GPR41 Regulates the Proliferation of BRECs via the PIK3-AKT-mTOR Pathway
Abstract
1. Introduction
2. Results
2.1. Proliferative Activity Analysis
2.2. Transcriptome Analysis
2.3. Differences in Genes Expression
2.4. Differences in Proteins Expression
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Proliferation
4.3. RNA-Seq and Data Analysis
4.4. qRT-PCR
4.5. Western Blot
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Baldwin, R.L., VI; McLeod, K.R.; Klotz, J.L.; Heitmann, R.N. Rumen development, intestinal growth and hepatic metabolism in the pre- and postweaning ruminant. J. Dairy Sci. 2004, 87, E55–E65. [Google Scholar] [CrossRef]
- O’Hara, E.; Neves, A.L.A.; Song, Y.; Guan, L.L. The Role of the Gut Microbiome in Cattle Production and Health: Driver or Passenger? Annu. Rev. Anim. Biosci. 2020, 8, 199–220. [Google Scholar] [CrossRef] [PubMed]
- Kertz, A.F.; Hill, T.M.; Quigley, J.D., 3rd; Heinrichs, A.J.; Linn, J.G.; Drackley, J.K. A 100-Year Review: Calf nutrition and management. J. Dairy Sci. 2017, 100, 10151–10172. [Google Scholar] [CrossRef] [PubMed]
- Lane, M.A.; Baldwin, R.L., VI; Jesse, B.W. Sheep rumen metabolic development in response to age and dietary treatments. J. Anim. Sci. 2000, 78, 1990–1996. [Google Scholar] [CrossRef] [PubMed]
- Diao, Q.; Zhang, R.; Fu, T. Review of Strategies to Promote Rumen Development in Calves. Animals 2019, 9, 490. [Google Scholar] [CrossRef]
- Liu, L.; Sun, D.; Mao, S.; Zhu, W.; Liu, J. Infusion of sodium butyrate promotes rumen papillae growth and enhances expression of genes related to rumen epithelial VFA uptake and metabolism in neonatal twin lambs. J. Anim. Sci. 2018, 97, 909–921. [Google Scholar] [CrossRef]
- Hijazi, N.; Rockey, D.C.; Shi, Z. The cellular microenvironment and cytoskeletal actin dynamics in liver fibrogenesis. Biocell 2022, 46, 2003–2007. [Google Scholar] [CrossRef]
- Cosín-Roger, J.; Ortiz-Masia, D.; Barrachina, M.D.; Calatayud, S. Metabolite Sensing GPCRs: Promising Therapeutic Targets for Cancer Treatment? Cells 2020, 9, 2345. [Google Scholar] [CrossRef]
- Wang, A.; Gu, Z.; Heid, B.; Akers, R.; Jiang, H. Identification and characterization of the bovine G protein-coupled receptor GPR41 and GPR43 genes. J. Dairy Sci. 2009, 92, 2696–2705. [Google Scholar] [CrossRef]
- Wu, J.; Zhou, Z.; Hu, Y.; Dong, S. Butyrate-induced GPR41 Activation Inhibits Histone Acetylation and Cell Growth. J. Genet. Genom. 2012, 39, 375–384. [Google Scholar] [CrossRef]
- Wei, S.; Han, C.; He, F.; Song, Q.; Kang, B.; Liu, H.; Li, L.; Xu, H.; Zeng, X. Inhibition of PI3K-Akt-mTOR signal pathway dismissed the stimulation of glucose on goose liver cell growth. J. Anim. Physiol Anim. Nutr 2017, 101, e133–e143. [Google Scholar] [CrossRef] [PubMed]
- Feng, F.B.; Qiu, H.Y. Effects of Artesunate on chondrocyte proliferation, apoptosis and autophagy through the PI3K/AKT/mTOR signaling pathway in rat models with rheumatoid arthritis. Biomed. Pharmacother. 2018, 10, 21209–21220. [Google Scholar] [CrossRef] [PubMed]
- Han, C.; Wei, S.; Song, Q.; He, F.; Xiong, X.; Wan, H.; Liu, D.; Ye, F.; Liu, H.; Li, L.; et al. Insulin Stimulates Goose Liver Cell Growth by Activating PI3K-AKT-mTOR Signal Pathway. Cell Physiol. Biochem. 2016, 38, 558–570. [Google Scholar] [CrossRef] [PubMed]
- Aschenbach, J.R.; Zebeli, Q.; Patra, A.K.; Greco, G.; Amasheh, S.; Penner, G.B. Symposium review: The importance of the ruminal epithelial barrier for a healthy and productive cow. J. Dairy Sci. 2019, 102, 1866–1882. [Google Scholar] [CrossRef]
- Sun, X.; Yang, Q.; Rogers, C.J.; Du, M.; Zhu, M.-J. AMPK improves gut epithelial differentiation and barrier function via regulating Cdx2 expression. Cell Death Differ. 2017, 24, 819–831. [Google Scholar] [CrossRef]
- Zhan, K.; Gong, X.; Chen, Y.; Jiang, M.; Yang, T.; Zhao, G. Short-Chain Fatty Acids Regulate the Immune Responses via G Protein-Coupled Receptor 41 in Bovine Rumen Epithelial Cells. Front. Immunol. 2019, 10, 2042. [Google Scholar] [CrossRef]
- Yang, T.; Zhan, K.; Ning, L.L.; Jiang, M.; Zhao, G. Short-chain fatty acids inhibit bovine rumen epithelial cells proliferation via upregulation of cyclin-dependent kinase inhibitors 1A, but not mediated by G protein-coupled receptor 41. J. Anim. Physiol. Anim. Nutr. 2020, 104, 409–417. [Google Scholar] [CrossRef]
- Stark, R.; Grzelak, M.; Hadfield, J. RNA sequencing: The teenage years. Nat. Rev. Genet. 2019, 20, 631–656. [Google Scholar] [CrossRef]
- Brazil, D.P.; Yang, Z.Z.; Hemmings, B.A. Advances in protein kinase B signalling-AKTion on multiple fronts. Trends Biochem. Sci. 2004, 29, 233–242. [Google Scholar] [CrossRef]
- Manning, B.D.; Cantley, L.C. AKT/PKB Signaling: Navigating Downstream. Cell 2007, 129, 1261–1274. [Google Scholar] [CrossRef]
- Wang, J.; Huang, Y.; Xu, J.; Yue, B.; Wen, Y.; Wang, X.; Lei, C.; Chen, H. Pleomorphic adenoma gene 1 (PLAG1) promotes proliferation and inhibits apoptosis of bovine primary myoblasts through the PI3K-Akt signaling pathway. J. Anim. Sci. 2022, 100, skac098. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Yang, S.; Kang, Z.; Ru, W.; Shen, X.; Li, M.; Lan, X.; Chen, H. circMEF2D Negatively Regulated by HNRNPA1 Inhibits Proliferation and Differentiation of Myoblasts via miR-486-PI3K/AKT Axis. J. Agric. Food Chem. 2022, 70, 8145–8163. [Google Scholar] [CrossRef] [PubMed]
- Staal, S.P. Molecular cloning of the akt oncogene and its human homologues AKT1 and AKT2: Amplification of AKT1 in a primary human gastric adenocarcinoma. Proc. Natl. Acad. Sci. USA 1987, 84, 5034–5037. [Google Scholar] [CrossRef] [PubMed]
- Hanrahan, A.J.; Schultz, N.; Westfal, M.L.; Sakr, R.A.; Giri, D.D.; Scarperi, S.; Janikariman, M.; Olvera, N.; Stevens, E.V.; She, Q.-B.; et al. Genomic Complexity and AKT Dependence in Serous Ovarian Cancer. Cancer Discov. 2012, 2, 56–67. [Google Scholar] [CrossRef] [PubMed]
- Vanhaesebroeck, B.; Guillermet-Guibert, J.; Graupera, M.; Bilanges, B. The emerging mechanisms of isoform-specific PI3K signalling. Nat. Rev. Mol. Cell Biol. 2010, 11, 329–341. [Google Scholar] [CrossRef]
- Liu, P.; Cheng, H.; Roberts, T.M.; Zhao, J.J. Targeting the phosphoinositide 3-kinase pathway in cancer. Nat. Rev. Drug Discov. 2009, 8, 627–644. [Google Scholar] [CrossRef]
- Song, C.; Yang, Z.; Dong, D.; Xu, J.; Chen, H. miR-483 inhibits bovine myoblast cell proliferation and differentiation via IGF1/PI3K/AKT signal pathway. J. Cell. Physiol. 2018, 234, 9839–9848. [Google Scholar] [CrossRef]
- Wang, X.; Cao, X.; Dong, D.; Shen, X.; Chen, H. Circular RNA TTN acts as a miR-432 sponge to facilitate proliferation and differentiation of myoblasts via the IGF2/PI3K/AKT signaling pathway. Mol. Ther. Nucleic Acids 2019, 18, 966–980. [Google Scholar] [CrossRef]
- Wullschleger, S.; Loewith, R.; Hall, M.N. TOR Signaling in Growth and Metabolism. Cell 2006, 124, 471–484. [Google Scholar] [CrossRef]
- Bishop, J.D.; Niem, W.L.; Dauphinee, S.M.; Too, C.K.L. Prolactin activates mammalian target-of-rapamycin through phosphatidylinositol 3-kinase and stimulates phosphorylation of p70S6K and 4E-binding protein-1 in lymphoma cells. Journal of Endocrinology 2006, 190, 307–312. [Google Scholar] [CrossRef]
- Osorio, J.S.; Lohakare, J.; Bionaz, M. Biosynthesis of milk fat, protein, and lactose: Roles of transcriptional and posttranscriptional regulation. Physiol. Genom. 2016, 48, 231–256. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Chen, D.; Zhen, Z.; Ao, J.; Yuan, X.; Gao, X. Annexin A2 positively regulates milk synthesis and proliferation of bovine mammary epithelial cells through the mTOR signaling pathway. J. Cell. Physiol. 2018, 233, 2464–2475. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Liu, L.; Qu, B.; Li, X.; Gao, X.; Zhang, M. Twinfilin 1 enhances milk bio-synthesis and proliferation of bovine mammary epithelial cells via the mTOR signaling pathway. Biochem. Biophys. Res. Commun. 2017, 492, 289–294. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Lin, X.; Hou, Q.; Hu, Z.; Wang, Y.; Wang, Z. Regulation of mTORC1 by amino acids in mammalian cells: A general picture of recent advances. Anim. Nutr. 2021, 7, 1009–1023. [Google Scholar] [CrossRef] [PubMed]
- Gingras, A.-C.; Raught, B.; Sonenberg, N. eIF4 Initiation Factors: Effectors of mRNA Recruitment to Ribosomes and Regulators of Translation. Annu. Rev. Biochem. 1999, 68, 913–963. [Google Scholar] [CrossRef] [PubMed]
- Fumagalli, S.; Pende, M. S6 kinase 1 at the central node of cell size and ageing. Front. Cell Dev. Biol. 2022, 10, 949196. [Google Scholar] [CrossRef] [PubMed]
- Ben-Sahra, I.; Howell, J.J.; Asara, J.M.; Manning, B.D. Stimulation of de Novo Pyrimidine Synthesis by Growth Signaling Through mTOR and S6K1. Science 2013, 339, 1323–1328. [Google Scholar] [CrossRef]
- Li, X.-G.; Sui, W.-G.; Gao, C.-Q.; Yan, H.-C.; Yin, Y.-L.; Li, H.-C.; Wang, X.-Q. L-Glutamate deficiency can trigger proliferation inhibition via down regulation of the mTOR/S6K1 pathway in pig intestinal epithelial cells1. J. Anim. Sci. 2016, 94, 1541–1549. [Google Scholar] [CrossRef]
- Pópulo, H.; Lopes, J.M.; Soares, P. The mTOR Signalling Pathway in Human Cancer. Int. J. Mol. Sci. 2012, 13, 1886–1918. [Google Scholar] [CrossRef]
- Xiong, J.; Wang, N.; Zhong, H.-J.; Cui, B.-W.; Cheng, S.; Sun, R.; Chen, J.-Y.; Xu, P.-P.; Cai, G.; Wang, L.; et al. SLC1A1 mediated glutamine addiction and contributed to natural killer T-cell lymphoma progression with immunotherapeutic potential. Ebiomedicine 2021, 72, 103614. [Google Scholar] [CrossRef]
- Osman, I.; He, X.; Liu, J.; Dong, K.; Wen, T.; Zhang, F.; Yu, L.; Hu, G.; Xin, H.-B.; Zhang, W.; et al. TEAD1 (TEA Domain Transcription Factor 1) Promotes Smooth Muscle Cell Proliferation Through Upregulating SLC1A5 (Solute Carrier Family 1 Member 5)-Mediated Glutamine Uptake. Circ. Res. 2019, 124, 1309–1322. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Frank, J.W.; Little, D.R.; Dunlap, K.A.; Satterfield, M.C.; Burghardt, R.C.; Hansen, T.R.; Wu, G.; Bazer, F.W. Functional role of arginine during the peri-implantation period of pregnancy. I. Consequences of loss of function of arginine transporter SLC7A1 mRNA in ovine conceptus trophectoderm. Faseb. J. 2014, 28, 2852–2863. [Google Scholar] [CrossRef] [PubMed]
- Menchini, R.J.; Chaudhry, F.A. Multifaceted regulation of the system A transporter Slc38a2 suggests nanoscale regulation of amino acid metabolism and cellular signaling. Neuropharmacology 2019, 161, 107789. [Google Scholar] [CrossRef] [PubMed]
- Lubischer, J.L.; Morgan, D.O. The Cell Cycle, Principles of Control. Integr. Comp. Biol. 2007, 47, 794–795. [Google Scholar] [CrossRef]
- Bertoli, C.; Skotheim, J.M.; de Bruin, R.A.M. Control of cell cycle transcription during G1 and S phases. Nat. Rev. Mol. Cell Biol. 2013, 14, 518–528. [Google Scholar] [CrossRef]
- Liu, L.; Michowski, W.; Kolodziejczyk, A.; Sicinski, P. The cell cycle in stem cell proliferation, pluripotency and differentiation. Nature 2019, 21, 1060–1067. [Google Scholar] [CrossRef]
- Pirozzi, F.; Lee, B.; Horsley, N.; Burkardt, D.D.; Dobyns, W.B.; Graham, J.M.; Dentici, M.L.; Cesario, C.; Schallner, J.; Porrmann, J.; et al. Proximal variants in CCND2 associated with microcephaly, short stature, and developmental delay: A case series and review of inverse brain growth phenotypes. Am. J. Med. Genet. Part A 2021, 185, 2719–2738. [Google Scholar] [CrossRef]
- Jeong, O.-S.; Chae, Y.-C.; Jung, H.; Park, S.C.; Cho, S.-J.; Kook, H.; Seo, S. Long noncoding RNA linc00598 regulates CCND2 transcription and modulates the G1 checkpoint. Sci. Rep. 2016, 6, 32172. [Google Scholar] [CrossRef]
- Becker, K.A.; Ghule, P.N.; Lian, J.B.; Stein, J.L.; van Wijnen, A.J.; Stein, G.S. Cyclin D2 and the CDK substrate p220(NPAT) are required for self-renewal of human embryonic stem cells. J. Cell Physiol. 2010, 222, 456–464. [Google Scholar] [CrossRef]
- Zhang, X.; Neganova, I.; Przyborski, S.; Yang, C.; Cooke, M.; Atkinson, S.P.; Anyfantis, G.; Fenyk, S.; Keith, N.; Hoare, S.F.; et al. A role for NANOG in G1 to S transition in human embryonic stem cells through direct binding of CDK6 and CDC25A. J. Cell Biol. 2009, 184, 67–82. [Google Scholar] [CrossRef]
- Pandey, S.; Wang, E. Cells en route to apoptosis are characterized by the upregulation of c-fos, c-myc, c-jun, cdc2, and RB phosphorylation, resembling events of early cell-cycle traverse. J. Cell Biochem. 1995, 58, 135–150. [Google Scholar] [CrossRef] [PubMed]
- Zhan, K.; Yang, T.Y.; Chen, Y.; Jiang, M.C.; Zhao, G.Q. Propionate enhances the expression of key genes involved in the gluconeogenic pathway in bovine intestinal epithelial cells. J. Dairy Sci. 2020, 103, 5514–5524. [Google Scholar] [CrossRef] [PubMed]




| Gene | Gene Description | Fold Change | p-Value |
|---|---|---|---|
| Amino Acid Transport | |||
| SLC1A1 | Solute carrier family 1 member 1 | 0.18 | <0.001 |
| SLC1A5 | Solute carrier family 1 member 5 | 0.43 | <0.001 |
| SLC7A1 | Solute carrier family 7 member 1 | 0.39 | <0.001 |
| SLC7A7 | Solute carrier family 7 member 7 | 0.37 | <0.001 |
| SLC7A11 | Solute carrier family 7 member 11 | 0.34 | <0.001 |
| SLC38A1 | Solute carrier family 38 member 1 | 0.28 | <0.001 |
| Glucose Transport | |||
| SLC2A5 | Solute carrier family 2 member 5 | 0.006 | <0.001 |
| SLC2A11 | Solute carrier family 2 member 11 | 2.8 | 0.02 |
| SLC2A13 | Solute carrier family 5 member 3 | 0.39 | 0.008 |
| SLC5A3 | Solute carrier family 5 member 3 | 0.27 | <0.001 |
| SLC5A9 | Solute carrier family 5 member 9 | 3.6 | 0.002 |
| PIK3-AKT-mTOR | |||
| PIK3CA | Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha | 0.46 | <0.001 |
| PIK3CB | Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta | 0.47 | <0.001 |
| PIK3CG | Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma | 0.08 | <0.001 |
| PIK3C2A | Phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha | 0.37 | <0.001 |
| PIK3C2B | Phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta | 0.47 | <0.001 |
| mTOR | Mechanistic target of rapamycin kinase | 0.34 | <0.001 |
| 4EBP2 | Eukaryotic translation initiation factor 4E binding protein 2 | 0.46 | 0.03 |
| RPS6KA2 | Ribosomal protein S6 kinase A2 | 0.12 | <0.001 |
| KRAS | KRAS proto-oncogene, GTPase | 0.32 | <0.001 |
| ERK4 | Mitogen-activated protein kinase 4 | 0.30 | <0.001 |
| Cell Cycle | |||
| CCND2 | Cyclin D2 | 0.13 | <0.001 |
| CDK6 | Cyclin dependent kinase 6 | 0.32 | <0.001 |
| CDC25A | Cell division cycle 25A | 0.43 | <0.001 |
| MYCL | MYCL proto-oncogene | 0.35 | <0.001 |
| BCL2 | BCL2 apoptosis regulator | 0.28 | <0.001 |
| CDK18 | Cyclin dependent kinase 18 | 0.50 | <0.001 |
| GSK3B | Glycogen synthase kinase 3 beta | 0.43 | <0.001 |
| Gene | Primer Sequence, 5′ to 3′ * | Product Size (bp) | Source |
|---|---|---|---|
| GAPDH | F: GGGTCATCATCTCTGCACCT | 176 | NM_001034034.2 |
| R: GGTCATAAGTCCCTCCACGA | |||
| p15INK4B | F: ACCCGGAAGTCACCTCAATT | 226 | NM_001075894 |
| R: GGGGCTCTCTGAATCCTACC | |||
| p16INK4A | F: CCTCTGAAGTCAAAAGGCGG | 121 | XM_010807758 |
| R: AAATCCTGACTCGTGGTGGG | |||
| p21Cip1 | F: GCAGACCACATGACAGATT | 205 | XM_005223326.4 |
| R: GTATGTACAAGAGAGGCGT | |||
| p27Kip1 | F: GACCTGCCGCAGATGATTCC | 249 | NM_001100346.1 |
| R: CCATTCTTGGAGTCAGCGAT | |||
| Cyclin E1 | F: TTGACAGGACTGTGAGAAGC | 187 | XM_024978361.1 |
| R: TTCAGTACAGGCAGTGGCGA | |||
| Cyclin E2 | F: CTGCATTCTGAGTTGGAACC | 229 | XM_025001684.1 |
| R: CTTGGAGCTTAGGAGCGTAG | |||
| CDK4 | F: ACTCTGTATCGTGCTCCAGAAG | 114 | XM_005206553.4 |
| R: CAGAAGAGAGGCTTTCGAGAA | |||
| Cyclin D1 | F: GCACTTCCTCTCCAAGATGC | 204 | NM_001046273.2 |
| R: GTCAGGCGGTGATAGGAGAG | |||
| Cyclin D2 | F: CCAGACCTTCATCGCTCTGT | 163 | XM_024992177.1 |
| R: GATCTTTGCCAGGAGATCCA | |||
| PIK3 | F: GATGCTACCTTACGGCTGCT | 215 | NM_001206047 |
| R: CGGCACAGGATAGGGTAAAC | |||
| AKT | F: CACCATTACGCCACCTGAC | 233 | NM_173986 |
| R: CACTCAAACGCATCCAGAAA | |||
| mTOR | F: ATGCTGTCCCTGGTCCTTATG | 178 | XM_002694043 |
| R: GGGTCAGAGAGTGGCCTTCAA | |||
| S6K1 | F: ATGAAAGCATGGACCATGGG | 199 | NM_205816 |
| R: CCGGTATTTGCTCCTGTTAC | |||
| 4EBP1 | F: GAACTCACCTGTGACCAAGA | 157 | NM_001077893 |
| R: CTCAAACTGTGACTCTTCACC | |||
| EIF4E | F: GAAGACTTTTGGGCTCTGTAC | 250 | NM_174310 |
| R: CAGCTCCACATACATCATCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meng, Z.; Tan, D.; Cheng, Z.; Jiang, M.; Zhan, K. GPR41 Regulates the Proliferation of BRECs via the PIK3-AKT-mTOR Pathway. Int. J. Mol. Sci. 2023, 24, 4203. https://doi.org/10.3390/ijms24044203
Meng Z, Tan D, Cheng Z, Jiang M, Zhan K. GPR41 Regulates the Proliferation of BRECs via the PIK3-AKT-mTOR Pathway. International Journal of Molecular Sciences. 2023; 24(4):4203. https://doi.org/10.3390/ijms24044203
Chicago/Turabian StyleMeng, Zitong, Dejin Tan, Zhiqiang Cheng, Maocheng Jiang, and Kang Zhan. 2023. "GPR41 Regulates the Proliferation of BRECs via the PIK3-AKT-mTOR Pathway" International Journal of Molecular Sciences 24, no. 4: 4203. https://doi.org/10.3390/ijms24044203
APA StyleMeng, Z., Tan, D., Cheng, Z., Jiang, M., & Zhan, K. (2023). GPR41 Regulates the Proliferation of BRECs via the PIK3-AKT-mTOR Pathway. International Journal of Molecular Sciences, 24(4), 4203. https://doi.org/10.3390/ijms24044203

