Bacterial Species from Vaginal Microbiota Differently Affect the Production of the E6 and E7 Oncoproteins and of p53 and p-Rb Oncosuppressors in HPV16-Infected Cells
Abstract
:1. Introduction
2. Results
2.1. Effects of Vaginal Bacteria on HPV-16 E6 and E7 Gene Expression and Protein Production by SiHa Cells
2.2. Effects of Vaginal Bacteria on p53 and pRb Production by SiHa Cells
2.3. Effects of Vaginal Bacteria on Cell Cycle
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains
4.2. Bacterial Cultures
4.3. Epithelial Cell Culture
4.4. Gene Expression
4.5. Western Blot Analysis
4.6. Cellular Cycle Analysis
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization. Cervical Cancer. Available online: https://www.who.int/health-topics/cervical-cancer (accessed on 1 March 2023).
- Mitra, A.; MacIntyre, D.A.; Marchesi, J.R.; Lee, Y.S.; Bennett, P.R.; Kyrgiou, M. The Vaginal Microbiota, Human Papillomavirus Infection and Cervical Intraepithelial Neoplasia: What Do We Know and Where Are We Going Next? Microbiome 2016, 4, 58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodríguez, A.C.; Schiffman, M.; Herrero, R.; Hildesheim, A.; Bratti, C.; Sherman, M.E.; Solomon, D.; Guillén, D.; Alfaro, M.; Morales, J.; et al. Longitudinal Study of Human Papillomavirus Persistence and Cervical Intraepithelial Neoplasia Grade 2/3: Critical Role of Duration of Infection. J. Natl. Cancer Inst. 2010, 102, 315–324. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khan, M.J.; Smith-McCune, K.K. Treatment of Cervical Precancers: Back to Basics. Obstet. Gynecol. 2014, 123, 1339–1343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brotman, R.M.; Shardell, M.D.; Gajer, P.; Tracy, J.K.; Zenilman, J.M.; Ravel, J.; Gravitt, P.E. Interplay between the Temporal Dynamics of the Vaginal Microbiota and Human Papillomavirus Detection. J. Infect. Dis. 2014, 210, 1723–1733. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shannon, B.; Yi, T.J.; Perusini, S.; Gajer, P.; Ma, B.; Humphrys, M.S.; Thomas-Pavanel, J.; Chieza, L.; Janakiram, P.; Saunders, M.; et al. Association of HPV Infection and Clearance with Cervicovaginal Immunology and the Vaginal Microbiota. Mucosal Immunol. 2017, 10, 1310–1319. [Google Scholar] [CrossRef] [Green Version]
- Di Paola, M.; Sani, C.; Clemente, A.M.; Iossa, A.; Perissi, E.; Castronovo, G.; Tanturli, M.; Rivero, D.; Cozzolino, F.; Cavalieri, D.; et al. Characterization of Cervico-Vaginal Microbiota in Women Developing Persistent High-Risk Human Papillomavirus Infection. Sci. Rep. 2017, 7, 10200. [Google Scholar] [CrossRef] [PubMed]
- Usyk, M.; Zolnik, C.P.; Castle, P.E.; Porras, C.; Herrero, R.; Gradissimo, A.; Gonzalez, P.; Safaeian, M.; Schiffman, M.; Burk, R.D. Cervicovaginal Microbiome and Natural History of HPV in a Longitudinal Study. PLoS Pathog. 2020, 16, e1008376. [Google Scholar] [CrossRef] [Green Version]
- Norenhag, J.; Du, J.; Olovsson, M.; Verstraelen, H.; Engstrand, L.; Brusselaers, N. The Vaginal Microbiota, Human Papillomavirus and Cervical Dysplasia: A Systematic Review and Network Meta-Analysis. BJOG 2020, 127, 171–180. [Google Scholar] [CrossRef]
- Mitra, A.; MacIntyre, D.A.; Ntritsos, G.; Smith, A.; Tsilidis, K.K.; Marchesi, J.R.; Bennett, P.R.; Moscicki, A.-B.; Kyrgiou, M. The Vaginal Microbiota Associates with the Regression of Untreated Cervical Intraepithelial Neoplasia 2 Lesions. Nat. Commun. 2020, 11, 1999. [Google Scholar] [CrossRef] [Green Version]
- Scheffner, M.; Werness, B.A.; Huibregtse, J.M.; Levine, A.J.; Howley, P.M. The E6 Oncoprotein Encoded by Human Papillomavirus Types 16 and 18 Promotes the Degradation of P53. Cell 1990, 63, 1129–1136. [Google Scholar] [CrossRef] [PubMed]
- Dyson, N.; Howley, P.M.; Münger, K.; Harlow, E. The Human Papilloma Virus-16 E7 Oncoprotein Is Able to Bind to the Retinoblastoma Gene Product. Science 1989, 243, 934–937. [Google Scholar] [CrossRef] [PubMed]
- Hussain, S.S.; Lundine, D.; Leeman, J.E.; Higginson, D.S. Genomic Signatures in HPV-Associated Tumors. Viruses 2021, 13, 1998. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.; Ismail, A.; Pappas-Gogos, G.; Boussios, S. HPV and Cervical Cancer: A Review of Epidemiology and Screening Uptake in the UK. Pathogens 2023, 12, 298. [Google Scholar] [CrossRef] [PubMed]
- Stanley, M. Immune Responses to Human Papillomavirus. Vaccine 2006, 24 (Suppl. 1), S16–S22. [Google Scholar] [CrossRef] [PubMed]
- Nicolò, S.; Tanturli, M.; Mattiuz, G.; Antonelli, A.; Baccani, I.; Bonaiuto, C.; Baldi, S.; Nannini, G.; Menicatti, M.; Bartolucci, G.; et al. Vaginal Lactobacilli and Vaginal Dysbiosis-Associated Bacteria Differently Affect Cervical Epithelial and Immune Homeostasis and Anti-Viral Defenses. Int. J. Mol. Sci. 2021, 22, 6487. [Google Scholar] [CrossRef]
- Kyrgiou, M.; Moscicki, A.-B. Vaginal Microbiome and Cervical Cancer. Semin. Cancer Biol. 2022, 86, 189–198. [Google Scholar] [CrossRef] [PubMed]
- Anahtar, M.N.; Byrne, E.H.; Doherty, K.E.; Bowman, B.A.; Yamamoto, H.S.; Soumillon, M.; Padavattan, N.; Ismail, N.; Moodley, A.; Sabatini, M.E.; et al. Cervicovaginal Bacteria Are a Major Modulator of Host Inflammatory Responses in the Female Genital Tract. Immunity 2015, 42, 965–976. [Google Scholar] [CrossRef] [Green Version]
- Schwabe, R.F.; Jobin, C. The Microbiome and Cancer. Nat. Rev. Cancer 2013, 13, 800–812. [Google Scholar] [CrossRef] [Green Version]
- Fulbright, L.E.; Ellermann, M.; Arthur, J.C. The Microbiome and the Hallmarks of Cancer. PLOS Pathog. 2017, 13, e1006480. [Google Scholar] [CrossRef]
- Chambers, L.M.; Bussies, P.; Vargas, R.; Esakov, E.; Tewari, S.; Reizes, O.; Michener, C. The Microbiome and Gynecologic Cancer: Current Evidence and Future Opportunities. Curr. Oncol. Rep. 2021, 23, 92. [Google Scholar] [CrossRef]
- Ilhan, Z.E.; Łaniewski Pawełand Thomas, N.; Roe, D.J.; Chase, D.M.; Herbst-Kralovetz, M.M. Deciphering the Complex Interplay between Microbiota, HPV, Inflammation and Cancer through Cervicovaginal Metabolic Profiling. EBioMedicine 2019, 44, 675–690. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caselli, E.; D’Accolti, M.; Santi, E.; Soffritti, I.; Conzadori, S.; Mazzacane, S.; Greco, P.; Contini, C.; Bonaccorsi, G. Vaginal Microbiota and Cytokine Microenvironment in HPV Clearance/Persistence in Women Surgically Treated for Cervical Intraepithelial Neoplasia: An Observational Prospective Study. Front. Cell. Infect. Microbiol. 2020, 10, 693. [Google Scholar] [CrossRef]
- Tilborghs, S.; Corthouts, J.; Verhoeven, Y.; Arias, D.; Rolfo, C.; Trinh, X.B.; van Dam, P.A. The Role of Nuclear Factor-Kappa B Signaling in Human Cervical Cancer. Crit. Rev. Oncol. Hematol. 2017, 120, 141–150. [Google Scholar] [CrossRef] [PubMed]
- Perkins, N.D. Achieving Transcriptional Specificity with Nf-Κb. Int. J. Biochem. Cell Biol. 1997, 29, 1433–1448. [Google Scholar] [CrossRef]
- Guttridge, D.C.; Albanese, C.; Reuther, J.Y.; Pestell, R.G.; Baldwin, A.S.J. NF-KappaB Controls Cell Growth and Differentiation through Transcriptional Regulation of Cyclin D1. Mol. Cell. Biol. 1999, 19, 5785–5799. [Google Scholar] [CrossRef] [Green Version]
- La Rosa, F.A.; Pierce, J.W.; Sonenshein, G.E. Differential Regulation of the C-Myc Oncogene Promoter by the NF-Kappa B Rel Family of Transcription Factors. Mol. Cell. Biol. 1994, 14, 1039–1044. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rebhandl, S.; Huemer, M.; Greil, R.; Geisberger, R. AID/APOBEC Deaminases and Cancer. Oncoscience 2015, 2, 320–333. [Google Scholar] [CrossRef] [Green Version]
- Longworth, M.S.; Laimins, L.A. Pathogenesis of Human Papillomaviruses in Differentiating Epithelia. Microbiol. Mol. Biol. Rev. 2004, 68, 362–372. [Google Scholar] [CrossRef] [Green Version]
- Wang, K.-D.; Xu, D.-J.; Wang, B.-Y.; Yan, D.-H.; Lv, Z.; Su, J.-R. Inhibitory Effect of Vaginal Lactobacillus Supernatants on Cervical Cancer Cells. Probiot. Antimicrob. Proteins 2018, 10, 236–242. [Google Scholar] [CrossRef]
- Hang, L.; Hua, L.; Di, L.; Ming, W.; Yan, L. Association of Cervical Dysbacteriosis, HPV Oncogene Expression, and Cervical Lesion Progression. Microbiol. Spectr. 2022, 10, e00151-22. [Google Scholar] [CrossRef]
- Friedl, F.; Kimura, I.; Osato, T.; Ito, Y. Studies on a New Human Cell Line (SiHa) Derived from Carcinoma of Uterus. I. Its Establishment and Morphology. Proc. Soc. Exp. Biol. Med. 1970, 135, 543–545. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Ma, Y.; Li, R.; Chen, X.; Wan, L.; Zhao, W. Associations of Cervicovaginal Lactobacilli with High-Risk Human Papillomavirus Infection, Cervical Intraepithelial Neoplasia, and Cancer: A Systematic Review and Meta-Analysis. J. Infect. Dis. 2019, 220, 1243–1254. [Google Scholar] [CrossRef]
- Barbosa, M.S.; Schlegel, R. The E6 and E7 Genes of HPV-18 Are Sufficient for Inducing Two-Stage In Vitro Transformation of Human Keratinocytes. Oncogene 1989, 4, 1529–1532. [Google Scholar]
- Dong, B.; Huang, Y.; Cai, H.; Chen, Y.; Li, Y.; Zou, H.; Lin, W.; Xue, H.; Feng, A.; Zhao, H.; et al. Prevotella as the Hub of the Cervicovaginal Microbiota Affects the Occurrence of Persistent Human Papillomavirus Infection and Cervical Lesions in Women of Childbearing Age via Host NF-ΚB/C-Myc. J. Med. Virol. 2022, 94, 5519–5534. [Google Scholar] [CrossRef]
- Vandermark, E.R.; Deluca, K.A.; Gardner, C.R.; Marker, D.F.; Schreiner, C.N.; Strickland, D.A.; Wilton, K.M.; Mondal, S.; Woodworth, C.D. Human Papillomavirus Type 16 E6 and E7 Proteins Alter NF-KB in Cultured Cervical Epithelial Cells and Inhibition of NF-KB Promotes Cell Growth and Immortalization. Virology 2012, 425, 53–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martinez-Zapien, D.; Ruiz, F.X.; Poirson, J.; Mitschler, A.; Ramirez, J.; Forster, A.; Cousido-Siah, A.; Masson, M.; Vande Pol, S.; Podjarny, A.; et al. Structure of the E6/E6AP/P53 Complex Required for HPV-Mediated Degradation of P53. Nature 2016, 529, 541–545. [Google Scholar] [CrossRef] [Green Version]
- Roman, A.; Munger, K. The Papillomavirus E7 Proteins. Virology 2013, 445, 138–168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boyer, S.N.; Wazer, D.E.; Band, V. E7 Protein of Human Papilloma Virus-16 Induces Degradation of Retinoblastoma Protein through the Ubiquitin-Proteasome Pathway. Cancer Res. 1996, 56, 4620–4624. [Google Scholar] [PubMed]
- Hoppe-Seyler, K.; Bossler, F.; Braun, J.A.; Herrmann, A.L.; Hoppe-Seyler, F. The HPV E6/E7 Oncogenes: Key Factors for Viral Carcinogenesis and Therapeutic Targets. Trends Microbiol. 2018, 26, 158–168. [Google Scholar] [CrossRef]
- Paccosi, S.; Musilli, C.; Caporale, R.; Gelli, A.M.G.; Guasti, D.; Clemente, A.M.; Torcia, M.G.; Filippelli, A.; Romagnoli, P.; Parenti, A. Stimulatory interactions between human coronary smooth muscle cells and dendritic cells. PLoS ONE 2014, 9, e0099652. [Google Scholar] [CrossRef] [Green Version]
- Ravel, J.; Gajer, P.; Abdo, Z.; Schneider, G.M.; Koenig, S.S.K.; McCulle, S.L.; Karlebach, S.; Gorle, R.; Russell, J.; Tacket, C.O.; et al. Vaginal Microbiome of Reproductive-Age Women. Proc. Natl. Acad. Sci. USA 2011, 108 (Suppl. 1), 4680–4687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Castronovo, G.; Clemente, A.M.; Antonelli, A.; D’Andrea, M.M.; Tanturli, M.; Perissi, E.; Paccosi, S.; Parenti, A.; Cozzolino, F.; Rossolini, G.M.; et al. Differences in Inflammatory Response Induced by Two Representatives of Clades of the Pandemic ST258 Klebsiella pneumoniae Clonal Lineage Producing KPC-Type Carbapenemases. PLoS ONE 2017, 12, e0170125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barbetti, V.; Tusa, I.; Cipolleschi, M.G.; Rovida, E.; Dello Sbarba, P. AML1/ETO Sensitizes via TRAIL Acute Myeloid Leukemia Cells to the pro-Apoptotic Effects of Hypoxia. Cell Death Dis. 2013, 4, e536. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- R Core Team R. A Language and Environment for Statistical Computing; R Core Team R: Vienna, Austria, 2020. [Google Scholar]
CST | Family and Genus | Species | Strain |
---|---|---|---|
I | Lactobacillaceae, Lactobacillus | L. crispatus | JV-V01 |
II | Lactobacillaceae, Lactobacillus | L. gasseri | SV-16A |
III | Lactobacillaceae, Lactobacillus | L. iners | UPII-60-B |
IV | Bifidobacteriaceae, Gardnerella | G. vaginalis | 49145/JCP-7276 |
IV | Bifidobacteriaceae, Gardnerella | G. vaginalis | 14019/JCP-7659 |
IV | Veillonellaceae, Megasphaera | M. micronuciformis | DNF-00954 |
IV | Prevotellaceae, Prevotella | P. bivia | DNF-0018 |
IV | Atopobiaceae, Atopobium | A. vaginalis | DSM-15829 |
Gene | Forward 5′-3′ | Reverse 3′-5′ |
---|---|---|
18S | ATTAAGGGTGTGGGCCGAAG | GGTGATCACACGTTCCACCT |
E6 | CGACCCAGAAAGTTACCA | AGCAAAGTCATATACCTCACG |
E7 | GCCACCATGCATGGAGATACACCTACA | GATCAGCCATGGTACATTATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nicolò, S.; Antonelli, A.; Tanturli, M.; Baccani, I.; Bonaiuto, C.; Castronovo, G.; Rossolini, G.M.; Mattiuz, G.; Torcia, M.G. Bacterial Species from Vaginal Microbiota Differently Affect the Production of the E6 and E7 Oncoproteins and of p53 and p-Rb Oncosuppressors in HPV16-Infected Cells. Int. J. Mol. Sci. 2023, 24, 7173. https://doi.org/10.3390/ijms24087173
Nicolò S, Antonelli A, Tanturli M, Baccani I, Bonaiuto C, Castronovo G, Rossolini GM, Mattiuz G, Torcia MG. Bacterial Species from Vaginal Microbiota Differently Affect the Production of the E6 and E7 Oncoproteins and of p53 and p-Rb Oncosuppressors in HPV16-Infected Cells. International Journal of Molecular Sciences. 2023; 24(8):7173. https://doi.org/10.3390/ijms24087173
Chicago/Turabian StyleNicolò, Sabrina, Alberto Antonelli, Michele Tanturli, Ilaria Baccani, Chiara Bonaiuto, Giuseppe Castronovo, Gian Maria Rossolini, G. Mattiuz, and M. G. Torcia. 2023. "Bacterial Species from Vaginal Microbiota Differently Affect the Production of the E6 and E7 Oncoproteins and of p53 and p-Rb Oncosuppressors in HPV16-Infected Cells" International Journal of Molecular Sciences 24, no. 8: 7173. https://doi.org/10.3390/ijms24087173
APA StyleNicolò, S., Antonelli, A., Tanturli, M., Baccani, I., Bonaiuto, C., Castronovo, G., Rossolini, G. M., Mattiuz, G., & Torcia, M. G. (2023). Bacterial Species from Vaginal Microbiota Differently Affect the Production of the E6 and E7 Oncoproteins and of p53 and p-Rb Oncosuppressors in HPV16-Infected Cells. International Journal of Molecular Sciences, 24(8), 7173. https://doi.org/10.3390/ijms24087173