Dual Role of Mitogen-Activated Protein Kinase 8 Interacting Protein-1 in Inflammasome and Pancreatic β-Cell Function
Abstract
1. Introduction
2. Results
2.1. Expression Profiles of Pro-Inflammatory and Inflammasome-Related Genes (IRGs) in Human Pancreatic Islets
2.2. Mapk8ip1 Silencing Influences IRGs in INS-1 (832/13) Cells
2.3. Inflammasome Activation Reduces Cell Viability and Alters the Expression of Pancreatic Β-Cell Function Genes
2.4. Expression Silencing of Mapk8ip1 Impairs β-Cell Inflammasome Activation in Stressed INS-1 Cells
2.5. Expression Silencing of Mapk8ip1 Influences β-Cell Physiology
2.6. Mapk8ip1 Silencing Reduces GSDMD Expression in INS-1 Cells
3. Discussion
4. Materials and Methods
4.1. RNA-Seq Expression Data from Human Pancreatic Islets
4.2. Culturing of INS-1 Cell Line and Palmitic Acid Treatment
4.3. siRNA Transfection
4.4. RNA Extraction and qRT-PCR
4.5. Insulin Secretion Assay
4.6. Western Blot Analysis
4.7. Apoptosis Assay
4.8. Cell Viability Assay
4.9. Glucose Uptake
4.10. ROS generation
4.11. Immunofluorescence Assay
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gonzalez, L.L.; Garrie, K.; Turner, M.D. Type 2 diabetes—An autoinflammatory disease driven by metabolic stress. Biochim. Biophys. Acta Mol. Basis Dis. 2018, 1864, 3805–3823. [Google Scholar] [CrossRef]
- Hameed, I.; Masoodi, S.R.; Mir, S.A.; Nabi, M.; Ghazanfar, K.; Ganai, B.A. Type 2 diabetes mellitus: From a metabolic disorder to an inflammatory condition. World J. Diabetes 2015, 6, 598–612. [Google Scholar] [CrossRef]
- Hotamisligil, G.S. Inflammation, metaflammation and immunometabolic disorders. Nature 2017, 542, 177–185. [Google Scholar] [CrossRef]
- Chawla, A.; Nguyen, K.D.; Goh, Y.P.S. Macrophage-mediated inflammation in metabolic disease. Nat. Rev. Immunol. 2011, 11, 738–749. [Google Scholar] [CrossRef]
- Pirzada, R.H.; Javaid, N.; Choi, S. The Roles of the NLRP3 Inflammasome in Neurodegenerative and Metabolic Diseases and in Relevant Advanced Therapeutic Interventions. Genes 2020, 11, 131. [Google Scholar] [CrossRef]
- Jorgensen, I.; Miao, E.A. Pyroptotic cell death defends against intracellular pathogens. Immunol. Rev. 2015, 265, 130–142. [Google Scholar] [CrossRef]
- Lamkanfi, M.; Dixit, V.M. Mechanisms and functions of inflammasomes. Cell 2014, 157, 1013–1022. [Google Scholar] [CrossRef]
- Wen, H.; Gris, D.; Lei, Y.; Jha, S.; Zhang, L.; Huang, M.T.; Brickey, W.J.; Ting, J.P. Fatty acid-induced NLRP3-ASC inflammasome activation interferes with insulin signaling. Nat. Immunol. 2011, 12, 408–415. [Google Scholar] [CrossRef]
- Sepehri, Z.; Kiani, Z.; Afshari, M.; Kohan, F.; Dalvand, A.; Ghavami, S. Inflammasomes and type 2 diabetes: An updated systematic review. Immunol. Lett. 2017, 192, 97–103. [Google Scholar] [CrossRef]
- Sokolova, M.; Sahraoui, A.; Høyem, M.; Øgaard, J.; Lien, E.; Aukrust, P.; Yndestad, A.; Ranheim, T.; Scholz, H. NLRP3 inflammasome mediates oxidative stress-induced pancreatic islet dysfunction. Am. J. Physiol. Endocrinol. Metab. 2018, 315, E912–E923. [Google Scholar] [CrossRef]
- Ding, S.; Xu, S.; Ma, Y.; Liu, G.; Jang, H.; Fang, J. Modulatory Mechanisms of the NLRP3 Inflammasomes in Diabetes. Biomolecules 2019, 9, 850. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Shen, X.; Liu, J.; Chen, W.; Wu, F.; Wu, W.; Meng, Z.; Zhu, M.; Miao, C. High glucose mediates NLRP3 inflammasome activation via upregulation of ELF3 expression. Cell Death Dis. 2020, 11, 383. [Google Scholar] [CrossRef]
- Luo, B.; Li, B.; Wang, W.; Liu, X.; Xia, Y.; Zhang, C.; Zhang, M.; Zhang, Y.; An, F. NLRP3 gene silencing ameliorates diabetic cardiomyopathy in a type 2 diabetes rat model. PLoS ONE 2014, 9, e104771. [Google Scholar] [CrossRef]
- Vandanmagsar, B.; Youm, Y.H.; Ravussin, A.; Galgani, J.E.; Stadler, K.; Mynatt, R.L.; Ravussin, E.; Stephens, J.M.; Dixit, V.D. The NLRP3 inflammasome instigates obesity-induced inflammation and insulin resistance. Nat. Med. 2011, 17, 179–188. [Google Scholar] [CrossRef]
- Stienstra, R.; van Diepen, J.A.; Tack, C.J.; Zaki, M.H.; van de Veerdonk, F.L.; Perera, D.; Neale, G.A.; Hooiveld, G.J.; Hijmans, A.; Vroegrijk, I.; et al. Inflammasome is a central player in the induction of obesity and insulin resistance. Proc. Natl. Acad. Sci. USA 2011, 108, 15324–15329. [Google Scholar] [CrossRef]
- Maedler, K.; Sergeev, P.; Ris, F.; Oberholzer, J.; Joller-Jemelka, H.I.; Spinas, G.A.; Kaiser, N.; Halban, P.A.; Donath, M.Y. Glucose-induced beta cell production of IL-1beta contributes to glucotoxicity in human pancreatic islets. J. Clin. Investig. 2002, 110, 851–860. [Google Scholar] [CrossRef]
- Alfadul, H.; Sabico, S.; Al-Daghri, N.M. The role of interleukin-1β in type 2 diabetes mellitus: A systematic review and meta-analysis. Front. Endocrinol. 2022, 13, 1694. [Google Scholar] [CrossRef] [PubMed]
- Youm, Y.H.; Adijiang, A.; Vandanmagsar, B.; Burk, D.; Ravussin, A.; Dixit, V.D. Elimination of the NLRP3-ASC inflammasome protects against chronic obesity-induced pancreatic damage. Endocrinology 2011, 152, 4039–4045. [Google Scholar] [CrossRef]
- Lee, H.M.; Kim, J.J.; Kim, H.J.; Shong, M.; Ku, B.J.; Jo, E.K. Upregulated NLRP3 inflammasome activation in patients with type 2 diabetes. Diabetes 2013, 62, 194–204. [Google Scholar] [CrossRef]
- Mamun, A.A.; Wu, Y.; Nasrin, F.; Akter, A.; Taniya, M.A.; Munir, F.; Jia, C.; Xiao, J. Role of Pyroptosis in Diabetes and Its Therapeutic Implications. J. Inflamm. Res. 2021, 14, 2187–2206. [Google Scholar] [CrossRef]
- Larsen, C.M.; Faulenbach, M.; Vaag, A.; Vølund, A.; Ehses, J.A.; Seifert, B.; Mandrup-Poulsen, T.; Donath, M.Y. Interleukin-1-receptor antagonist in type 2 diabetes mellitus. N. Engl. J. Med. 2007, 356, 1517–1526. [Google Scholar] [CrossRef] [PubMed]
- Hong, P.; Gu, R.N.; Li, F.X.; Xiong, X.X.; Liang, W.B.; You, Z.J.; Zhang, H.F. NLRP3 inflammasome as a potential treatment in ischemic stroke concomitant with diabetes. J. Neuroinflamm. 2019, 16, 121. [Google Scholar] [CrossRef]
- Bai, Y.; Mu, Q.; Bao, X.; Zuo, J.; Fang, X.; Hua, J.; Zhang, D.; Jiang, G.; Li, P.; Gao, S.; et al. Targeting NLRP3 Inflammasome in the Treatment Of Diabetes and Diabetic Complications: Role of Natural Compounds from Herbal Medicine. Aging Dis. 2021, 12, 1587–1604. [Google Scholar] [CrossRef]
- Lebreton, F.; Berishvili, E.; Parnaud, G.; Rouget, C.; Bosco, D.; Berney, T.; Lavallard, V. NLRP3 inflammasome is expressed and regulated in human islets. Cell Death Dis. 2018, 9, 726. [Google Scholar] [CrossRef]
- Pellet, J.B.; Haefliger, J.A.; Staple, J.K.; Widmann, C.; Welker, E.; Hirling, H.; Bonny, C.; Nicod, P.; Catsicas, S.; Waeber, G.; et al. Spatial, temporal and subcellular localization of islet-brain 1 (IB1), a homologue of JIP-1, in mouse brain. Eur. J. Neurosci. 2000, 12, 621–632. [Google Scholar] [CrossRef] [PubMed]
- Bonny, C.; Nicod, P.; Waeber, G. IB1, a JIP-1-related nuclear protein present in insulin-secreting cells. J. Biol. Chem. 1998, 273, 1843–1846. [Google Scholar] [CrossRef]
- Waeber, G.; Delplanque, J.; Bonny, C.; Mooser, V.; Steinmann, M.; Widmann, C.; Maillard, A.; Miklossy, J.; Dina, C.; Hani, E.H.; et al. The gene MAPK8IP1, encoding islet-brain-1, is a candidate for type 2 diabetes. Nat. Genet. 2000, 24, 291–295. [Google Scholar] [CrossRef] [PubMed]
- Whitmarsh, A.J.; Kuan, C.Y.; Kennedy, N.J.; Kelkar, N.; Haydar, T.F.; Mordes, J.P.; Appel, M.; Rossini, A.A.; Jones, S.N.; Flavell, R.A.; et al. Requirement of the JIP1 scaffold protein for stress-induced JNK activation. Genes Dev. 2001, 15, 2421–2432. [Google Scholar] [CrossRef]
- Standen, C.L.; Kennedy, N.J.; Flavell, R.A.; Davis, R.J. Signal transduction cross talk mediated by Jun N-terminal kinase-interacting protein and insulin receptor substrate scaffold protein complexes. Mol. Cell Biol. 2009, 29, 4831–4840. [Google Scholar] [CrossRef]
- Saeed, R.; Mohammed, A.K.; Saleh, S.E.; Aboshanab, K.M.; Aboulwafa, M.M.; Taneera, J. Expression silencing of Mitogen-Activated Protein Kinase 8 Interacting Protein-1 conferred its role in pancreatic β-cell physiology and Insulin Secretion. Metabolites 2023, 13, 307. [Google Scholar]
- Whitmarsh, A.J.; Cavanagh, J.; Tournier, C.; Yasuda, J.; Davis, R.J. A mammalian scaffold complex that selectively mediates MAP kinase activation. Science 1998, 281, 1671–1674. [Google Scholar] [CrossRef]
- Song, N.; Liu, Z.S.; Xue, W.; Bai, Z.F.; Wang, Q.Y.; Dai, J.; Liu, X.; Huang, Y.J.; Cai, H.; Zhan, X.Y.; et al. NLRP3 Phosphorylation Is an Essential Priming Event for Inflammasome Activation. Mol. Cell 2017, 68, 185–197e6. [Google Scholar] [CrossRef]
- Ghiasi, S.M.; Dahllöf, M.S.; Osmai, Y.; Osmai, M.; Jakobsen, K.K.; Aivazidis, A.; Tyrberg, B.; Perruzza, L.; Prause, M.C.B.; Christensen, D.P.; et al. Regulation of the β-cell inflammasome and contribution to stress-induced cellular dysfunction and apoptosis. Mol. Cell Endocrinol. 2018, 478, 106–114. [Google Scholar] [CrossRef]
- Kelley, N.; Jeltema, D.; Duan, Y.; He, Y. The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int. J. Mol. Sci. 2019, 20, 3328. [Google Scholar] [CrossRef] [PubMed]
- Bauernfeind, F.G.; Horvath, G.; Stutz, A.; Alnemri, E.S.; MacDonald, K.; Speert, D.; Fernandes-Alnemri, T.; Wu, J.; Monks, B.G.; Fitzgerald, K.A.; et al. Cutting Edge: NF-κB Activating Pattern Recognition and Cytokine Receptors License NLRP3 Inflammasome Activation by Regulating NLRP3 Expression1. J. Immunol. 2009, 183, 787–791. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, C.A. Interleukin-1 in the pathogenesis and treatment of inflammatory diseases. Blood 2011, 117, 3720–3732. [Google Scholar] [CrossRef] [PubMed]
- Kant, S.; Standen, C.L.; Morel, C.; Jung, D.Y.; Kim, J.K.; Swat, W.; Flavell, R.A.; Davis, R.J. A Protein Scaffold Coordinates SRC-Mediated JNK Activation in Response to Metabolic Stress. Cell Rep. 2017, 20, 2775–2783. [Google Scholar] [CrossRef]
- Jenster, L.-M.; Lange, K.-E.; Normann, S.; vom Hemdt, A.; Wuerth, J.D.; Schiffelers, L.D.J.; Tesfamariam, Y.M.; Gohr, F.N.; Klein, L.; Kaltheuner, I.H.; et al. P38 kinases mediate NLRP1 inflammasome activation after ribotoxic stress response and virus infection. J. Exp. Med. 2022, 220, e20220837. [Google Scholar] [CrossRef]
- Place, D.E.; Samir, P.; Karki, R.; Briard, B.; Vogel, P.; Kanneganti, T.D. ASK Family Kinases Are Required for Optimal NLRP3 Inflammasome Priming. Am. J. Pathol. 2018, 188, 1021–1030. [Google Scholar] [CrossRef] [PubMed]
- Prause, M.; Christensen, D.P.; Billestrup, N.; Mandrup-Poulsen, T. JNK1 protects against glucolipotoxicity-mediated beta-cell apoptosis. PLoS ONE 2014, 9, e87067. [Google Scholar] [CrossRef]
- Ralston, J.C.; Lyons, C.L.; Kennedy, E.B.; Kirwan, A.M.; Roche, H.M. Fatty Acids and NLRP3 Inflammasome-Mediated Inflammation in Metabolic Tissues. Annu. Rev. Nutr. 2017, 37, 77–102. [Google Scholar] [CrossRef]
- Nemecz, M.; Constantin, A.; Dumitrescu, M.; Alexandru, N.; Filippi, A.; Tanko, G.; Georgescu, A. The Distinct Effects of Palmitic and Oleic Acid on Pancreatic Beta Cell Function: The Elucidation of Associated Mechanisms and Effector Molecules. Front. Pharmacol. 2019, 9, 1554. [Google Scholar] [CrossRef]
- Shi, H.; Kokoeva, M.V.; Inouye, K.; Tzameli, I.; Yin, H.; Flier, J.S. TLR4 links innate immunity and fatty acid-induced insulin resistance. J. Clin. Investig. 2006, 116, 3015–3025. [Google Scholar] [CrossRef]
- Legrand-Poels, S.; Esser, N.; L’homme, L.; Scheen, A.; Paquot, N.; Piette, J. Free fatty acids as modulators of the NLRP3 inflammasome in obesity/type 2 diabetes. Biochem. Pharmacol. 2014, 92, 131–141. [Google Scholar] [CrossRef]
- Zhou, R.; Yazdi, A.S.; Menu, P.; Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation. Nature 2011, 469, 221–225. [Google Scholar] [CrossRef]
- Zhou, R.; Tardivel, A.; Thorens, B.; Choi, I.; Tschopp, J. Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nat. Immunol. 2010, 11, 136–140. [Google Scholar] [CrossRef]
- Volpe, C.M.O.; Villar-Delfino, P.H.; Dos Anjos, P.M.F.; Nogueira-Machado, J.A. Cellular death, reactive oxygen species (ROS) and diabetic complications. Cell Death Dis. 2018, 9, 119. [Google Scholar] [CrossRef]
- Eguchi, N.; Vaziri, N.D.; Dafoe, D.C.; Ichii, H. The Role of Oxidative Stress in Pancreatic β Cell Dysfunction in Diabetes. Int. J. Mol. Sci. 2021, 22, 1509. [Google Scholar] [CrossRef] [PubMed]
- Sergi, D.; Naumovski, N.; Heilbronn, L.K.; Abeywardena, M.; O’Callaghan, N.; Lionetti, L.; Luscombe-Marsh, N. Mitochondrial (Dys)function and Insulin Resistance: From Pathophysiological Molecular Mechanisms to the Impact of Diet. Front. Physiol. 2019, 10, 532. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Frigerio, F.; Maechler, P. The sensitivity of pancreatic beta-cells to mitochondrial injuries triggered by lipotoxicity and oxidative stress. Biochem. Soc. Trans. 2008, 36, 930–934. [Google Scholar] [CrossRef] [PubMed]
- Gerber, P.A.; Rutter, G.A. The Role of Oxidative Stress and Hypoxia in Pancreatic Beta-Cell Dysfunction in Diabetes Mellitus. Antioxid. Redox Signal. 2017, 26, 501–518. [Google Scholar] [CrossRef] [PubMed]
- Pellegrini, C.; Antonioli, L.; Lopez-Castejon, G.; Blandizzi, C.; Fornai, M. Canonical and Non-Canonical Activation of NLRP3 Inflammasome at the Crossroad between Immune Tolerance and Intestinal Inflammation. Front. Immunol. 2017, 8, 36. [Google Scholar] [CrossRef]
- Fadista, J.; Vikman, P.; Laakso, E.O.; Mollet, I.G.; Esguerra, J.L.; Taneera, J.; Storm, P.; Osmark, P.; Ladenvall, C.; Prasad, R.B.; et al. Global genomic and transcriptomic analysis of human pancreatic islets reveals novel genes influencing glucose metabolism. Proc. Natl. Acad. Sci. USA 2014, 111, 13924–13929. [Google Scholar] [CrossRef]
- Hohmeier, H.E.; Mulder, H.; Chen, G.; Henkel-Rieger, R.; Prentki, M.; Newgard, C.B. Isolation of INS-1-derived cell lines with robust ATP-sensitive K+ channel-dependent and -independent glucose-stimulated insulin secretion. Diabetes 2000, 49, 424–430. [Google Scholar] [CrossRef] [PubMed]
- Taneera, J.; Prasad, R.B.; Dhaiban, S.; Mohammed, A.K.; Haataja, L.; Arvan, P.; Hamad, M.; Groop, L.; Wollheim, C.B. Silencing of the FTO gene inhibits insulin secretion: An in vitro study using GRINCH cells. Mol. Cell. Endocrinol. 2018, 472, 10–17. [Google Scholar] [CrossRef]
- Joshi-Barve, S.; Barve, S.S.; Amancherla, K.; Gobejishvili, L.; Hill, D.; Cave, M.; Hote, P.; McClain, C.J. Palmitic acid induces production of proinflammatory cytokine interleukin-8 from hepatocytes. Hepatology 2007, 46, 823–830. [Google Scholar] [CrossRef] [PubMed]
- Dong, Z.; Zhuang, Q.; Ning, M.; Wu, S.; Lu, L.; Wan, X. Palmitic acid stimulates NLRP3 inflammasome activation through TLR4-NF-κB signal pathway in hepatic stellate cells. Ann. Transl. Med. 2020, 8, 168. [Google Scholar] [CrossRef] [PubMed]
- El-Huneidi, W.; Anjum, S.; Mohammed, A.K.; Unnikannan, H.; Saeed, R.; Bajbouj, K.; Abu-Gharbieh, E.; Taneera, J. Copine 3 “CPNE3” is a novel regulator for insulin secretion and glucose uptake in pancreatic β-cells. Sci. Rep. 2021, 11, 20692. [Google Scholar] [CrossRef]
- Gurung, P.; Li, B.; Subbarao Malireddi, R.K.; Lamkanfi, M.; Geiger, T.L.; Kanneganti, T.-D. Chronic TLR Stimulation Controls NLRP3 Inflammasome Activation through IL-10 Mediated Regulation of NLRP3 Expression and Caspase-8 Activation. Sci. Rep. 2015, 5, 14488. [Google Scholar] [CrossRef]







| No. | Gene/Symbol | Forward Primers (5′-3′) | Reverse Primers (5′-3′) |
|---|---|---|---|
| 1 | Nlrp3 | GCCTCATCCGAAAGAAGTTGC | TGGCCTCAGAGAAACCTAGGA |
| 2 | Casp-1 | GTGGTTCCCTCAAGTTTTGC | GTGCTGCAGATAATGAGGGCA |
| 3 | Il-1β | CAGCAATGGTCGGGACATAG0 | AGACTGCCCATTCTCGACAAG |
| 4 | IL-18 | ATTCTTTCAGAAACGTGTGCCAG | ATCCCCATTTTCATCCTTCC |
| 5 | Gsdmd | CGGGAGTGGTCAAGAATGTG | CATGAGCTTGAGAGTTTCCTGC |
| 6 | Nlrp1 | GCCCTCTGCCTGAAATACCTT | CAGGGTCCTTCTTTGGCAGAT |
| 7 | Nlrc4 | ACTCCATCAGCAAACCAACC | CCTCGATTTCTGGGCAGTTCT |
| 8 | NF-κβ1 | CCACACTGTAAACCAAAGCCC | GGAAGGCCTCGAATGACATCA |
| 9 | Aim2 | TCACCAGTTCCTCAGTTGTGG | GCACGGCAGAGTTTTCAGTTT |
| 10 | Asc | AAGGACAGTACCAGGCAGTTC | CCAAGTAGGGCTGTGTTTGC |
| 11 | Il-6 | GCCTATTGAAAATCTGCTCTGG | ATTGCTCTGAATGACTCTGG |
| 12 | Hprt | TTGTGTCATCAGCGAAAGTGG | CACAGGACTAGAACGTCTGCT |
| 13 | Mafa | GAGGAGGAGCGCAAGATCGG | AGCAAAAGTTTCGTGCTGTCAA |
| 14 | NeuroD1 | CCCTAACTGATTGCACCAGC | TGCAGGGTAGTGCATGGTAA |
| 15 | Syt5 | CACCTGACCCCAGATCCTTT | GAGTGGTACTGGAAGTCGGA |
| 16 | Snap25 | GGCGTTTGCTGAATGACAAC | CAGAGCCTGACACCCTAAGA |
| 17 | Cacna1a | CTAGCCCTGCCAAGATCGG | ACGATAAGGCTGTTCTCGG |
| 18 | Cacnb1 | CTTTACCCCAGCAACCACCC | GTCCACACACGAGTCTCCTG |
| 19 | Vamp2 | TGGTGGACATCATGAGGGTG | GCTTGGCTGCACTTGTTTCA |
| 20 | Jnk | TCCAGTTCTCGTACCCGCTA | AGCATGGCGTGACACAGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saeed, R.; Mohammed, A.K.; Saleh, S.E.; Aboulwafa, M.M.; Aboshanab, K.M.; Taneera, J. Dual Role of Mitogen-Activated Protein Kinase 8 Interacting Protein-1 in Inflammasome and Pancreatic β-Cell Function. Int. J. Mol. Sci. 2023, 24, 4990. https://doi.org/10.3390/ijms24054990
Saeed R, Mohammed AK, Saleh SE, Aboulwafa MM, Aboshanab KM, Taneera J. Dual Role of Mitogen-Activated Protein Kinase 8 Interacting Protein-1 in Inflammasome and Pancreatic β-Cell Function. International Journal of Molecular Sciences. 2023; 24(5):4990. https://doi.org/10.3390/ijms24054990
Chicago/Turabian StyleSaeed, Rania, Abdul Khader Mohammed, Sarra E. Saleh, Mohammad M. Aboulwafa, Khaled M. Aboshanab, and Jalal Taneera. 2023. "Dual Role of Mitogen-Activated Protein Kinase 8 Interacting Protein-1 in Inflammasome and Pancreatic β-Cell Function" International Journal of Molecular Sciences 24, no. 5: 4990. https://doi.org/10.3390/ijms24054990
APA StyleSaeed, R., Mohammed, A. K., Saleh, S. E., Aboulwafa, M. M., Aboshanab, K. M., & Taneera, J. (2023). Dual Role of Mitogen-Activated Protein Kinase 8 Interacting Protein-1 in Inflammasome and Pancreatic β-Cell Function. International Journal of Molecular Sciences, 24(5), 4990. https://doi.org/10.3390/ijms24054990

