A Pilot Study to Evaluate Genipin in Staphylococcus aureus and Pseudomonas aeruginosa Keratitis Models: Modulation of Pro-Inflammatory Cytokines and Matrix Metalloproteinases
Abstract
1. Introduction
2. Results
2.1. Genipin Alleviates the Severity of Bacterial Keratitis—Improved Management of Descemetocele and Corneal Perforation after Topical Genipin Treatment
2.2. Decreased Inflammatory Cell Infiltration in Genipin-Treated Eyes
2.3. Microbial Log Reduction
2.4. Genipin Regulates the Host’s Immune Response to Infection
3. Discussion
4. Materials and Methods
4.1. Study Design
4.2. Bacterial Strains
4.3. Induction of Keratitis and Treatment Regimen
4.4. Clinical Examination
4.5. Confocal Corneal Evaluation
4.6. Histological Analysis
4.7. Bacterial Colony-Forming Unit Analysis—Plate Count
4.8. Quantitative Real-Time Polymerase Chain Reaction
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Flaxman, S.R.; Bourne, R.R.A.; Resnikoff, S.; Ackland, P.; Braithwaite, T.; Cicinelli, M.V.; Das, A.; Jonas, J.B.; Keeffe, J.; Kempen, J.H.; et al. Global causes of blindness and distance vision impairment 1990–2020: A systematic review and meta-analysis. Lancet Glob. Health 2017, 5, e1221–e1234. [Google Scholar] [CrossRef]
- Ung, L.; Bispo, P.J.M.; Shanbhag, S.S.; Gilmore, M.S.; Chodosh, J. The persistent dilemma of microbial keratitis: Global burden, diagnosis, and antimicrobial resistance. Surv. Ophthalmol. 2019, 64, 255–271. [Google Scholar] [CrossRef] [PubMed]
- Pascolini, D.; Mariotti, S.P. Global estimates of visual impairment: 2010. Br. J. Ophthalmol. 2012, 96, 614–618. [Google Scholar] [CrossRef] [PubMed]
- Steinmetz, J.D.; Bourne, R.R.A.; Briant, P.S.; Flaxman, S.R.; Taylor, H.R.B.; Jonas, J.B.; Abdoli, A.A.; Abrha, W.A.; Abualhasan, A.; Abu-Gharbieh, E.G.; et al. Causes of blindness and vision impairment in 2020 and trends over 30 years, and prevalence of avoidable blindness in relation to VISION 2020: The Right to Sight: An analysis for the Global Burden of Disease Study. Lancet Glob. Health 2021, 9, e144–e160. [Google Scholar] [CrossRef] [PubMed]
- Ting, D.S.J.; Ho, C.S.; Deshmukh, R.; Said, D.G.; Dua, H.S. Infectious keratitis: An update on epidemiology, causative microorganisms, risk factors, and antimicrobial resistance. Eye 2021, 35, 1084–1101. [Google Scholar] [CrossRef]
- Acharya, N.R.; Agarwal, T.; Alfonso, E.C.; Bagga, B.; Bispo, P.J.; Burton, M.J.; Dart, J.K.; Doan, T.; Fleiszig, S.M.; Garg, P. Infectious corneal ulceration: A proposal for neglected tropical disease status. Bull. World Health Organ. 2019, 97, 854–856. [Google Scholar]
- Köberlein, J.; Beifus, K.; Schaffert, C.; Finger, R.P. The economic burden of visual impairment and blindness: A systematic review. BMJ Open 2013, 3, e003471. [Google Scholar] [CrossRef]
- Khor, W.B.; Prajna, V.N.; Garg, P.; Mehta, J.S.; Xie, L.; Liu, Z.; Padilla, M.D.B.; Joo, C.K.; Inoue, Y.; Goseyarakwong, P.; et al. The Asia Cornea Society Infectious Keratitis Study: A Prospective Multicenter Study of Infectious Keratitis in Asia. Am. J. Ophthalmol. 2018, 195, 161–170. [Google Scholar] [CrossRef]
- Austin, A.; Lietman, T.; Rose-Nussbaumer, J. Update on the Management of Infectious Keratitis. Ophthalmology 2017, 124, 1678–1689. [Google Scholar] [CrossRef]
- Li, J.; Ma, X.; Zhao, L.; Li, Y.; Zhou, Q.; Du, X. Extended Contact Lens Wear Promotes Corneal Norepinephrine Secretion and Pseudomonas aeruginosa Infection in Mice. Investig. Ophthalmol. Vis. Sci. 2020, 61, 17. [Google Scholar] [CrossRef]
- Singh, M.; Gour, A.; Gandhi, A.; Mathur, U.; Farooqui, J.H. Demographic details, risk factors, microbiological profile, and clinical outcomes of pediatric infectious keratitis cases in North India. Indian J. Ophthalmol. 2020, 68, 434–440. [Google Scholar] [CrossRef] [PubMed]
- Grandi, G.; Bianco, G.; Boattini, M.; Scalabrin, S.; Iannaccone, M.; Fea, A.; Cavallo, R.; Costa, C. Bacterial etiology and antimicrobial resistance trends in ocular infections: A 30-year study, Turin area, Italy. Eur. J. Ophthalmol. 2021, 31, 405–414. [Google Scholar] [CrossRef] [PubMed]
- Lin, A.; Rhee, M.K.; Akpek, E.K.; Amescua, G.; Farid, M.; Garcia-Ferrer, F.J.; Varu, D.M.; Musch, D.C.; Dunn, S.P.; Mah, F.S. Bacterial Keratitis Preferred Practice Pattern(R). Ophthalmology 2019, 126, P1–P55. [Google Scholar] [CrossRef]
- Hilliam, Y.; Kaye, S.; Winstanley, C. Pseudomonas aeruginosa and microbial keratitis. J. Med. Microbiol. 2020, 69, 3–13. [Google Scholar] [CrossRef]
- Tena, D.; Rodríguez, N.; Toribio, L.; González-Praetorius, A. Infectious Keratitis: Microbiological Review of 297 Cases. Jpn. J. Infect. Dis. 2019, 72, 121–123. [Google Scholar] [CrossRef] [PubMed]
- Lakhundi, S.; Siddiqui, R.; Khan, N.A. Pathogenesis of microbial keratitis. Microb. Pathog. 2017, 104, 97–109. [Google Scholar] [CrossRef]
- Jamerson, E.C.; Elhusseiny, A.M.; ElSheikh, R.H.; Eleiwa, T.K.; El Sayed, Y.M. Role of Matrix Metalloproteinase 9 in Ocular Surface Disorders. Eye Contact Lens. 2020, 46 (Suppl 2), S57–S63. [Google Scholar] [CrossRef]
- Miyajima, S.; Akaike, T.; Matsumoto, K.; Okamoto, T.; Yoshitake, J.; Hayashida, K.; Negi, A.; Maeda, H. Matrix metalloproteinases induction by pseudomonal virulence factors and inflammatory cytokines in vitro. Microb. Pathog. 2001, 31, 271–281. [Google Scholar] [CrossRef] [PubMed]
- Thibodeaux, B.A.; Caballero, A.R.; Marquart, M.E.; Tommassen, J.; O’Callaghan, R.J. Corneal virulence of Pseudomonas aeruginosa elastase B and alkaline protease produced by Pseudomonas putida. Curr. Eye Res. 2007, 32, 373–386. [Google Scholar] [CrossRef]
- Zhang, Y.; Liang, Q.; Liu, Y.; Pan, Z.; Baudouin, C.; Labbé, A.; Lu, Q. Expression of cytokines in aqueous humor from fungal keratitis patients. BMC Ophthalmol. 2018, 18, 105. [Google Scholar] [CrossRef]
- Yamaguchi, T.; Calvacanti, B.M.; Cruzat, A.; Qazi, Y.; Ishikawa, S.; Osuka, A.; Lederer, J.; Hamrah, P. Correlation between human tear cytokine levels and cellular corneal changes in patients with bacterial keratitis by in vivo confocal microscopy. Investig. Ophthalmol. Vis. Sci. 2014, 55, 7457–7466. [Google Scholar] [CrossRef] [PubMed]
- Ghasemi, H. Roles of IL-6 in Ocular Inflammation: A Review. Ocul. Immunol. Inflamm. 2018, 26, 37–50. [Google Scholar] [CrossRef]
- Ghasemi, H.; Ghazanfari, T.; Yaraee, R.; Faghihzadeh, S.; Hassan, Z.M. Roles of IL-8 in ocular inflammations: A review. Ocul. Immunol. Inflamm. 2011, 19, 401–412. [Google Scholar] [CrossRef] [PubMed]
- Keadle, T.L.; Usui, N.; Laycock, K.A.; Miller, J.K.; Pepose, J.S.; Stuart, P.M. IL-1 and TNF-α Are Important Factors in the Pathogenesis of Murine Recurrent Herpetic Stromal Keratitis. Investig. Ophthalmol. Vis. Sci. 2000, 41, 96–102. [Google Scholar] [PubMed]
- Cole, N.; Bao, S.; Willcox, M.; Husband, A.J. TNF-alpha production in the cornea in response to Pseudomonas aeruginosa challenge. Immunol. Cell Biol. 1999, 77, 164–166. [Google Scholar] [CrossRef]
- Kennedy, M.; Kim, K.H.; Harten, B.; Brown, J.; Planck, S.; Meshul, C.; Edelhauser, H.; Rosenbaum, J.T.; Armstrong, C.A.; Ansel, J.C. Ultraviolet irradiation induces the production of multiple cytokines by human corneal cells. Investig. Ophthalmol. Vis. Sci. 1997, 38, 2483–2491. [Google Scholar]
- Bryant-Hudson, K.M.; Gurung, H.R.; Zheng, M.; Carr, D.J. Tumor necrosis factor alpha and interleukin-6 facilitate corneal lymphangiogenesis in response to herpes simplex virus 1 infection. J. Virol. 2014, 88, 14451–14457. [Google Scholar] [CrossRef]
- Egrilmez, S.; Yildirim-Theveny, S. Treatment-Resistant Bacterial Keratitis: Challenges and Solutions. Clin. Ophthalmol. 2020, 14, 287–297. [Google Scholar] [CrossRef]
- Prajna, N.V.; Srinivasan, M.; Mascarenhas, J.; Lalitha, P.; Rajaraman, R.; McClintic, S.M.; O’Brien, K.S.; Ray, K.J.; Acharya, N.R.; Lietman, T.M.; et al. Visual Impairment in Fungal Versus Bacterial Corneal Ulcers 4 Years After Successful Antimicrobial Treatment. Am. J. Ophthalmol. 2019, 204, 124–129. [Google Scholar] [CrossRef]
- Zhang, Q.; Zhao, M.; Xu, M.; Gu, F.; Liu, Q.; Chen, Y.; Zhang, H.; Kijlstra, A. Outcomes of therapeutic keratoplasty for severe infectious keratitis in Chongqing, a 16-year experience. Infect. Drug Resist. 2019, 12, 2487–2493. [Google Scholar] [CrossRef]
- Szentmáry, N.; Módis, L.; Imre, L.; Füst, Á.; Daas, L.; Laurik, L.; Seitz, B.; Nagy, Z.Z. Diagnostics and treatment of infectious keratitis. Orv. Hetil. 2017, 158, 1203–1212. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mathews, P.M.; Lindsley, K.; Aldave, A.J.; Akpek, E.K. Etiology of Global Corneal Blindness and Current Practices of Corneal Transplantation: A Focused Review. Cornea 2018, 9, 1198–1203. [Google Scholar] [CrossRef] [PubMed]
- Asbell, P.A.; Sanfilippo, C.M.; Sahm, D.F.; DeCory, H.H. Trends in Antibiotic Resistance Among Ocular Microorganisms in the United States From 2009 to 2018. JAMA Ophthalmol. 2020, 138, 439–450. [Google Scholar] [CrossRef]
- Lin, L.; Duan, F.; Yang, Y.; Lou, B.; Liang, L.; Lin, X. Nine-year analysis of isolated pathogens and antibiotic susceptibilities of microbial keratitis from a large referral eye center in southern China. Infect. Drug Resist. 2019, 12, 1295–1302. [Google Scholar] [CrossRef] [PubMed]
- Cabrera-Aguas, M.; Khoo, P.; George, C.R.R.; Lahra, M.M.; Watson, S.L. Antimicrobial resistance trends in bacterial keratitis over 5 years in Sydney, Australia. Clin. Exp. Ophthalmol. 2020, 48, 183–191. [Google Scholar] [CrossRef]
- Peterson, J.C.; Durkee, H.; Miller, D.; Maestre-Mesa, J.; Arboleda, A.; Aguilar, M.C.; Relhan, N.; Flynn, H.W., Jr.; Amescua, G.; Parel, J.M.; et al. Molecular epidemiology and resistance profiles among healthcare- and community-associated Staphylococcus aureus keratitis isolates. Infect. Drug Resist. 2019, 12, 831–843. [Google Scholar] [CrossRef]
- Galvis, V.; Parra, M.M.; Tello, A.; Castellanos, Y.A.; Camacho, P.A.; Villarreal, D.; Salcedo, S.L.L. Antibiotic resistance profile in eye infections in a reference centre in Floridablanca, Colombia. Arch. Soc. Esp. Oftalmol. (Engl. Ed.) 2019, 94, 4–11. [Google Scholar] [CrossRef]
- Hobbs, C.A.; Koyanagi, M.; Swartz, C.; Davis, J.; Maronpot, R.; Recio, L.; Hayashi, S.M. Genotoxicity evaluation of the naturally-derived food colorant, gardenia blue, and its precursor, genipin. Food Chem. Toxicol. 2018, 118, 695–708. [Google Scholar] [CrossRef]
- Xiao, W.; Li, S.; Wang, S.; Ho, C.T. Chemistry and bioactivity of Gardenia jasminoides. J. Food. Drug. Anal. 2017, 25, 43–61. [Google Scholar] [CrossRef]
- Wang, C.; Lau, T.T.; Loh, W.L.; Su, K.; Wang, D.A. Cytocompatibility study of a natural biomaterial crosslinker--Genipin with therapeutic model cells. J. Biomed. Mater. Res. B Appl. Biomater. 2011, 97, 58–65. [Google Scholar] [CrossRef]
- Neri-Numa, I.A.; Pessoa, G.M.; Paulino, B.N.; Pastore, G.M. Genipin: A natural blue pigment for food and health purposes. Trends Food Sci. Technol. 2017, 67, 271–279. [Google Scholar] [CrossRef]
- Yan, L.P.; Wang, Y.J.; Ren, L.; Wu, G.; Caridade, S.G.; Fan, J.B.; Wang, L.Y.; Ji, P.H.; Oliveira, J.M.; Oliveira, J.T.; et al. Genipin-cross-linked collagen/chitosan biomimetic scaffolds for articular cartilage tissue engineering applications. J. Biomed. Mater. Res. A 2010, 95, 465–475. [Google Scholar] [CrossRef]
- Song, W.; Tang, Y.; Qiao, J.; Li, H.; Rong, B.; Yang, S.; Wu, Y.; Yan, X. The Short-Term Safety Evaluation of Corneal Crosslinking Agent-Genipin. Ophthalmic. Res. 2019, 62, 141–149. [Google Scholar] [CrossRef] [PubMed]
- Koo, H.J.; Song, Y.S.; Kim, H.J.; Lee, Y.H.; Hong, S.M.; Kim, S.J.; Kim, B.C.; Jin, C.; Lim, C.J.; Park, E.H. Antiinflammatory effects of genipin, an active principle of gardenia. Eur. J. Pharmacol. 2004, 495, 201–208. [Google Scholar] [CrossRef]
- Koudouna, E.; Huertas-Bello, M.; Rodriguez, C.N.; Consuelo Henao, S.; Navarrete, M.L.; Avila, M.Y. Genipin in an Ex Vivo Corneal Model of Bacterial and Fungal Keratitis. Transl. Vis. Sci. Technol. 2021, 10, 31. [Google Scholar] [CrossRef]
- Avik Khan, A.; Gallah, H.; Riedl, B.; Bouchard, J.; Agnes Safrany, A.; Lacroix, M. Genipin cross-linked antimicrobial nanocomposite films and gamma irradiation to prevent the surface growth of bacteria in fresh meats. Innov. Food Sci. Emerg. Technol. 2016, 35, 96–102. [Google Scholar] [CrossRef]
- Hong, M.; Lee, S.; Clayton, J.; Yake, W.; Li, J. Genipin suppression of growth and metastasis in hepatocellular carcinoma through blocking activation of STAT-3. J. Exp. Clin. Cancer Res. 2020, 39, 146. [Google Scholar] [CrossRef]
- Shanmugam, M.K.; Shen, H.; Tang, F.R.; Arfuso, F.; Rajesh, M.; Wang, L.; Kumar, A.P.; Bian, J.; Goh, B.C.; Bishayee, A.; et al. Potential role of genipin in cancer therapy. Pharmacol. Res. 2018, 133, 195–200. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Zhu, M.; Tsao, S.W.; Man, K.; Zhang, Z.; Feng, Y. Up-regulation of TIMP-1 by genipin inhibits MMP-2 activities and suppresses the metastatic potential of human hepatocellular carcinoma. PLoS ONE. 2012, 7, e46318. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Chen, L.; Liang, Z.; Li, Y.; Yuan, F.; Liu, J.; Tian, Y.; Hao, Z.; Zhou, F.; Liu, X.; et al. Genipin Inhibits LPS-Induced Inflammatory Response in BV2 Microglial Cells. Neurochem. Res. 2017, 42, 2769–2776. [Google Scholar] [CrossRef]
- Yu, S.X.; Du, C.T.; Chen, W.; Lei, Q.Q.; Li, N.; Qi, S.; Zhang, X.J.; Hu, G.Q.; Deng, X.M.; Han, W.Y.; et al. Genipin inhibits NLRP3 and NLRC4 inflammasome activation via autophagy suppression. Sci. Rep. 2015, 5, 17935. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Yin, F.; Zheng, X.; Jing, J.; Hu, Y. Geniposide, a novel agonist for GLP-1 receptor, prevents PC12 cells from oxidative damage via MAP kinase pathway. Neurochem. Int. 2007, 51, 361–369. [Google Scholar] [CrossRef] [PubMed]
- Manickam, B.; Sreedharan, R.; Elumalai, M. ‘Genipin’—The natural water soluble cross-linking agent and its importance in the modified drug delivery systems: An overview. Curr. Drug Deliv. 2014, 11, 139–145. [Google Scholar] [CrossRef] [PubMed]
- Oryan, A.; Kamali, A.; Moshiri, A.; Baharvand, H.; Daemi, H. Chemical crosslinking of biopolymeric scaffolds: Current knowledge and future directions of crosslinked engineered bone scaffolds. Int. J. Biol. Macromol. 2018, 107 Pt A, 678–688. [Google Scholar] [CrossRef]
- Levy, A.M.; Fazio, M.A.; Grytz, R. Experimental myopia increases and scleral crosslinking using genipin inhibits cyclic softening in the tree shrew sclera. Ophthalmic Physiol. Opt. 2018, 38, 246–256. [Google Scholar] [CrossRef] [PubMed]
- Výborný, K.; Vallová, J.; Kočí, Z.; Kekulová, K.; Jiráková, K.; Jendelová, P.; Hodan, J.; Kubinová, Š. Genipin and EDC crosslinking of extracellular matrix hydrogel derived from human umbilical cord for neural tissue repair. Sci. Rep. 2019, 9, 10674. [Google Scholar] [CrossRef] [PubMed]
- Muzzarelli, R.A.A. Genipin-crosslinked chitosan hydrogels as biomedical and pharmaceutical aids. Carbohydr. Polym. 2009, 77, 1–9. [Google Scholar] [CrossRef]
- Avila, M.Y.; Narvaez, M.; Castañeda, J.P. Effects of genipin corneal crosslinking in rabbit corneas. J. Cataract Refract. Surg. 2016, 42, 1073–1077. [Google Scholar] [CrossRef] [PubMed]
- Avila, M.Y.; Navia, J.L. Effect of genipin collagen crosslinking on porcine corneas. J. Cataract Refract. Surg. 2010, 36, 659–664. [Google Scholar] [CrossRef]
- Hannon, B.G.; Schwaner, S.A.; Boazak, E.M.; Gerberich, B.G.; Winger, E.J.; Prausnitz, M.R.; Ethier, C.R. Sustained scleral stiffening in rats after a single genipin treatment. J. R. Soc. Interface 2019, 16, 20190427. [Google Scholar] [CrossRef]
- Wong, F.F.; Lari, D.R.; Schultz, D.S.; Stewart, J.M. Whole globe inflation testing of exogenously crosslinked sclera using genipin and methylglyoxal. Exp. Eye Res. 2012, 103, 17–21. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Liu, T.X.; Luo, X.; Gu, Y.W.; Yang, B.; Wang, Z. Correlation of discoloration and biomechanical properties in porcine sclera induced by genipin. Int. J. Ophthalmol. 2014, 7, 621–625. [Google Scholar] [PubMed]
- Wang, Y.; Bao, J.; Wu, X.; Wu, Q.; Li, Y.; Zhou, Y.; Li, L.; Bu, H. Genipin crosslinking reduced the immunogenicity of xenogeneic decellularized porcine whole-liver matrices through regulation of immune cell proliferation and polarization. Sci. Rep. 2016, 6, 24779. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Corpuz, C.C. Effects of scleral cross-linking using genipin on the process of form-deprivation myopia in the guinea pig: A randomized controlled experimental study. BMC Ophthalmol. 2015, 15, 89. [Google Scholar] [CrossRef] [PubMed]
- Nam, K.N.; Choi, Y.S.; Jung, H.J.; Park, G.H.; Park, J.M.; Moon, S.K.; Cho, K.H.; Kang, C.; Kang, I.; Oh, M.S.; et al. Genipin inhibits the inflammatory response of rat brain microglial cells. Int. Immunopharmacol. 2010, 10, 493–499. [Google Scholar] [CrossRef]
- Zhao, H.; Wang, R.; Ye, M.; Zhang, L. Genipin protects against H2O2-induced oxidative damage in retinal pigment epithelial cells by promoting Nrf2 signaling. Int. J. Mol. Med. 2019, 43, 936–944. [Google Scholar] [CrossRef]
- Donovan, C.; Koudouna, E.; Margo, C.E.; Avila, M.Y.; Espana, E.M. Genipin Delays Corneal Stromal Enzymatic Digestion. Transl. Vis. Sci. Technol. 2021, 10, 25. [Google Scholar] [CrossRef]
- Elbasiony, E.; Cho, W.; Mittal, S.K.; Chauhan, S.K. Suppression of lipopolysaccharide-induced corneal opacity by hepatocyte growth factor. Sci. Rep. 2022, 12, 494. [Google Scholar] [CrossRef]
- Said, D.G.; Rallis, K.I.; Al-Aqaba, M.A.; Ting, D.S.J.; Dua, H.S. Surgical management of infectious keratitis. Ocul. Surf. 2021. [Google Scholar] [CrossRef]
- Zang, Y.; Li, S.; Ruan, F.; Liu, Z.; Jie, Y. Tacrolimus dye drop treatment for the management of early post-operative intraocular inflammation after therapeutic keratoplasty for severe infectious keratitis. Exp. Ther. Med. 2020, 20, 3260–3268. [Google Scholar] [CrossRef]
- Urbańska, K.; Woźniak, M.; Więsyk, P.; Konarska, N.; Bartos, W.; Biszewski, M.; Bielak, M.; Chorągiewicz, T.; Rejdak, R. Management and Treatment Outcomes of High-Risk Corneal Transplantations. J. Clin. Med. 2022, 11, 5511. [Google Scholar] [CrossRef] [PubMed]
- Sharma, N.; Kaur, M.; Titiyal, J.S.; Aldave, A. Infectious keratitis after lamellar keratoplasty. Surv. Ophthalmol. 2021, 66, 623–643. [Google Scholar] [CrossRef] [PubMed]
- Ratitong, B.; Marshall, M.E.; Dragan, M.A.; Anunciado, C.M.; Abbondante, S.; Pearlman, E. Differential Roles for IL-1alpha and IL-1beta in Pseudomonas aeruginosa Corneal Infection. J. Immunol. 2022. [Google Scholar] [CrossRef]
- Guo, L.; Wang, Z.; Li, J.; Cui, L.; Dong, J.; Meng, X.; Zhu, G.; Li, J.; Wang, H. MCC950 attenuates inflammation-mediated damage in canines with Staphylococcus pseudintermedius keratitis by inhibiting the NLRP3 inflammasome. Int. Immunopharmacol. 2022, 108, 108857. [Google Scholar] [CrossRef] [PubMed]
- Peng, L.; Zhong, J.; Xiao, Y.; Wang, B.; Li, S.; Deng, Y.; He, D.; Yuan, J. Therapeutic effects of an anti-IL-6 antibody in fungal keratitis: Macrophage inhibition and T cell subset regulation. Int. Immunopharmacol. 2020, 85, 106649. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, G.; Zhang, X.; Lin, L. ROS-scavenging glyco-nanoplatform for synergistic antibacterial and wound-healing therapy of bacterial keratitis. J. Mater. Chem. B 2022, 10, 4575–4587. [Google Scholar] [CrossRef]
- Reinstein Merjava, S.; Kossl, J.; Neuwirth, A.; Skalicka, P.; Hlinomazova, Z.; Holan, V.; Jirsova, K. Presence of Protease Inhibitor 9 and Granzyme B in Healthy and Pathological Human Corneas. Biology 2022, 11, 793. [Google Scholar] [CrossRef]
- Karmakar, M.; Katsnelson, M.; Malak, H.A.; Greene, N.G.; Howell, S.J.; Hise, A.G.; Camilli, A.; Kadioglu, A.; Dubyak, G.R.; Pearlman, E. Neutrophil IL-1beta processing induced by pneumolysin is mediated by the NLRP3/ASC inflammasome and caspase-1 activation and is dependent on K+ efflux. J. Immunol. 2015, 194, 1763–1775. [Google Scholar] [CrossRef]
- Fukuda, K. Corneal fibroblasts: Function and markers. Exp. Eye Res. 2020, 200, 108229. [Google Scholar] [CrossRef]
- Sagerfors, S.; Ejdervik-Lindblad, B.; Soderquist, B. Infectious keratitis: Isolated microbes and their antibiotic susceptibility pattern during 2004-2014 in Region Orebro County, Sweden. Acta Ophthalmol. 2020, 98, 255–260. [Google Scholar] [CrossRef]
- Silhavy, T.J.; Kahne, D.; Walker, S. The bacterial cell envelope. Cold Spring Harb. Perspect Biol. 2010, 2, a000414. [Google Scholar] [CrossRef]
- Guo, L.; Dong, W.; Fu, X.; Lin, J.; Dong, Z.; Tan, X.; Zhang, T. Tripartite Motif 8 (TRIM8) Positively Regulates Pro-inflammatory Responses in Pseudomonas aeruginosa-Induced Keratitis Through Promoting K63-Linked Polyubiquitination of TAK1 Protein. Inflammation 2017, 40, 454–463. [Google Scholar] [CrossRef]
- Palomar, A.P.D.; Montolío, A.; Cegoñino, J.; Dhanda, S.K.; Lio, C.T.; Bose, T. The Innate Immune Cell Profile of the Cornea Predicts the Onset of Ocular Surface Inflammatory Disorders. J. Clin. Med. 2019, 8, 2110. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Rong, R.; Xia, X. Spotlight on pyroptosis: Role in pathogenesis and therapeutic potential of ocular diseases. J. Neuroinflammation 2022, 19, 183. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.Y.; Jiang, W.W.; Liu, Y.L.; Ma, Z.X.; Dai, J.Q. Anti-inflammatory action of geniposide promotes wound healing in diabetic rats. Pharm. Biol. 2022, 60, 294–299. [Google Scholar] [CrossRef]
- Afzal, M.; Vijay, A.K.; Stapleton, F.; Willcox, M. Virulence Genes of Staphylococcus aureus Associated With Keratitis, Conjunctivitis, and Contact Lens-Associated Inflammation. Transl. Vis. Sci. Technol. 2022, 11, 5. [Google Scholar] [CrossRef]
- Hazlett, L.D.; Jiang, X.; McClellan, S.A. IL-10 function, regulation, and in bacterial keratitis. J. Ocul. Pharmacol. Ther. 2014, 30, 373–380. [Google Scholar] [CrossRef]
- Iannotta, M.; Belardo, C.; Trotta, M.C.; Iannotti, F.A.; Vitale, R.M.; Maisto, R.; Boccella, S.; Infantino, R.; Ricciardi, F.; Mirto, B.F.; et al. N-palmitoyl-D-glucosamine, a Natural Monosaccharide-Based Glycolipid, Inhibits TLR4 and Prevents LPS-Induced Inflammation and Neuropathic Pain in Mice. Int. J. Mol. Sci. 2021, 22, 1491. [Google Scholar] [CrossRef]
- Yang, H.; Yue, Y.; Li, Y.; Su, L.; Yan, S. Geniposide attenuates dextran sulfate sodium-induced colitis in mice via Nrf-2/HO-1/NF-kappaB pathway. Ann. Palliat. Med. 2020, 9, 2826–2836. [Google Scholar] [CrossRef] [PubMed]
- Kozera, B.; Rapacz, M. Reference genes in real-time PCR. J. Appl. Genet. 2013, 54, 391–406. [Google Scholar] [CrossRef] [PubMed]
- Kernacki, K.A.; Fridman, R.; Hazlett, L.D.; Lande, M.A.; Berk, R.S. In vivo characterization of host and bacterial protease expression during Pseudomonas aeruginosa corneal infections in naive and immunized mice. Curr. Eye Res. 1997, 16, 289–297. [Google Scholar] [CrossRef] [PubMed]
- Gharaibeh, A.M.; Saez, V.; Garcia, N.; Bataille, L.; Alió, J.L. Optimizing Genipin Concentration for Corneal Collagen Cross-Linking: An ex vivo Study. Ophthalmic Res. 2018, 60, 100–108. [Google Scholar] [CrossRef] [PubMed]
- Altmann, S.; Emanuel, A.; Toomey, M.; McIntyre, K.; Covert, J.; Dubielzig, R.R.; Leatherberry, G.; Murphy, C.J.; Kodihalli, S.; Brandt, C.R. A quantitative rabbit model of vaccinia keratitis. Investig. Ophthalmol. Vis. Sci. 2010, 51, 4531–4540. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucl. Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
Microorganism | SLE Score Post-Inoculation ± SE | ||
---|---|---|---|
6 h | 24 h | 48 h | |
S. aureus + vehicle | 8.05 ± 1.01 | 23.5 ± 1.60 | 20.7 ± 2.16 |
S. aureus + genipin | 9.95 ± 1.40 | 17.1 ± 2.42 * | 15.7 ± 0.85 * |
P. aeruginosa + vehicle | 5.69 ± 0.45 | 18.13 ± 0.92 | 27.25 ± 0.48 |
P. aeruginosa + genipin | 6.0 ± 0.71 | 14.44 ± 0.50 * | 24.88 ± 0.52 * |
A. Corneal Opacity Degree | Absence | 0 |
Visible Iris | 1.5 | |
Iris details indistinguishable | 3 | |
Anterior chamber invisible | 4 | |
B. Corneal Opacity Area | None | 0 |
≤ (not 0) | 0.5 | |
>1/4 to <1/2 | 1 | |
>1/2 to <3/4 | 1.5 | |
>3/4 | 2 | |
C. Corneal Ulceration | Normal curvature | 0 |
Protrusion or depression | 1.5 | |
Perforation | 3 | |
D. Area of the initial injury | Same or lower | 1.5 |
Higher | 3 | |
E. Redness of nictitating membrane | Normal | 0 |
Slightly vascular dilation and edema | 1 | |
Remarkable vascular dilation and redness of the entire membrane | 2–4 | |
F. Discharge | No discharge | 0 |
Any quantity | 1 | |
Wet eyelids and eyelashes | 2 | |
G. Hypopyon | Not observed | 0 |
<1/4 of the corneal radius | 1 | |
>1/4 to <1/2 | 2 | |
>1/2 | 3 | |
I. Chemosis or inflammation | Not observed | 0 |
Clearly with eyelid disturbance | 1 | |
Partially closed eyelids | 2 | |
Closed eyelids | 3 |
Gene | Forward 5′-3′ | Reverse 5′-3′ |
---|---|---|
IL-1RA | GAAGTTGTGCCTGTCTTGTGTG | CCTCCTGGAAGTAGAACTTGGT |
IL-1b | TGTTGTCTGGCACGTATGAGCTG | CTTCTTCTTTGGGTAACGGTTGGG |
IL-6 | CTGAAGAACATCCAACACCTGATC | CCTAACGCTCATCTTCCTAGTTTC |
IL-8 | ACACTCCACACCTTTCCATCC | CCTACGACAGATCCATGCAGT |
IL-10 | CCCGATCCTATTTATTTACCGAGC | GTTAGAAAGTGTGGTCAGGCACAG |
IL-15 | CTGTATCAGTGCAGGTCTTCC | CCTCCAGTTCCTCACATTCTTTGC |
TNF-a | CTCCCAGGTTCTCTTCAGCGGTC | GTCCAGGTACTCAGGCTGGTTGA |
IFN-ϒ | GCCAGGACACACTAACCAGAG | CCTCGAAACAGCGTCTGACT |
TRAIL | CTGATCCTGATCTTCACAGTGCTCC | CTACTCTCTGAGGCCCTCTTTCTC |
MMP9 | TGGGCTTGGATCACTCCTCTG | CAGCTTGTTCCCTATCTCGGC |
MMP13 | CCAGATTTATCCTGATGGGCGTAC | CACTTGGGAATAGGCTTCCGC |
MMP-2 | TGGACCAGAGCACCATCGAG | GTGGAGCACCAGAGGAAGCC |
GAPDH | GCGTGAACCACGAGAAGTATGACAAC | CAGTGGAGGCAGGGATGATGTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huertas-Bello, M.; Cuéllar-Sáenz, J.A.; Rodriguez, C.N.; Cortés-Vecino, J.A.; Navarrete, M.L.; Avila, M.Y.; Koudouna, E. A Pilot Study to Evaluate Genipin in Staphylococcus aureus and Pseudomonas aeruginosa Keratitis Models: Modulation of Pro-Inflammatory Cytokines and Matrix Metalloproteinases. Int. J. Mol. Sci. 2023, 24, 6904. https://doi.org/10.3390/ijms24086904
Huertas-Bello M, Cuéllar-Sáenz JA, Rodriguez CN, Cortés-Vecino JA, Navarrete ML, Avila MY, Koudouna E. A Pilot Study to Evaluate Genipin in Staphylococcus aureus and Pseudomonas aeruginosa Keratitis Models: Modulation of Pro-Inflammatory Cytokines and Matrix Metalloproteinases. International Journal of Molecular Sciences. 2023; 24(8):6904. https://doi.org/10.3390/ijms24086904
Chicago/Turabian StyleHuertas-Bello, Marcela, Jerson Andrés Cuéllar-Sáenz, Cristian Nicolas Rodriguez, Jesús Alfredo Cortés-Vecino, Myriam Lucia Navarrete, Marcel Yecid Avila, and Elena Koudouna. 2023. "A Pilot Study to Evaluate Genipin in Staphylococcus aureus and Pseudomonas aeruginosa Keratitis Models: Modulation of Pro-Inflammatory Cytokines and Matrix Metalloproteinases" International Journal of Molecular Sciences 24, no. 8: 6904. https://doi.org/10.3390/ijms24086904
APA StyleHuertas-Bello, M., Cuéllar-Sáenz, J. A., Rodriguez, C. N., Cortés-Vecino, J. A., Navarrete, M. L., Avila, M. Y., & Koudouna, E. (2023). A Pilot Study to Evaluate Genipin in Staphylococcus aureus and Pseudomonas aeruginosa Keratitis Models: Modulation of Pro-Inflammatory Cytokines and Matrix Metalloproteinases. International Journal of Molecular Sciences, 24(8), 6904. https://doi.org/10.3390/ijms24086904