Group
4.2. DNA Preparation
4.3. Bisulfite Conversion
4.4. Genes and Primers Design
4.5. Methylation Analysis by MSP
4.6. Statistical Methods
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. Globocan 2012: Estimated Cancer Incidence, Mortality and Prevalence Worldwide in 2012. Available online: http://globocan.iarc.fr/Default.aspx (accessed on 21 June 2012).
- Glorieux, M.; Dok, R.; Nuyts, S. Novel DNA targeted therapies for head and neck cancers: Clinical potential and biomarkers. Oncotarget 2017, 8, 81662–81678. [Google Scholar] [CrossRef] [PubMed]
- Arantes, L.M.P.B.; de Carvalho, A.C.; Melendez, M.E.; Carvalho, A.L. Serum, plasma and saliva biomarkers for head and neck cancer. Expert Rev. Mol. Diagn. 2017, 18, 85–112. [Google Scholar] [CrossRef] [PubMed]
- De Martel, C.; Plummer, M.; Vignat, J.; Franceschi, S. Worldwide burden of cancer attributable to HPV by site, country and HPV type. Int. J. Cancer. 2017, 141, 664–670. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Ye, M.; Ni, S.; Li, Q.; Ye, D.; Li, J.; Shen, Z.; Deng, H. DNA methylation biomarkers for head and neck squamous cell carcinoma. Epigenetics 2018, 13, 398–409. [Google Scholar] [CrossRef] [PubMed]
- Yoder, J.A.; Walsh, C.P.; Bestor, T.H. Cytosine methylation and the ecology of intragenomic parasites. Trends Genet. 1997, 13, 335–340. [Google Scholar] [CrossRef] [PubMed]
- Hibma, M.H. The immune response to papillomavirus during infection persistence and regression. Open Virol. J. 2012, 6, 241–248. [Google Scholar] [CrossRef] [PubMed]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef]
- Sanchez-Cespedes, M.; Esteller, M.; Wu, L.; Nawroz-Danish, H.; Yoo, G.H.; Koch, W.M.; Jen, J.; Herman, J.G.; Sidransky, D. Gene Promoter Hypermethylation in Tumors and Serum of Head and Neck Cancer Patients. Cancer Res. 2000, 60, 892–895. [Google Scholar]
- Demokan, S.; Suoglu, Y.; Demir, D.; Gozeler, M.; Dalay, N. Microsatellite instability and methylation of the DNA mismatch repair genes in head and neck cancer. Ann. Oncol. 2006, 17, 995–999. [Google Scholar] [CrossRef]
- Sasidharan, N.V.; Toor, S.M.; Taha, R.Z.; Shaath, H.; Elkord, E. DNA methylation and repressive histones in the promoters of PD-1, CTLA-4, TIM-3, LAG-3, TIGIT, PD-L1, and galectin-9 genes in human colorectal cancer. Clin. Epigenet. 2018, 10, 104. [Google Scholar] [CrossRef]
- Pan, Y.; Liu, G.; Zhou, F.; Su, B.; Li, Y. DNA methylation profiles in cancer diagnosis and therapeutics. Clin. Exp. Med. 2018, 18, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Reichert, E.T.; Strauss, L.; Wagner, E.M.; Gooding, W.; Whiteside, T.L. Signaling abnormalities, apoptosis, and reduced proliferation of circulating and tumor-infiltrating lymphocytes in patients with oral carcinoma. Clin. Cancer Res. 2002, 8, 3137–3145. [Google Scholar] [PubMed]
- Baylin, S.B. DNA methylation and gene silencing in cancer. Nat. Clin. Pract. Oncol. 2005, 2 (Suppl. S1), S4–S11. [Google Scholar] [CrossRef]
- Milutin-Gasperov, N.; Sabol, I.; Halec, G.; Matovina, M.; Grce, M. Retrospective study of the prevalence of high-risk human papillomaviruses among Croatian women. Coll. Antropol. 2007, 31 (Suppl. S2), 89–96. [Google Scholar] [PubMed]
- Milutin, G.N.; Sabol, I.; Planinić, P.; Grubišić, G.; Fistonić, I.; Ćorušić, A.; Grce, A. Methylated Host Cell Gene Promoters and Human Papillomavirus Type 16 and 18 Predicting Cervical Lesions and Cancer. PLoS ONE 2015, 10, e0129452. [Google Scholar]
- Kular, L.; Liu, Y.; Ruhrmann, S.; Zheleznyakova, G.; Marabita, F.; Gomez-Cabrero, D.; James, T.; Ewing, E.; Lindén, M.; Górnikiewicz, B.; et al. DNA methylation as a mediator of HLA-DRB1*15:01 and a protective variant in multiple sclerosis. Nat. Commun. 2018, 9, 1–15. [Google Scholar] [CrossRef]
- Liu, Y.; Aryee, M.J.; Padyukov, L.; Fallin, M.D.; Hesselberg, E.; Runarsson, A.; Reinius, L.; Acevedo, N.; Taub, M.; Ronninger, M.; et al. Epigenome-wide association data implicate DNA methylation as an intermediary of genetic risk in rheumatoid arthritis. Nat. Biotechnol. 2013, 31, 142–147. [Google Scholar] [CrossRef]
- Hong, X.; Hao, K.; Ladd-Acosta, C.; Hansen, K.D.; Tsai, H.-J.; Liu, X.; Xu, X.; Thornton, T.A.; Caruso, D.; Keet, C.A.; et al. Genome-wide association study identifies peanut allergy-specific loci and evidence of epigenetic mediation in US children. Nat. Commun. 2015, 6, 6304. [Google Scholar] [CrossRef]
- Jing, J.; Yang, I.V.; Hui, L.; Patel, J.A.; Evans, C.M.; Prikeris, R.; Kobzik, L.; O’Connor, B.P.; Schwartz, D.A. Role of macrophage receptor with collagenous structure in innate immune tolerance. J. Immunol. 2013, 190, 6360–6367. [Google Scholar] [CrossRef]
- DiNardo, A.R.; Nishiguchi, T.; Mace, E.M.; Rajapakshe, K.; Mtetwa, G.; Kay, A.; Maphalala, G.; Secor, W.E.; Mejia, R.; Orange, J.S.; et al. Schistosomiasis Induces Persistent DNA Methylation and Tuberculosis-Specific Immune Changes. J. Immunol. 2018, 201, 124–133. [Google Scholar] [CrossRef]
- Schoenborn, J.R.; Wilson, C.B. Regulation of interferon-gamma during innate and adaptive immune responses. Adv. Immunol. 2007, 96, 41–101. [Google Scholar]
- Dias, H.C.; Cordeiro, C.; Real, F.C.; Cunha, E.; Manco, L. Age Estimation Based on DNA Methylation Using Blood Samples From Deceased Individuals. J. Forensic Sci. 2019, 65, 465–470. [Google Scholar] [CrossRef]
- Vizoso, M.; Puig, M.; Carmona, F.; Maqueda, M.; Velásquez, A.; Gomez, A.; Labernadie, A.; Lugo, R.; Gabasa, M.; Rigat-Brugarolas, L.G.; et al. Aberrant DNA methylation in non-small cell lung cancer-associated fibroblasts. Carcinogenesis 2015, 36, 1453–1463. [Google Scholar] [CrossRef]
- Quintero, M.; Adamoski, D.; Reis, L.M.D.; Ascenção, C.F.R.; Oliveira, K.R.S.; de Gonçalves, K.; Dias, M.M.; Carazzolle, M.F.; Dias, S.M.G. Guanylate-binding protein-1 is a potential new therapeutic target for triple-negative breast cancer. BMC Cancer 2017, 17, 727. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Ling, T.; Wu, H.; Zhang, J. Screening of candidate tumor-suppressor genes in 3p21.3 and investigation of the methylation of gene promoters in oral squamous cell carcinoma. Oncol. Rep. 2013, 29, 1175–1182. [Google Scholar] [CrossRef]
- Lin, F.; Zhang, P.L.; Yang, X.J.; Shi, J.; Blasick, T.; Han, W.K.; Wang, H.L.; Shen, S.S.; Teh, B.T.; Bonventre, J.V. Human kidney injury molecule-1 (hKIM-1): A useful immunohistochemical marker for diagnosing renal cell carcinoma and ovarian clear cell carcinoma. Am. J. Surg. Pathol. 2007, 31, 371–381. [Google Scholar] [CrossRef]
- Milutin, G.N.; Farkas, S.A.; Nilsson, T.K.; Grce, M. Epigenetic activation of immune genes in cervical cancer. Immunol. Lett. 2014, 162, 256–257. [Google Scholar] [CrossRef] [PubMed]
- Cicchini, L.; Westrich, J.A.; Xu, T.; Vermeer, D.W.; Berger, J.N.; Clambey, E.T.; Lee, D.; Song, J.I.; Lambert, P.F.; Greer, R.O.; et al. Suppression of Antitumor Immune Responses by Human Papillomavirus through Epigenetic Downregulation of CXCL14. Mbio 2016, 7, e00270-16. [Google Scholar] [CrossRef]
- Pyeon, D.; Newton, M.A.; Lambert, P.F.; Boon, J.A.D.; Sengupta, S.; Marsit, C.J.; Woodworth, C.D.; Connor, J.P.; Haugen, T.H.; Smith, E.M.; et al. Fundamental differences in cell cycle deregulation in human papillomavirus-positive and human papillomavirus-negative head/neck and cervical cancers. Cancer Res. 2007, 67, 4605–4619. [Google Scholar] [CrossRef] [PubMed]
- Cicchini, L.; Blumhagen, R.Z.; Westrich, J.A.; Myers, M.E.; Warren, C.J.; Siska, C.; Raben, D.; Kechris, K.J.; Pyeon, D. High-Risk Human Papillomavirus E7 Alters Host DNA Methylome and Represses HLA-E Expression in Human Keratinocytes. Sci. Rep. 2017, 7, 3633. [Google Scholar] [CrossRef]
- Iarc, W. Handbooks of Cancer Prevention Volume 10: Cervix Cancer Screening; IARC Press: Lyon, France, 2005. [Google Scholar]
- Biktasova, A.; Hajek, M.; Sewell, A.; Gary, C.; Bellinger, G.; Deshpande, H.A.; Bhatia, A.; Burtness, B.; Judson, B.; Mehra, S.; et al. Demethylation Therapy as a Targeted Treatment for Human Papillomavirus–Associated Head and Neck Cancer. Clin. Cancer Res. 2017, 23, 7276–7287. [Google Scholar] [CrossRef] [PubMed]
- Lindel, K.; Beer, K.T.; Laissue, J.; Greiner, R.H.; Aebersold, D.M. Human papillomavirus positive squamous cell carcinoma of the oropharynx: A radiosensitive subgroup of head and neck carcinoma. Cancer 2001, 92, 805–813. [Google Scholar] [CrossRef] [PubMed]
- Lindquist, D.; Romanitan, M.; Hammarstedt-Nordenvall, L.; Näsman, A.; Dahlstrand, H.; Lindholm, J.; Onelöv, L.; Ramqvist, T.; Ye, W.; Munck-Wikland, E.; et al. Human papillomavirus is a favourable prognostic factor in tonsillar cancer and its oncogenic role is supported by the expression of E6 and E7. Mol. Oncol. 2007, 1, 350–355. [Google Scholar] [CrossRef] [PubMed]
- Hansson, B.G.; Rosenquist, K.; Antonsson, A.; Wennerberg, J.; Schildt, E.-B.; Bladström, A.; Gunilla, A. Strong association between infection with human papillomavirus and oral and oropharyngeal squamous cell carcinoma: A population-based case-control study in southern Sweden. Acta Otolaryngol. 2005, 125, 1337–1344. [Google Scholar] [CrossRef]
- Rosenquist, K. Risk factors in oral and oropharyngeal squamous cell carcinoma: A population-based case-control study in southern Sweden. Swed. Dent. J. Suppl. 2005, 179, 1–66. [Google Scholar]
- Morshed, K. Association between human papillomavirus infection and laryngeal squamous cell carcinoma. J. Med. Virol. 2010, 82, 1017–1023. [Google Scholar] [CrossRef]
- Ozdayi, G.; Kemaloglu, Y.; Ekinci, O.; Dogan, B.; Ilhan, M.N.; Aydil, U.; Akyol, G.; Koybasioglu, A.; Inal, E.; Rota, S. Role of human papillomavirus in the clinical and histopathologic features of laryngeal and hypopharyngeal cancers. J. Otolaryngol. Head Neck Surg. 2009, 38, 119–125. [Google Scholar]
- Williams, R.; Lee, D.W.; Elzey, B.D.; Anderson, M.E.; Hostager, B.S.; Lee, J.H. Preclinical models of HPV+ and HPV- HNSCC in mice: An immune clearance of HPV+ HNSCC. Head Neck 2009, 31, 911–918. [Google Scholar] [CrossRef] [PubMed]
- Manos, M.M.; Ting, Y.; Wright, D.K.; Levwis, A.J.; Broker, T.R.; Wolinsky, S.M. The use of polymerase chain reaction amplification for the detection of genital human papillomavirus. Cancer Cells 1989, 7, 209–214. [Google Scholar]
Immune System Gene Promoters | No. of Unmethylated Control Samples * (%) | No. of Unmethylated Cancer Samples ** (%) | p-Value |
---|---|---|---|
EDARADD | 4 (13.3) | 24 (88.9) | p < 0.0001 |
GBP4 | 2 (6.7) | 23 (85.2) | p < 0.0001 |
HAVCR2 | 8 (26.7) | 21 (77.8) | p = 0.0001 |
HLA DPB1 | 0 (0.0) | 17 (63) | p < 0.0001 |
IL12RB1 | 0 (0.0) | 23 (85.2) | p < 0.0001 |
MARCO | 2 (6.7) | 23 (85.2) | p < 0.0001 |
SIGLEC12 | 4 (13.3) | 23 (85.2) | p < 0.0001 |
Primer | Sequence 5′-3′ |
---|---|
EDARADD-Uf | TTGTTTTGGAATAGTTAGAGGATGG |
EDARADD-Ur | AAATACCTAAAAAAATCTCCACACT |
GBP4-Uf | TGTGTTTGTAGTTTTAGTTATATGG |
GBP4-Ur | TAAAACAAAATTTCACTCTATCACC |
HAVCR2-Uf | GGTAGGAGTTTTTAGGGAAAAATG |
HAVCR2-Ur | AAACAACAAAATTTATATCCCCATC |
HLA DPB1-Uf | GGAAGGTATAGTTTGATTTTGTTTG |
HLA DPB1-Ur | AAACCCTATTTATACAAATCCTCATT |
IL12RB1-Uf | TTAGTTTGGGTTTAGAGTATGATGT |
IL12RB1-Ur | CAAAATAAACTTCTCAAAATACACA |
MARCO-Uf | ATTTAGTGTTTGTTAGGATTGTTGG |
MARCO-Ur | TAACATCAAAATTTTACCACTCATC |
SIGLEC12-Uf | TTGATAATGTAGAAGTTTGTGATGG |
SIGLEC12-Ur | ACCAATAACCATAAACTAAATCAAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Anić, P.; Golubić Talić, J.; Božinović, K.; Dediol, E.; Mravak-Stipetić, M.; Grce, M.; Milutin Gašperov, N. Methylation of Immune Gene Promoters in Oral and Oropharyngeal Cancer. Int. J. Mol. Sci. 2023, 24, 7698. https://doi.org/10.3390/ijms24097698
Anić P, Golubić Talić J, Božinović K, Dediol E, Mravak-Stipetić M, Grce M, Milutin Gašperov N. Methylation of Immune Gene Promoters in Oral and Oropharyngeal Cancer. International Journal of Molecular Sciences. 2023; 24(9):7698. https://doi.org/10.3390/ijms24097698
Chicago/Turabian StyleAnić, Petra, Jasminka Golubić Talić, Ksenija Božinović, Emil Dediol, Marinka Mravak-Stipetić, Magdalena Grce, and Nina Milutin Gašperov. 2023. "Methylation of Immune Gene Promoters in Oral and Oropharyngeal Cancer" International Journal of Molecular Sciences 24, no. 9: 7698. https://doi.org/10.3390/ijms24097698