Next Article in Journal
Prenyl Transferases Regulate Secretory Protein Sorting and Parasite Morphology in Toxoplasma gondii
Previous Article in Journal
Immobilization of M3 Muscarinic Receptor to Rapidly Analyze Drug—Protein Interactions and Bioactive Components in a Natural Plant
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bacterial Species from Vaginal Microbiota Differently Affect the Production of the E6 and E7 Oncoproteins and of p53 and p-Rb Oncosuppressors in HPV16-Infected Cells

1
Department of Clinical and Experimental Medicine, University of Florence, 50134 Florence, Italy
2
Clinical Microbiology and Virology Unit, Careggi University Hospital, 50139 Florence, Italy
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(8), 7173; https://doi.org/10.3390/ijms24087173
Submission received: 6 March 2023 / Revised: 7 April 2023 / Accepted: 10 April 2023 / Published: 12 April 2023
(This article belongs to the Section Molecular Microbiology)

Abstract

:
Vaginal dysbiosis is characterized by a decrease in the relative abundance of Lactobacillus species in favor of other species. This condition facilitates infections by sexually transmitted pathogens including high risk (HR)-human papilloma viruses (HPVs) involved in the development of cervical cancer. Some vaginal dysbiosis bacteria contribute to the neoplastic progression by inducing chronic inflammation and directly activating molecular pathways involved in carcinogenesis. In this study, SiHa cells, an HPV-16-transformed epithelial cell line, were exposed to different representative vaginal microbial communities. The expression of the HPV oncogenes E6 and E7 and the production of relative oncoproteins was evaluated. The results showed that Lactobacillus crispatus and Lactobacillus gasseri modulated the basal expression of the E6 and E7 genes of SiHa cells and the production of the E6 and E7 oncoproteins. Vaginal dysbiosis bacteria had contrasting effects on E6/E7 gene expression and protein production. The expression of the E6 and E7 genes and the production of the relative oncoproteins was increased by strains of Gardnerella vaginalis and, to a lesser extent, by Megasphaera micronuciformis. In contrast, Prevotella bivia decreased the expression of oncogenes and the production of the E7 protein. A decreased amount of p53 and pRb was found in the cultures of SiHa cells with M. micronuciformis, and accordingly, in the same cultures, a higher percentage of cells progressed to the S-phase of the cell cycle compared to the untreated or Lactobacillus-stimulated cultures. These data confirm that L. crispatus represents the most protective component of the vaginal microbiota against neoplastic progression of HR-HPV infected cells, while M. micronuciformis and, to a lesser extent, G. vaginalis may directly interfere in the oncogenic process, inducing or maintaining the production of viral oncoproteins.

1. Introduction

Cervical cancer represents the fourth most common cancer in women with 570,000 new cases diagnosed and an estimated 311,000 women died of the disease in 2018 [1]. Persistent infections with high risk-human papillomavirus (HR-HPV) strains represent a major risk factor for cervical cancer development. In particular, infections with HPVs-16 and -18 strains are responsible for around 70% of cases of cervical cancer worldwide [2]. Approximately 70% of HPV infections are cleared spontaneously in one year and 90% in two years. The infection persists in the remaining cases and can progress to low grade cervical intraepithelial neoplasia (LSIL/CIN-1), high grade squamous intraepithelial lesions (HSIL/CIN-2), or carcinoma in situ (CIN3). While the majority of CIN-1 is spontaneously cleared by the immune system, CIN-2 lesions progress to neoplasia in almost 50–60% of cases. The regression of CIN-2 is observed in almost 40% of women [3]. It is difficult to predict which lesions regress and which progress to carcinoma, and traditionally, women with a diagnosis of CIN-2 undergo surgical treatments that, fortunately, are now much less invasive than in the past [4].
Drivers governing transition between HPV acquisition, clearance, persistence, and cancer progression have not been elucidated yet. Cervico-vaginal microbiota in cooperation with the immune system maintains the health of the vaginal environment and largely contributes to prevent HPV infection as well as other sexually transmitted infections. In particular, Lactobacillus crispatus, Lactobacillus gasseri, and Lactobacillus jensenii were reported as the most protective species against HR-HPV infection and persistence [5,6,7,8]. In contrast, Gardnerella vaginalis, Sneathia, Megasphaera, and Prevotella were repeatedly found associated with HR-HPV persistence and high-grade lesions in infected women. Occasionally increased prevalence of Lactobacillus iners has been associated with squamous intra-epithelial lesions and progression to dysplasia/cancer [9].
The cervico-vaginal microbiota associated with the recovery of high-grade lesions (CIN-2) was also studied. Regression of CIN-2 is significantly less frequent in women with a non-lactobacillus dominated microbiota [10]. The presence of Megasphaera, Prevotella, Gardnerella (bacterial vaginosis-associated genus), Sneathia, and Atopobium species has been significantly associated with the persistence of CIN-2 lesions and cancer progression [10].
Despite the huge amount of data on the composition of vaginal microbiota associated with the risk of cancer development, the molecular mechanisms activated by bacterial cells involved in the neoplastic transformation of cervical epithelial cells were not elucidated.
In this study, we investigated the effects of representative taxa of vaginal microbial communities on relevant steps of the oncogenesis process triggered by HR-HPV strains.
The production of HPV oncogenic proteins E6 and E7 and the amount of p53 and pRb oncosuppressors were investigated in SiHa cells, an HPV-16 transformed epithelial cell line cultured with live bacterial cells of the most representative species of cervico-vaginal microbiota.

2. Results

2.1. Effects of Vaginal Bacteria on HPV-16 E6 and E7 Gene Expression and Protein Production by SiHa Cells

As a first step of analysis, we investigated whether vaginal bacteria differently affected the expression of the viral E6 and E7 oncogenes and the production of the relative proteins by cervical epithelial HR-HPV-transformed cells. SiHa cells, harboring few copies of integrated copies of HPV-16, were used as the experimental model of HR-HPV transformed cells and co-cultured with live bacterial cells for 6 h.
Figure 1 shows the results of E6 and E7 gene expression obtained through RT-PCRs with primers specific to the E6 and E7 genes of HPV16.
The expression of the E6 gene (panel A) was significantly decreased in cultures with L. crispatus and L. iners. The mean value of E6 mRNA expression was always above that of the untreated cultures in G. vaginalis and M. micronuciformis and A. vaginae stimulated cultures. P. bivia was the only species associated with vaginal dysbiosis that significantly decreased E6 gene expression.
When we studied the expression of the E7 gene, we found that all vaginal lactobacilli decreased the basal expression of the oncogene with L. crispatus and L. gasseri more efficiently compared to L. iners. P. bivia was, again, the only species of vaginal dysbiosis bacteria that significantly decreased the basal E7 oncogene expression.
The G. vaginalis strain, M. micronuciformis, increased the basal expression of the E7 gene.
We also investigated the production of viral oncoproteins in the SiHa cells cultured with live bacteria, as above reported.
Figure 2, panel A shows that the amount of E6 proteins was significantly lower than the untreated controls only in cultures with L. crispatus.
Figure 2 panel B shows that the production of the E7 protein was significantly decreased in cultures with L. crispatus and L. gasseri. Surprisingly, the E7 protein was found increased in cultures with L. iners. Taken in consideration with the results of the gene expression analysis, these data suggest that L. iners may increase the stability of the E7 oncoprotein.
Among the vaginal dysbiosis bacteria, E7 was significantly decreased in cultures with P. bivia while it was increased in cultures with G. vaginalis and M. micronuciformis. (p < 0.05 and p = 0.05, respectively).
Overall, these data indicate L. crispatus and L. gasseri as vaginal Lactobacillus species that are able to modulate the expression of E6 and E7 oncogenes and the production of the relative oncoproteins.
Among the vaginal dysbiosis bacteria, P. bivia was the only species that modulated E6 and E7 oncogene expression and the production of the relative oncoproteins.
G. vaginalis and M. micronuciformis did not affect the basal production of E6 and increased the production of the E7 oncoprotein.

2.2. Effects of Vaginal Bacteria on p53 and pRb Production by SiHa Cells

As a third step of our study, we explored the production of the tumor suppressor p53 and pRb proteins. Loss of function of these important proteins plays a significant role in most human cancers including cervical cancer. The HPV oncoproteins E6 and E7 target the ubiquitination of p53 and pRb proteins, respectively [11,12]. To investigate whether vaginal bacteria affect the production of p53 and pRb proteins, SiHa cells were cultured with live bacterial cells as reported and the production of p53 and of pRb was evaluated by Western blot analysis.
Figure 3 shows that the production of the p53 and pRb proteins was differently affected by co-culture with vaginal bacteria. While p53 and pRb production was unaffected or increased in culture with vaginal lactobacilli, the amount of the two oncosuppressors was significantly lower in cultures with M. micronuciformis, suggesting that this species might induce deregulation of the cell cycle.

2.3. Effects of Vaginal Bacteria on Cell Cycle

Loss of p53 and pRb as induced by the viral E6 and E7 oncoproteins allow for a high number of cells to enter in the S phase of cell cycle and even to progress to G2/M [13].
As a final step of the study, we evaluated the effects of vaginal bacteria on phases of the cell cycle. SiHa cells were cultured with live bacterial cells for 24 h and cell proliferation was recorded by FACS analysis using CSFE fluorescent staining.
Figure 4 shows that vaginal lactobacilli do not affect any phase of the cell cycle. The percentage of cells in G0, G1, S, G2/M were not different from those revealed in the untreated controls.
In contrast, a significant increase in the percentage of cells in the S phase of cell cycle compared to the untreated control was found in SiHa cultured with M. micronuciformis.
According to the results previously reported, M. micronuciformis, and to a lesser extent, G. vaginalis, are strongly suggested as bacterial species more involved in affecting normal cellular functions.

3. Discussion

Vaginal microbial communities dominated by Lactobacillus species strongly contribute to protect the vaginal environment from infections with sexually transmitted pathogens including HR-HPV. Infection with high-risk HPV strains is cleared by the host immune response in most cases. In a small percentage of women, however, the infection persists, and in some cases, women develop high-grade cervical intraepithelial neoplasia [14].
Either longitudinal or cross-sectional studies have revealed that Lactobacillus-dominated microbiota is highly protective against HR-HPV infection. The role of vaginal lactobacilli in HPV disease, however, is not limited to preventing viral infections.
The clearance of HPV infection requires the coordinate activation of both innate and adaptive immunity and the differentiation of T helper effector lineages and cytotoxic T lymphocytes (CTLs) are needed for the clearance of HPV [15]. HPVs, and HR-HPV in particular, have evolved sophisticated mechanisms of immune escape, resulting in tolerance of the pathogen by the immune system.
Vaginal microbiota may play a relevant role in the clearance or persistence of HPV [7]. In a previous paper, we demonstrated that bacterial species common in vaginal dysbiosis induce an unbalanced T cell differentiation that exacerbates inflammatory processes and may compromise viral clearance [16].
Chronic inflammation induced by bacterial species other than Lactobacillus is actually retained as the mechanism linking the vaginal environment to the neoplastic progression of HR-HPV-infected epithelial cells [17,18].
Chronic inflammatory status results in tissue damage, influx of neutrophils, and increased ROS production with consequent epithelial genomic instability, genotoxicity, and aberrant proliferation [19,20,21]. In accordance with this hypothesis, metabolomic profiles associated with cancers are also associated with cervical inflammation and HPV infections [22], and increased levels of proinflammatory cytokines (IL-1α, IL-1β, IL-6, IL-8, and TNF-α) have been shown in the vaginal fluids of women with cervical intraepithelial neoplasia [23].
In addition to ROS production, elevated levels of NF-kB activation also characterize chronic inflammation. The prolonged activation of NF-kB may play a role in the neoplastic transformation of the cells and its role in HR-HPV induced cancer has been extensively studied [24]. NF-kB is an important player in host response against infections since it induces the expression of inflammatory cytokines, chemokines, and their receptors. Beyond their role in immunity, all of these factors contribute to keeping the level of NF-kB activation high, and persistent inducing and amplifying side effects of NF-kB such as cyclin D1 and c-MYC transcription [25,26,27], which in turn, play important roles in cancer progression. Finally, NF-kB induces the production of host-deaminase as the APOBEC proteins and activation-induced cytidine deaminase (AID) enzymes, two families of proteins mainly involved in host-defense against viral infections that, however, can also mutate host DNA and contribute to cancer development [28].
The relevance of the E6 and E7 viral oncoproteins in the neoplastic transformation of cervical epithelial cells is beyond question. E6 and E7 directly affect important cell cycle checkpoints by inducing the degradation of p53 (tumor suppressor protein) and pRb (retinoblastoma protein), and the inhibition of cyclin dependent kinase (CDK) inhibitors (p21, p27, p16) [29]. E6 and E7 oncoproteins represent the major contributor to HPV-induced neoplastic initiation and the progression of carcinogenesis.
The co-expression of E6 and E7 usually constitutes the perfect environment for sustained proliferation. In fact, E7-mediated pRb disintegration induces cellular growth that could be stabilized by p53 in the case this protein is functional and is not degraded by the E6/E6AP complex.
Despite the relevance of E6 and E7 in HR-HPV induced neoplasia, less data are available on the direct or inflammatory-mediated effects of vaginal bacteria on E6/E7 gene activation and/or protein production.
Soluble products of vaginal lactobacilli were reported as modulators of HPV-oncogene expression [30]; a positive association between the abundance of Sneathia and Megasphaera species and the expression of E6 and E7 genes was reported in cervical swabs from women with CIN-2/3 or cervical cancer [31].
In this study, we selected SiHa cells, a cell line with a few copies of HPV-16 integrated in the genome, as the experimental model of cervical neoplasia [32] and evaluated the effects of representative vaginal bacterial species on the E6/E7 oncogene expression and the production of the relative oncoproteins. We compared the effects induced by vaginal dysbiosis bacteria (G. vaginalis, A. vaginae, P. bivia, M. micronuciformis) with those induced by vaginal lactobacilli.
Our data showed that all vaginal lactobacillus species downregulated the oncogene expression. L. crispatus, the most representative species of vaginal lactobacilli [2,7,31] significantly modulated the oncogene expression and the production of the relative oncoproteins, suggesting that, in addition to preventing HPV infection [7,9,33], this species might also control viral replication and genomic integration. L. gasseri behaves similarly to L. crispatus.
These data agreed with those obtained by Wang that used the culture supernatant of vaginal lactobacilli and CaSki cells (with ~600 copies of integrated HPV-16 genome) as the experimental model [30] and also suggest that different bacterial species are responsible for gene modulation in SiHa cells.
Despite the modulation of the E7 oncogene induced by L. iners, we found that the E7 protein amount was increased compared to untreated cultures, suggesting that L. iners may activate pathways that increase the stability of the oncoprotein.
The co-expression of E6 and E7 constitutes the perfect environment for a sustained proliferation of the transformed cells [34]. However, since E6 and E7 may affect different pathways of cell cycle regulation and apoptosis, we cannot rule out that L. iners may play a role in HR-HPV-induced cancer. According to these data, a recent metanalysis suggests that Lactobacillus crispatus, but not L. iners, may be the specific protective factor against hrHPV infection, CIN, and CC [33]. Further studies are necessary to explore this point.
Among the vaginal dysbiosis bacteria, G. vaginalis and M. micronuciformis behave the opposite to L. crispatus: they increase the oncogene expression and the production of oncoproteins, suggesting a role for these species in viral-induced cancerogenesis. In contrast, P. bivia is a bacterial species able to significantly decrease the oncogene expression and the production of at least one oncoprotein (E7).
A recent survey showed a positive correlation among the abundance of Prevotella species in the vaginas of women with persistent HR-HPV and the expression of TLR4, NF-kB, C-myc, and hTERT by host cervical cells, suggesting that the overgrowth of this species may affect the rate of cervical lesions in women with persistent HPV infections [35].
As above reported, NF-kB plays an important role in HR-HPV induced cancer [24], since this pathway also leads to cyclin D1 and c-MYC transcription [25,26,27], which in turn also plays an important role in cancer progression.
The role of the TLR4 and NF-kB pathways in the expression of viral oncoproteins is still controversial.
It has been proposed that, at least in the initial phase of viral infection, the oncoproteins E6 and E7 inhibit the NF-kB activity [36], blocking an initial immune response that would be able to counteract the viral infection.
We have not studied the effects of vaginal bacteria on NF-kb activation because indirect evidence suggests that this pathway was not significantly activated by vaginal bacteria in SiHa cells. The production of the inflammatory cytokines IL-1β and TNFα and the chemokine IL-8 by SiHa cells is poorly stimulated by vaginal bacteria [16], suggesting a not significant activation of the NK-kB pathway in our experimental condition.
We are aware that these data do not authorize ruling out that vaginal bacteria affect the NF-kB dependent pathways differently. Further studies are needed to detail the molecular mechanisms activated by L. crispatus or by Prevotella species that lead to the inhibition of oncogene expression.
To obtain further evidence that G. vaginalis and M. micronuciformis interfere in the E6/E7-mediated oncogenic process, we investigated, in the same cultures, the production of p53 and pRb, the main targets of E6 and E7 oncoproteins, respectively.
E6 binds the cellular ubiquitin ligase E6AP (E6-associated protein) and induces the proteolytic degradation of p53 [37]. E7 preferentially binds the hypophosphorylated form of pRb and the complex E7/pRb functionally inactivates and degrades pRb, inducing, as a consequence, the release of E2 transcription factors and cyclin transcription, forcing the cells through premature S-phase entry [38,39,40].
We found a significant reduction in p53 and pRb oncosuppressors in cultures of SiHa cells with M. micronuciformis, in addition to an increased percentage of cells in the S phase of cell cycle after 24 h of culture. Thus, these data suggest that at least M. micronuciformis may accelerate neoplastic transformation by inducing the production of viral oncoproteins and the degradation of important cellular oncosuppressors.
Large prospective multicenter studies are needed to ascertain whether an abundance of M. micronuciformis with or without G. vaginalis can really affect the HR-HPV-induced neoplastic process.

4. Materials and Methods

4.1. Bacterial Strains

A collection of 8 vaginal bacterial reference strains were included in the study, and the related features are reported in Table 1.
L. crispatus (JV-V01), L. gasseri (SV-16A), and L. iners (UPII-60-B) were used as representative of CST-I, II, and III, respectively [41,42]. G. vaginalis was selected as representative of CST-IV and two strains isolated from women with bacterial vaginosis with Nugent Score 5 (49145/JCP-7276) or score 8 (14019/JCP-7659) were selected, respectively. A. vaginae (DSM-15829), M. micronuciformis (DNF00954), and P. bivia (DNF 00188) were also included as representative of CST-IV.

4.2. Bacterial Cultures

Bacteria were cultured on tryptic soy agar (TSA), composed of tryptic soy broth (Oxoid, Basingstoke, United Kingdom) and 1g/L of bacto-agar (Sigma Aldrich, St. Louis, MO, USA), supplemented with 5% defibrinated horse blood (Oxoid, Basingstoke, UK). Bacterial cultures were incubated at 36 ± 1 °C for 72 h in anaerobic conditions (AnaeroGen™, Thermo Fisher Scientific, Waltham, MA, USA) in a jar to create the ideal growth conditions (CO2: 9–13%; O2 < 0.01%).
Bacterial strains were then subcultured in liquid medium using TSB with 5% defibrinated horse blood (Oxoid, Basingstoke, United Kingdom). The bacterial concentration was measured using the DensiCHECK densitometer (bioMérieux, Marcy l’Étoile, France) after 1 mL of culture centrifugation at 4000× g for 5 min and pellet resuspension in 1 mL of physiological solution. The resulting McFarland value was used to calculate the bacterial concentration CFU/mL (colony forming units/mL) for the following standardization at a ratio of 1:50 with SiHa cells.

4.3. Epithelial Cell Culture

The SiHa cell line, isolated from squamous cell carcinoma and containing the HPV-16 genome (1 to 2 copies per cell), was obtained from ATCC® (ATCC® HTB35™). The SiHa cells were cultured in DMEM (Euroclone, Pero, Italy) supplemented with 10% FBS (fetal bovine serum), 1% L-glutamine, 1% penicillin and streptomycin (Euroclone, Pero, Italy) at 37 °C in the presence of 5% of CO2.

4.4. Gene Expression

RNA was extracted from 106 cells using a Total RNA Extraction Kit (RBCBioscience, Real Genomics, New Taipei City, Taiwan cat. #YRB100) and quantified using a Nanodrop (Thermo Fisher, Waltham, MA, USA) and stored at −80 °C.
For each sample, we reverse-transcribed 2 ug of RNA using PrimeScript RT-PCR (TaKara, Kusatsu, Japan, cat. #RR047A). Real-time PCR was performed by using a QuantiNova SYBR Green PCR Kit (Qiagen, Hilden, Germany, cat. #208056) as described by Paccosi S et al. [41]. The 18S gene was used as the housekeeping gene. The primers used in this work are reported in Table 2.

4.5. Western Blot Analysis

A total of 1 × 106 SiHa cells were cultured in DMEM for 6 h with and without live bacterial cells (50 MOI/cell).
Cells were lysed with RIPA buffer in the presence of a phosphatase/protease inhibitor cocktail (Sigma-Aldrich), centrifuged at 12,000 g, and 40 μg of proteins/lane was loaded onto Stain Free gel (Bio-Rad Hercules, CA, USA) SDS-PAGE and blotted onto PVDF filters and Millipore Immobilon Transfer membrane (Millipore, Sigma-Aldrich) as described [43].
Membranes were stained with mouse mAb anti-HPV16 E6/18 E6 (cat. #C1P5: sc-460, Santa Cruz Biotechnology Inc., Heidelberg, Germany), mouse mAb anti-HPV16 E7 (cat. #NM2:sc-65711, Santa Cruz Biotechnology Inc.), mouse mAb anti-p53 (D0-7) (cat. #48818, Cell Signaling Technology, Danvers, MA, USA), mouse mAb anti-pRb (cat. #9309, Cell Signaling Technology), rabbit anti-PpRb Ab (cat. #9308, Cell Signaling Technology), mouse anti-α -tubulin (B-5-1-2) (cat. #sc:-23948, Santa Cruz Biotechnology Inc.), rabbit anti-GAPDH antibodies (cat# sc:2118, Cell Signaling Technology) at 1:1000 final dilution. Goat anti-mouse IgG (H + L)-HRP conjugate or goat anti-rabbit IgG (H + L) (Human IgG Adsorbed) horseradish peroxidase conjugate (cat. #170-6516; cat. #170-6515, Bio-Rad, Hercules, CA, USA) were used as secondary antibodies at the final dilutions (1:2000). Reactions were visualized by the ECL detection system as recommended by the manufacturer (Bio-Rad, Hercules, CA, USA). The intensity of proteins of interest was acquired by the ChemiDocTouch System (Bio-Rad, Hercules, CA, USA). The densitometric analysis was expressed as the ratio between the interest protein and α-tubulin or the GAPDH housekeeping proteins by ImageLab software v.5.2 (Bio-Rad, Hercules, CA, USA) [43].

4.6. Cellular Cycle Analysis

A total of 10 × 104 SiHa cells were cultured in complete DMEM for 24 h in the presence or absence of live bacterial cells (50 MOI/cell). The cell cycle phase distribution (propidium iodide staining) was determined as previously reported [44] using a FACS Canto (Beckton & Dickinson, San Josè, CA, USA).

4.7. Statistical Analysis

Viability data were analyzed by the analysis of variance (ANOVA) with the Bonferroni P value adjustment method for multiple comparisons from five different experiments. Gene expression (real-time PCR) and protein production (Western blot densitometry) were analyzed using the pairwise Wilcoxon test and Kruskal–Wallis test with and or without the Holm p value adjustment method for multiple comparisons. A p value < 0.05 was considered statistically significant. Statistical analysis was performed using R software version 4.2.2 [45].

5. Conclusions

Our data confirm that vaginal lactobacilli and L. crispatus are particularly able to modulate the oncogene expression in SiHa cells. M. micronuciformis, and to a lesser extent, G. vaginalis, increased the production of viral oncoproteins and reduced the cellular oncosuppressors p53 and pRb.
A more detailed analysis of bacterial strains isolated from the vaginal fluids of women with early cervical lesions (CIN-1) may help to identify the factor/s able to affect the oncogenic process induced by viral proteins.

Author Contributions

Conceptualization, M.G.T.; Methodology, S.N., G.M., A.A., I.B. and C.B.; Software and statistical analysis, M.T.; Writing—review and editing, S.N., M.G.T., A.A. and G.M.R.; Resources, M.G.T., A.A., I.B., C.B., G.C. and G.M.R.; Supervision, M.G.T.; Funding acquisition, M.G.T. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Regione Toscana, V.A.M.P. Project; MIUR; Fondazione Cassa di Risparmio Firenze, Italia (grant number 2016.0961).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors would like to thank Eloisa Perissi for the technical support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. World Health Organization. Cervical Cancer. Available online: https://www.who.int/health-topics/cervical-cancer (accessed on 1 March 2023).
  2. Mitra, A.; MacIntyre, D.A.; Marchesi, J.R.; Lee, Y.S.; Bennett, P.R.; Kyrgiou, M. The Vaginal Microbiota, Human Papillomavirus Infection and Cervical Intraepithelial Neoplasia: What Do We Know and Where Are We Going Next? Microbiome 2016, 4, 58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Rodríguez, A.C.; Schiffman, M.; Herrero, R.; Hildesheim, A.; Bratti, C.; Sherman, M.E.; Solomon, D.; Guillén, D.; Alfaro, M.; Morales, J.; et al. Longitudinal Study of Human Papillomavirus Persistence and Cervical Intraepithelial Neoplasia Grade 2/3: Critical Role of Duration of Infection. J. Natl. Cancer Inst. 2010, 102, 315–324. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Khan, M.J.; Smith-McCune, K.K. Treatment of Cervical Precancers: Back to Basics. Obstet. Gynecol. 2014, 123, 1339–1343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Brotman, R.M.; Shardell, M.D.; Gajer, P.; Tracy, J.K.; Zenilman, J.M.; Ravel, J.; Gravitt, P.E. Interplay between the Temporal Dynamics of the Vaginal Microbiota and Human Papillomavirus Detection. J. Infect. Dis. 2014, 210, 1723–1733. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Shannon, B.; Yi, T.J.; Perusini, S.; Gajer, P.; Ma, B.; Humphrys, M.S.; Thomas-Pavanel, J.; Chieza, L.; Janakiram, P.; Saunders, M.; et al. Association of HPV Infection and Clearance with Cervicovaginal Immunology and the Vaginal Microbiota. Mucosal Immunol. 2017, 10, 1310–1319. [Google Scholar] [CrossRef] [Green Version]
  7. Di Paola, M.; Sani, C.; Clemente, A.M.; Iossa, A.; Perissi, E.; Castronovo, G.; Tanturli, M.; Rivero, D.; Cozzolino, F.; Cavalieri, D.; et al. Characterization of Cervico-Vaginal Microbiota in Women Developing Persistent High-Risk Human Papillomavirus Infection. Sci. Rep. 2017, 7, 10200. [Google Scholar] [CrossRef] [PubMed]
  8. Usyk, M.; Zolnik, C.P.; Castle, P.E.; Porras, C.; Herrero, R.; Gradissimo, A.; Gonzalez, P.; Safaeian, M.; Schiffman, M.; Burk, R.D. Cervicovaginal Microbiome and Natural History of HPV in a Longitudinal Study. PLoS Pathog. 2020, 16, e1008376. [Google Scholar] [CrossRef] [Green Version]
  9. Norenhag, J.; Du, J.; Olovsson, M.; Verstraelen, H.; Engstrand, L.; Brusselaers, N. The Vaginal Microbiota, Human Papillomavirus and Cervical Dysplasia: A Systematic Review and Network Meta-Analysis. BJOG 2020, 127, 171–180. [Google Scholar] [CrossRef]
  10. Mitra, A.; MacIntyre, D.A.; Ntritsos, G.; Smith, A.; Tsilidis, K.K.; Marchesi, J.R.; Bennett, P.R.; Moscicki, A.-B.; Kyrgiou, M. The Vaginal Microbiota Associates with the Regression of Untreated Cervical Intraepithelial Neoplasia 2 Lesions. Nat. Commun. 2020, 11, 1999. [Google Scholar] [CrossRef] [Green Version]
  11. Scheffner, M.; Werness, B.A.; Huibregtse, J.M.; Levine, A.J.; Howley, P.M. The E6 Oncoprotein Encoded by Human Papillomavirus Types 16 and 18 Promotes the Degradation of P53. Cell 1990, 63, 1129–1136. [Google Scholar] [CrossRef] [PubMed]
  12. Dyson, N.; Howley, P.M.; Münger, K.; Harlow, E. The Human Papilloma Virus-16 E7 Oncoprotein Is Able to Bind to the Retinoblastoma Gene Product. Science 1989, 243, 934–937. [Google Scholar] [CrossRef] [PubMed]
  13. Hussain, S.S.; Lundine, D.; Leeman, J.E.; Higginson, D.S. Genomic Signatures in HPV-Associated Tumors. Viruses 2021, 13, 1998. [Google Scholar] [CrossRef] [PubMed]
  14. Choi, S.; Ismail, A.; Pappas-Gogos, G.; Boussios, S. HPV and Cervical Cancer: A Review of Epidemiology and Screening Uptake in the UK. Pathogens 2023, 12, 298. [Google Scholar] [CrossRef] [PubMed]
  15. Stanley, M. Immune Responses to Human Papillomavirus. Vaccine 2006, 24 (Suppl. 1), S16–S22. [Google Scholar] [CrossRef] [PubMed]
  16. Nicolò, S.; Tanturli, M.; Mattiuz, G.; Antonelli, A.; Baccani, I.; Bonaiuto, C.; Baldi, S.; Nannini, G.; Menicatti, M.; Bartolucci, G.; et al. Vaginal Lactobacilli and Vaginal Dysbiosis-Associated Bacteria Differently Affect Cervical Epithelial and Immune Homeostasis and Anti-Viral Defenses. Int. J. Mol. Sci. 2021, 22, 6487. [Google Scholar] [CrossRef]
  17. Kyrgiou, M.; Moscicki, A.-B. Vaginal Microbiome and Cervical Cancer. Semin. Cancer Biol. 2022, 86, 189–198. [Google Scholar] [CrossRef] [PubMed]
  18. Anahtar, M.N.; Byrne, E.H.; Doherty, K.E.; Bowman, B.A.; Yamamoto, H.S.; Soumillon, M.; Padavattan, N.; Ismail, N.; Moodley, A.; Sabatini, M.E.; et al. Cervicovaginal Bacteria Are a Major Modulator of Host Inflammatory Responses in the Female Genital Tract. Immunity 2015, 42, 965–976. [Google Scholar] [CrossRef] [Green Version]
  19. Schwabe, R.F.; Jobin, C. The Microbiome and Cancer. Nat. Rev. Cancer 2013, 13, 800–812. [Google Scholar] [CrossRef] [Green Version]
  20. Fulbright, L.E.; Ellermann, M.; Arthur, J.C. The Microbiome and the Hallmarks of Cancer. PLOS Pathog. 2017, 13, e1006480. [Google Scholar] [CrossRef]
  21. Chambers, L.M.; Bussies, P.; Vargas, R.; Esakov, E.; Tewari, S.; Reizes, O.; Michener, C. The Microbiome and Gynecologic Cancer: Current Evidence and Future Opportunities. Curr. Oncol. Rep. 2021, 23, 92. [Google Scholar] [CrossRef]
  22. Ilhan, Z.E.; Łaniewski Pawełand Thomas, N.; Roe, D.J.; Chase, D.M.; Herbst-Kralovetz, M.M. Deciphering the Complex Interplay between Microbiota, HPV, Inflammation and Cancer through Cervicovaginal Metabolic Profiling. EBioMedicine 2019, 44, 675–690. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Caselli, E.; D’Accolti, M.; Santi, E.; Soffritti, I.; Conzadori, S.; Mazzacane, S.; Greco, P.; Contini, C.; Bonaccorsi, G. Vaginal Microbiota and Cytokine Microenvironment in HPV Clearance/Persistence in Women Surgically Treated for Cervical Intraepithelial Neoplasia: An Observational Prospective Study. Front. Cell. Infect. Microbiol. 2020, 10, 693. [Google Scholar] [CrossRef]
  24. Tilborghs, S.; Corthouts, J.; Verhoeven, Y.; Arias, D.; Rolfo, C.; Trinh, X.B.; van Dam, P.A. The Role of Nuclear Factor-Kappa B Signaling in Human Cervical Cancer. Crit. Rev. Oncol. Hematol. 2017, 120, 141–150. [Google Scholar] [CrossRef] [PubMed]
  25. Perkins, N.D. Achieving Transcriptional Specificity with Nf-Κb. Int. J. Biochem. Cell Biol. 1997, 29, 1433–1448. [Google Scholar] [CrossRef]
  26. Guttridge, D.C.; Albanese, C.; Reuther, J.Y.; Pestell, R.G.; Baldwin, A.S.J. NF-KappaB Controls Cell Growth and Differentiation through Transcriptional Regulation of Cyclin D1. Mol. Cell. Biol. 1999, 19, 5785–5799. [Google Scholar] [CrossRef] [Green Version]
  27. La Rosa, F.A.; Pierce, J.W.; Sonenshein, G.E. Differential Regulation of the C-Myc Oncogene Promoter by the NF-Kappa B Rel Family of Transcription Factors. Mol. Cell. Biol. 1994, 14, 1039–1044. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Rebhandl, S.; Huemer, M.; Greil, R.; Geisberger, R. AID/APOBEC Deaminases and Cancer. Oncoscience 2015, 2, 320–333. [Google Scholar] [CrossRef] [Green Version]
  29. Longworth, M.S.; Laimins, L.A. Pathogenesis of Human Papillomaviruses in Differentiating Epithelia. Microbiol. Mol. Biol. Rev. 2004, 68, 362–372. [Google Scholar] [CrossRef] [Green Version]
  30. Wang, K.-D.; Xu, D.-J.; Wang, B.-Y.; Yan, D.-H.; Lv, Z.; Su, J.-R. Inhibitory Effect of Vaginal Lactobacillus Supernatants on Cervical Cancer Cells. Probiot. Antimicrob. Proteins 2018, 10, 236–242. [Google Scholar] [CrossRef]
  31. Hang, L.; Hua, L.; Di, L.; Ming, W.; Yan, L. Association of Cervical Dysbacteriosis, HPV Oncogene Expression, and Cervical Lesion Progression. Microbiol. Spectr. 2022, 10, e00151-22. [Google Scholar] [CrossRef]
  32. Friedl, F.; Kimura, I.; Osato, T.; Ito, Y. Studies on a New Human Cell Line (SiHa) Derived from Carcinoma of Uterus. I. Its Establishment and Morphology. Proc. Soc. Exp. Biol. Med. 1970, 135, 543–545. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, H.; Ma, Y.; Li, R.; Chen, X.; Wan, L.; Zhao, W. Associations of Cervicovaginal Lactobacilli with High-Risk Human Papillomavirus Infection, Cervical Intraepithelial Neoplasia, and Cancer: A Systematic Review and Meta-Analysis. J. Infect. Dis. 2019, 220, 1243–1254. [Google Scholar] [CrossRef]
  34. Barbosa, M.S.; Schlegel, R. The E6 and E7 Genes of HPV-18 Are Sufficient for Inducing Two-Stage In Vitro Transformation of Human Keratinocytes. Oncogene 1989, 4, 1529–1532. [Google Scholar]
  35. Dong, B.; Huang, Y.; Cai, H.; Chen, Y.; Li, Y.; Zou, H.; Lin, W.; Xue, H.; Feng, A.; Zhao, H.; et al. Prevotella as the Hub of the Cervicovaginal Microbiota Affects the Occurrence of Persistent Human Papillomavirus Infection and Cervical Lesions in Women of Childbearing Age via Host NF-ΚB/C-Myc. J. Med. Virol. 2022, 94, 5519–5534. [Google Scholar] [CrossRef]
  36. Vandermark, E.R.; Deluca, K.A.; Gardner, C.R.; Marker, D.F.; Schreiner, C.N.; Strickland, D.A.; Wilton, K.M.; Mondal, S.; Woodworth, C.D. Human Papillomavirus Type 16 E6 and E7 Proteins Alter NF-KB in Cultured Cervical Epithelial Cells and Inhibition of NF-KB Promotes Cell Growth and Immortalization. Virology 2012, 425, 53–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Martinez-Zapien, D.; Ruiz, F.X.; Poirson, J.; Mitschler, A.; Ramirez, J.; Forster, A.; Cousido-Siah, A.; Masson, M.; Vande Pol, S.; Podjarny, A.; et al. Structure of the E6/E6AP/P53 Complex Required for HPV-Mediated Degradation of P53. Nature 2016, 529, 541–545. [Google Scholar] [CrossRef] [Green Version]
  38. Roman, A.; Munger, K. The Papillomavirus E7 Proteins. Virology 2013, 445, 138–168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Boyer, S.N.; Wazer, D.E.; Band, V. E7 Protein of Human Papilloma Virus-16 Induces Degradation of Retinoblastoma Protein through the Ubiquitin-Proteasome Pathway. Cancer Res. 1996, 56, 4620–4624. [Google Scholar] [PubMed]
  40. Hoppe-Seyler, K.; Bossler, F.; Braun, J.A.; Herrmann, A.L.; Hoppe-Seyler, F. The HPV E6/E7 Oncogenes: Key Factors for Viral Carcinogenesis and Therapeutic Targets. Trends Microbiol. 2018, 26, 158–168. [Google Scholar] [CrossRef]
  41. Paccosi, S.; Musilli, C.; Caporale, R.; Gelli, A.M.G.; Guasti, D.; Clemente, A.M.; Torcia, M.G.; Filippelli, A.; Romagnoli, P.; Parenti, A. Stimulatory interactions between human coronary smooth muscle cells and dendritic cells. PLoS ONE 2014, 9, e0099652. [Google Scholar] [CrossRef] [Green Version]
  42. Ravel, J.; Gajer, P.; Abdo, Z.; Schneider, G.M.; Koenig, S.S.K.; McCulle, S.L.; Karlebach, S.; Gorle, R.; Russell, J.; Tacket, C.O.; et al. Vaginal Microbiome of Reproductive-Age Women. Proc. Natl. Acad. Sci. USA 2011, 108 (Suppl. 1), 4680–4687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Castronovo, G.; Clemente, A.M.; Antonelli, A.; D’Andrea, M.M.; Tanturli, M.; Perissi, E.; Paccosi, S.; Parenti, A.; Cozzolino, F.; Rossolini, G.M.; et al. Differences in Inflammatory Response Induced by Two Representatives of Clades of the Pandemic ST258 Klebsiella pneumoniae Clonal Lineage Producing KPC-Type Carbapenemases. PLoS ONE 2017, 12, e0170125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Barbetti, V.; Tusa, I.; Cipolleschi, M.G.; Rovida, E.; Dello Sbarba, P. AML1/ETO Sensitizes via TRAIL Acute Myeloid Leukemia Cells to the pro-Apoptotic Effects of Hypoxia. Cell Death Dis. 2013, 4, e536. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. R Core Team R. A Language and Environment for Statistical Computing; R Core Team R: Vienna, Austria, 2020. [Google Scholar]
Figure 1. Effects of the bacterial strains on the expression of the HPV16 E6 (A) and E7 (B) oncogenes in the SiHa cells. Data are expressed as fold-change in the mRNA relative amount with respect to the untreated cultures (Ctrl). The box plot shows the median f five different experiments and the whisker was calculated using the formula IQR × 1.5. Statistical analysis was performed by the Kruskal–Wallis test with Holm–Bonferroni p value adjustment. p value E6 = 0.33; p value * E7 = 0.001; ** p value vs. Ctrl 0.005.
Figure 1. Effects of the bacterial strains on the expression of the HPV16 E6 (A) and E7 (B) oncogenes in the SiHa cells. Data are expressed as fold-change in the mRNA relative amount with respect to the untreated cultures (Ctrl). The box plot shows the median f five different experiments and the whisker was calculated using the formula IQR × 1.5. Statistical analysis was performed by the Kruskal–Wallis test with Holm–Bonferroni p value adjustment. p value E6 = 0.33; p value * E7 = 0.001; ** p value vs. Ctrl 0.005.
Ijms 24 07173 g001
Figure 2. The effects of bacterial strains on the production of HPV-16 E6 (A) and E7 (B) oncoproteins in the SiHa cells. The amount of E6 and E7 proteins were evaluated by Western blot analysis. The figure shows the results of one representative experiment out of five performed. The box plot below represents the median of five different experiments and the whisker was calculated using the formula IQR × 1.5. Statistical analysis was performed by the Kruskal–Wallis test and pairwise Wilcoxon test comparisons. p value E6 = 0.7; p value E7 = 0.002; ** p-value ≤ 0.005 of bacterial stimulated cultures vs. untreated cell cultures (Ctrl).
Figure 2. The effects of bacterial strains on the production of HPV-16 E6 (A) and E7 (B) oncoproteins in the SiHa cells. The amount of E6 and E7 proteins were evaluated by Western blot analysis. The figure shows the results of one representative experiment out of five performed. The box plot below represents the median of five different experiments and the whisker was calculated using the formula IQR × 1.5. Statistical analysis was performed by the Kruskal–Wallis test and pairwise Wilcoxon test comparisons. p value E6 = 0.7; p value E7 = 0.002; ** p-value ≤ 0.005 of bacterial stimulated cultures vs. untreated cell cultures (Ctrl).
Ijms 24 07173 g002
Figure 3. The effect of bacterial strains on the amount of p53 (A) and pRb (B) proteins in SiHa cells. Western blot analysis with anti p53 and anti P-pRb antibodies. Data from one representative experiment out of five performed are shown. Bar graph shows the mean of five different experiments ± SE. Statistical analysis was performed by the Kruskal–Wallis test with Holm–Bonferroni p value adjustment. * p-value ≤ 0.05 of bacterial stimulated cultures vs. untreated cell cultures (Ctrl).
Figure 3. The effect of bacterial strains on the amount of p53 (A) and pRb (B) proteins in SiHa cells. Western blot analysis with anti p53 and anti P-pRb antibodies. Data from one representative experiment out of five performed are shown. Bar graph shows the mean of five different experiments ± SE. Statistical analysis was performed by the Kruskal–Wallis test with Holm–Bonferroni p value adjustment. * p-value ≤ 0.05 of bacterial stimulated cultures vs. untreated cell cultures (Ctrl).
Ijms 24 07173 g003
Figure 4. The effect of bacterial strains on the SiHa cell cycle. Results are shown as the mean percentage of cells ± SE in each phase of the cell cycle (G0/G1, S, and G2/M) recorded by FACS analysis (CSFE fluorescent staining). The bar graph represents the means ± SE of three different experiments. Statistical analysis was performed by the Student t-test. * p-value ≤ 0.05 of the bacterial stimulated cultures vs. untreated cell cultures (Ctrl).
Figure 4. The effect of bacterial strains on the SiHa cell cycle. Results are shown as the mean percentage of cells ± SE in each phase of the cell cycle (G0/G1, S, and G2/M) recorded by FACS analysis (CSFE fluorescent staining). The bar graph represents the means ± SE of three different experiments. Statistical analysis was performed by the Student t-test. * p-value ≤ 0.05 of the bacterial stimulated cultures vs. untreated cell cultures (Ctrl).
Ijms 24 07173 g004
Table 1. Reference bacterial strains.
Table 1. Reference bacterial strains.
CSTFamily and GenusSpeciesStrain
ILactobacillaceae, LactobacillusL. crispatusJV-V01
IILactobacillaceae, LactobacillusL. gasseriSV-16A
IIILactobacillaceae, LactobacillusL. inersUPII-60-B
IVBifidobacteriaceae, GardnerellaG. vaginalis49145/JCP-7276
IVBifidobacteriaceae, GardnerellaG. vaginalis14019/JCP-7659
IVVeillonellaceae, MegasphaeraM. micronuciformisDNF-00954
IVPrevotellaceae, PrevotellaP. biviaDNF-0018
IVAtopobiaceae, AtopobiumA. vaginalisDSM-15829
Table 2. Oligonucleotide sequences used in this study.
Table 2. Oligonucleotide sequences used in this study.
GeneForward 5′-3′Reverse 3′-5′
18SATTAAGGGTGTGGGCCGAAGGGTGATCACACGTTCCACCT
E6CGACCCAGAAAGTTACCAAGCAAAGTCATATACCTCACG
E7GCCACCATGCATGGAGATACACCTACAGATCAGCCATGGTACATTATGG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Nicolò, S.; Antonelli, A.; Tanturli, M.; Baccani, I.; Bonaiuto, C.; Castronovo, G.; Rossolini, G.M.; Mattiuz, G.; Torcia, M.G. Bacterial Species from Vaginal Microbiota Differently Affect the Production of the E6 and E7 Oncoproteins and of p53 and p-Rb Oncosuppressors in HPV16-Infected Cells. Int. J. Mol. Sci. 2023, 24, 7173. https://doi.org/10.3390/ijms24087173

AMA Style

Nicolò S, Antonelli A, Tanturli M, Baccani I, Bonaiuto C, Castronovo G, Rossolini GM, Mattiuz G, Torcia MG. Bacterial Species from Vaginal Microbiota Differently Affect the Production of the E6 and E7 Oncoproteins and of p53 and p-Rb Oncosuppressors in HPV16-Infected Cells. International Journal of Molecular Sciences. 2023; 24(8):7173. https://doi.org/10.3390/ijms24087173

Chicago/Turabian Style

Nicolò, Sabrina, Alberto Antonelli, Michele Tanturli, Ilaria Baccani, Chiara Bonaiuto, Giuseppe Castronovo, Gian Maria Rossolini, G. Mattiuz, and M. G. Torcia. 2023. "Bacterial Species from Vaginal Microbiota Differently Affect the Production of the E6 and E7 Oncoproteins and of p53 and p-Rb Oncosuppressors in HPV16-Infected Cells" International Journal of Molecular Sciences 24, no. 8: 7173. https://doi.org/10.3390/ijms24087173

APA Style

Nicolò, S., Antonelli, A., Tanturli, M., Baccani, I., Bonaiuto, C., Castronovo, G., Rossolini, G. M., Mattiuz, G., & Torcia, M. G. (2023). Bacterial Species from Vaginal Microbiota Differently Affect the Production of the E6 and E7 Oncoproteins and of p53 and p-Rb Oncosuppressors in HPV16-Infected Cells. International Journal of Molecular Sciences, 24(8), 7173. https://doi.org/10.3390/ijms24087173

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop