Inhibition of Xanthine Oxidase Protects against Diabetic Kidney Disease through the Amelioration of Oxidative Stress via VEGF/VEGFR Axis and NOX-FoxO3a-eNOS Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. The Effects of XO Inhibition on Physical and Biochemical Parameters in STZ-Induced DKD Mice
2.2. The Effects of XO Inhibition on Uric Acid and XOR Activities in STZ-Induced DKD Mice
Cont | Feb | STZ | STZ + Feb | |
---|---|---|---|---|
BW (g) | 29.6 ± 0.8 | 27.0 ± 2.1 | 22.2 ± 2.0 ***,†† | 22.6 ± 2.6 ***,†† |
Food intake (g/day) | 3.86 ± 0.20 | 3.20 ± 0.33 | 5.60 ± 0.13 ***,††† | 6.17 ± 0.38 ***,††† |
Water intake (mL/day) | 6.33 ± 1.04 | 4.53 ± 0.23 | 23.4 ± 0.88 ***,††† | 24.2 ± 2.46 ***,††† |
KW/BW(g/g × 100) | 0.7 ± 0.07 | 0.6 ± 0.06 | 0.9 ± 0.02 *,†† | 0.7 ± 0.1 ‡ |
FBS (mg/dL) | 180.0 ± 22.3 | 172.8 ± 25.3 | 681.0 ± 155.2 *** | 489.9 ± 39.0 ***,†† |
HbA1c (%) | 4.23 ± 0.31 | 4.16 ± 0.32 | 11.3 ± 1.32 ***,††† | 10.1 ± 1.48 ***,††† |
Serum Cr (mg/dL) | 0.08 ± 0.05 | 0.08 ± 0.04 | 0.07 ± 0.05 | 0.04 ± 0.05 |
2.3. The Effects of XO Inhibition on Renal Histological Changes, and Expression of TGF-β1 and Col IV in STZ-Induced DKD Mice
2.4. The Effects of XO Inhibition on VEGF and VEGFR Expression in STZ-Induced DKD Mice
2.5. The Effects of XO Inhibition on NOX Expressions in STZ-Induced DKD Mice
2.6. The Effects of XO Inhibition on Akt, FoxOs, and eNOS Expression in STZ-Induced DKD Mice
2.7. The Effects of XO Inhibition on Oxidative Stress in STZ-Induced DKD Mice
2.8. The Effects of XO Inhibition on Oxidative Stress in HG-Treated Human GECs via VEGFR1/3-Dependent NOX-FoxO3a-eNOS Signaling
3. Discussion
4. Materials and Methods
4.1. Animals and Experimental Design
4.2. The Assessments of Biochemical Parameters in Blood and Urine Samples
4.3. Histopathologic Analysis and Immunohistochemical Staining
4.4. In Vitro Experiments
4.5. Enzyme Immunoassay in the Kidney Tissues
4.6. Immunoblot Analysis
4.7. Real-Time Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
4.8. Measurement of ROS in GECs
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Harding, J.L.; Pavkov, M.E.; Magliano, D.J.; Shaw, J.E.; Gregg, E.W. Global trends in diabetes complications: A review of current evidence. Diabetologia 2019, 62, 3–16. [Google Scholar] [CrossRef]
- Lin, X.; Xu, Y.; Pan, X.; Xu, J.; Ding, Y.; Sun, X.; Song, X.; Ren, Y.; Shan, P.F. Global, regional, and national burden and trend of diabetes in 195 countries and territories: An analysis from 1990 to 2025. Sci. Rep. 2020, 10, 14790. [Google Scholar] [CrossRef] [PubMed]
- de Boer, I.H.; Caramori, M.L.; Chan, J.C.N.; Heerspink, H.J.L.; Hurst, C.; Khunti, K.; Liew, A.; Michos, E.D.; Navaneethan, S.D.; Olowu, W.A.; et al. KDIGO 2020 Clinical Practice Guideline for Diabetes Management in Chronic Kidney Disease. Kidney Int. 2020, 98, S1–S115. [Google Scholar] [CrossRef]
- Jha, J.C.; Banal, C.; Chow, B.S.; Cooper, M.E.; Jandeleit-Dahm, K. Diabetes and Kidney Disease: Role of Oxidative Stress. Antioxid. Redox Signal. 2016, 25, 657–684. [Google Scholar] [CrossRef] [PubMed]
- Battelli, M.G.; Polito, L.; Bortolotti, M.; Bolognesi, A. Xanthine Oxidoreductase-Derived Reactive Species: Physiological and Pathological Effects. Oxid. Med. Cell. Longev. 2016, 2016, 3527579. [Google Scholar] [CrossRef]
- Bravard, A.; Bonnard, C.; Durand, A.; Chauvin, M.A.; Favier, R.; Vidal, H.; Rieusset, J. Inhibition of xanthine oxidase reduces hyperglycemia-induced oxidative stress and improves mitochondrial alterations in skeletal muscle of diabetic mice. Am. J. Physiol. Endocrinol. Metab. 2011, 300, E581–E591. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.M.; Choi, Y.W.; Seok, H.Y.; Jeong, K.H.; Lee, S.H.; Lee, T.W.; Ihm, C.G.; Lim, S.J.; Moon, J.Y. Reducing serum uric acid attenuates TGF-beta1-induced profibrogenic progression in type 2 diabetic nephropathy. Nephron Exp. Nephrol. 2012, 121, e109–e121. [Google Scholar] [CrossRef]
- Lee, H.J.; Jeong, K.H.; Kim, Y.G.; Moon, J.Y.; Lee, S.H.; Ihm, C.G.; Sung, J.Y.; Lee, T.W. Febuxostat ameliorates diabetic renal injury in a streptozotocin-induced diabetic rat model. Am. J. Nephrol. 2014, 40, 56–63. [Google Scholar] [CrossRef] [PubMed]
- Matsui-Hirai, H.; Hayashi, T.; Yamamoto, S.; Ina, K.; Maeda, M.; Kotani, H.; Iguchi, A.; Ignarro, L.J.; Hattori, Y. Dose-Dependent Modulatory Effects of Insulin on Glucose-Induced Endothelial Senescence In Vitro and In Vivo: A Relationship between Telomeres and Nitric Oxide. J. Pharmacol. Exp. Ther. 2011, 337, 591–599. [Google Scholar] [CrossRef]
- Fu, J.; Lee, K.; Chuang, P.Y.; Liu, Z.; He, J.C. Glomerular endothelial cell injury and cross talk in diabetic kidney disease. Am. J. Physiol. Renal Physiol. 2015, 308, F287–F297. [Google Scholar] [CrossRef]
- Cha, D.R.; Kang, Y.S.; Han, S.Y.; Jee, Y.H.; Han, K.H.; Han, J.Y.; Kim, Y.S.; Kim, N.H. Vascular endothelial growth factor is increased during early stage of diabetic nephropathy in type II diabetic rats. J. Endocrinol. 2004, 183, 183–194. [Google Scholar] [CrossRef] [PubMed]
- Cooper, M.E.; Vranes, D.; Youssef, S.; Stacker, S.A.; Cox, A.J.; Rizkalla, B.; Casley, D.J.; Bach, L.A.; Kelly, D.J.; Gilbert, R.E. Increased renal expression of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 in experimental diabetes. Diabetes 1999, 48, 2229–2239. [Google Scholar] [CrossRef]
- Takano, Y.; Hase-Aoki, K.; Horiuchi, H.; Zhao, L.; Kasahara, Y.; Kondo, S.; Becker, M.A. Selectivity of febuxostat, a novel non-purine inhibitor of xanthine oxidase/xanthine dehydrogenase. Life Sci. 2005, 76, 1835–1847. [Google Scholar] [CrossRef]
- Komers, R.; Xu, B.; Schneider, J.; Oyama, T.T. Effects of xanthine oxidase inhibition with febuxostat on the development of nephropathy in experimental type 2 diabetes. Br. J. Pharmacol. 2016, 173, 2573–2588. [Google Scholar] [CrossRef]
- Nakamura, T.; Murase, T.; Nampei, M.; Morimoto, N.; Ashizawa, N.; Iwanaga, T.; Sakamoto, R. Effects of topiroxostat and febuxostat on urinary albumin excretion and plasma xanthine oxidoreductase activity in db/db mice. Eur. J. Pharmacol. 2016, 780, 224–231. [Google Scholar] [CrossRef]
- Mizuno, Y.; Yamamotoya, T.; Nakatsu, Y.; Ueda, K.; Matsunaga, Y.; Inoue, M.K.; Sakoda, H.; Fujishiro, M.; Ono, H.; Kikuchi, T.; et al. Xanthine Oxidase Inhibitor Febuxostat Exerts an Anti-Inflammatory Action and Protects against Diabetic Nephropathy Development in KK-Ay Obese Diabetic Mice. Int. J. Mol. Sci. 2019, 20, 4680. [Google Scholar] [CrossRef]
- Itano, S.; Kadoya, H.; Satoh, M.; Nakamura, T.; Murase, T.; Sasaki, T.; Kanwar, Y.S.; Kashihara, N. Non-purine selective xanthine oxidase inhibitor ameliorates glomerular endothelial injury in Ins(Akita) diabetic mice. Am. J. Physiol. Renal Physiol. 2020, 319, F765–F772. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, M.Z.; Baky, M.A.E.; Hassan, O.A.; Mohammed, H.H.; Abdel-Aziz, A.M. PTEN/PI3K/VEGF signaling pathway involved in the protective effect of xanthine oxidase inhibitor febuxostat against endometrial hyperplasia in rats. Hum. Exp. Toxicol. 2020, 39, 1224–1234. [Google Scholar] [CrossRef] [PubMed]
- Di Meo, S.; Reed, T.T.; Venditti, P.; Victor, V.M. Role of ROS and RNS Sources in Physiological and Pathological Conditions. Oxid. Med. Cell. Longev. 2016, 2016, 1245049. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wang, C.; Liu, F.; Lu, Y.; Cheng, J. Metabonomics revealed xanthine oxidase-induced oxidative stress and inflammation in the pathogenesis of diabetic nephropathy. Anal. Bioanal. Chem. 2015, 407, 2569–2579. [Google Scholar] [CrossRef]
- Tsai, C.C.; Wu, S.B.; Cheng, C.Y.; Kao, S.C.; Kau, H.C.; Chiou, S.H.; Hsu, W.M.; Wei, Y.H. Increased oxidative DNA damage, lipid peroxidation, and reactive oxygen species in cultured orbital fibroblasts from patients with Graves’ ophthalmopathy: Evidence that oxidative stress has a role in this disorder. Eye 2010, 24, 1520–1525. [Google Scholar] [CrossRef]
- Cui, J.; Zhou, Q.; Yu, M.; Liu, Y.; Teng, X.; Gu, X. 4-tert-butylphenol triggers common carp hepatocytes ferroptosis via oxidative stress, iron overload, SLC7A11/GSH/GPX4 axis, and ATF4/HSPA5/GPX4 axis. Ecotoxicol. Environ. Saf. 2022, 242, 113944. [Google Scholar] [CrossRef]
- Lassén, E.; Daehn, I.S. Molecular Mechanisms in Early Diabetic Kidney Disease: Glomerular Endothelial Cell Dysfunction. Int. J. Mol. Sci. 2020, 21, 9456. [Google Scholar] [CrossRef]
- Chung, H.Y.; Baek, B.S.; Song, S.H.; Kim, M.S.; Huh, J.I.; Shim, K.H.; Kim, K.W.; Lee, K.H. Xanthine dehydrogenase/xanthine oxidase and oxidative stress. Age 1997, 20, 127–140. [Google Scholar] [CrossRef] [PubMed]
- Battelli, M.G.; Bortolotti, M.; Polito, L.; Bolognesi, A. Metabolic syndrome and cancer risk: The role of xanthine oxidoreductase. Redox Biol. 2018, 21, 101070. [Google Scholar] [CrossRef]
- Adachi, T.; Fukushima, T.; Usami, Y.; Hirano, K. Binding of human xanthine oxidase to sulphated glycosaminoglycans on the endothelial-cell surface. Biochem. J. 1993, 289 Pt 2, 523–527. [Google Scholar] [CrossRef]
- Witting, P.K.; Rayner, B.S.; Wu, B.J.; Ellis, N.A.; Stocker, R. Hydrogen peroxide promotes endothelial dysfunction by stimulating multiple sources of superoxide anion radical production and decreasing nitric oxide bioavailability. Cell. Physiol. Biochem. 2007, 20, 255–268. [Google Scholar] [CrossRef] [PubMed]
- Battelli, M.G.; Polito, L.; Bolognesi, A. Xanthine oxidoreductase in atherosclerosis pathogenesis: Not only oxidative stress. Atherosclerosis 2014, 237, 562–567. [Google Scholar] [CrossRef] [PubMed]
- Kou, B.; Ni, J.; Vatish, M.; Singer, D.R. Xanthine oxidase interaction with vascular endothelial growth factor in human endothelial cell angiogenesis. Microcirculation 2008, 15, 251–267. [Google Scholar] [CrossRef]
- Abdel-Aziz, A.M.; Gamal El-Tahawy, N.F.; Salah Abdel haleem, M.A.; Mohammed, M.M.; Ali, A.I.; Ibrahim, Y.F. Amelioration of testosterone-induced benign prostatic hyperplasia using febuxostat in rats: The role of VEGF/TGFβ and iNOS/COX-2. Eur. J. Pharmacol. 2020, 889, 173631. [Google Scholar] [CrossRef]
- Park, S.A.; Jeong, M.S.; Ha, K.-T.; Jang, S.B. Structure and function of vascular endothelial growth factor and its receptor system. BMB Rep. 2018, 51, 73–78. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.W.; Lim, J.H.; Kim, M.Y.; Chung, S.; Shin, S.J.; Chung, H.W.; Choi, B.S.; Kim, Y.S.; Chang, Y.S.; Park, C.W. Long-term blockade of vascular endothelial growth factor receptor-2 aggravates the diabetic renal dysfunction associated with inactivation of the Akt/eNOS-NO axis. Nephrol. Dial. Transplant. 2011, 26, 1173–1188. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lavoz, C.; Rodrigues-Diez, R.R.; Plaza, A.; Carpio, D.; Egido, J.; Ruiz-Ortega, M.; Mezzano, S. VEGFR2 Blockade Improves Renal Damage in an Experimental Model of Type 2 Diabetic Nephropathy. J. Clin. Med. 2020, 9, 302. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.S.; Lim, J.H.; Kim, T.W.; Kim, M.Y.; Kim, Y.; Chung, S.; Shin, S.J.; Choi, B.S.; Kim, H.W.; Kim, Y.S.; et al. Vascular endothelial growth factor-receptor 1 inhibition aggravates diabetic nephropathy through eNOS signaling pathway in db/db mice. PLoS ONE 2014, 9, e94540. [Google Scholar] [CrossRef]
- Hwang, S.D.; Song, J.H.; Kim, Y.; Lim, J.H.; Kim, M.Y.; Kim, E.N.; Hong, Y.A.; Chung, S.; Choi, B.S.; Kim, Y.S.; et al. Inhibition of lymphatic proliferation by the selective VEGFR-3 inhibitor SAR131675 ameliorates diabetic nephropathy in db/db mice. Cell. Death. Dis. 2019, 10, 219. [Google Scholar] [CrossRef]
- Shibuya, M. Differential roles of vascular endothelial growth factor receptor-1 and receptor-2 in angiogenesis. J. Biochem. Mol. Biol. 2006, 39, 469–478. [Google Scholar] [CrossRef]
- Kim, N.H.; Oh, J.H.; Seo, J.A.; Lee, K.W.; Kim, S.G.; Choi, K.M.; Baik, S.H.; Choi, D.S.; Kang, Y.S.; Han, S.Y.; et al. Vascular endothelial growth factor (VEGF) and soluble VEGF receptor FLT-1 in diabetic nephropathy. Kidney Int. 2005, 67, 167–177. [Google Scholar] [CrossRef]
- Sung, S.H.; Ziyadeh, F.N.; Wang, A.; Pyagay, P.E.; Kanwar, Y.S.; Chen, S. Blockade of vascular endothelial growth factor signaling ameliorates diabetic albuminuria in mice. J. Am. Soc. Nephrol. 2006, 17, 3093–3104. [Google Scholar] [CrossRef]
- Sato, W.; Kosugi, T.; Zhang, L.; Roncal, C.A.; Heinig, M.; Campbell-Thompson, M.; Yuzawa, Y.; Atkinson, M.A.; Grant, M.B.; Croker, B.P.; et al. The pivotal role of VEGF on glomerular macrophage infiltration in advanced diabetic nephropathy. Lab. Investig. 2008, 88, 949–961. [Google Scholar] [CrossRef]
- Kim, Y.; Hwang, S.D.; Lim, J.H.; Kim, M.Y.; Kim, E.N.; Choi, B.S.; Kim, Y.S.; Kim, H.W.; Park, C.W. Attenuated Lymphatic Proliferation Ameliorates Diabetic Nephropathy and High-Fat Diet-Induced Renal Lipotoxicity. Sci. Rep. 2019, 9, 1994. [Google Scholar] [CrossRef]
- Ushio-Fukai, M. Redox signaling in angiogenesis: Role of NADPH oxidase. Cardiovasc. Res. 2006, 71, 226–235. [Google Scholar] [CrossRef]
- Jones, S.A.; O'Donnell, V.B.; Wood, J.D.; Broughton, J.P.; Hughes, E.J.; Jones, O.T. Expression of phagocyte NADPH oxidase components in human endothelial cells. Am. J. Physiol. 1996, 271, H1626–H1634. [Google Scholar] [CrossRef] [PubMed]
- Webb, A.E.; Brunet, A. FOXO transcription factors: Key regulators of cellular quality control. Trends Biochem. Sci. 2014, 39, 159–169. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.A.; Lim, J.H.; Kim, M.Y.; Kim, T.W.; Kim, Y.; Yang, K.S.; Park, H.S.; Choi, S.R.; Chung, S.; Kim, H.W.; et al. Fenofibrate improves renal lipotoxicity through activation of AMPK-PGC-1alpha in db/db mice. PLoS ONE 2014, 9, e96147. [Google Scholar]
- Hong, Y.A.; Lim, J.H.; Kim, M.Y.; Kim, Y.; Park, H.S.; Kim, H.W.; Choi, B.S.; Chang, Y.S.; Kim, H.W.; Kim, T.Y.; et al. Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy. Antioxid. Redox Signal. 2018, 28, 1543–1561. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.J.; Kim, J.H.; Chang, Y.K.; Park, C.W.; Kim, S.Y.; Hong, Y.A. Inhibition of xanthine oxidoreductase protects against contrast-induced renal tubular injury by activating adenosine monophosphate-activated protein kinase. Free. Radic. Biol. Med. 2019, 145, 209–220. [Google Scholar] [CrossRef]
- Rangan, G.K.; Tesch, G.H. Quantification of renal pathology by image analysis. Nephrology 2007, 12, 553–558. [Google Scholar] [CrossRef]
Gene | Sequence (Mouse) |
---|---|
VEGF | Fwd: CAGGCTGCTGTAACGATGAA Rev: AAATGCTTTCTCCGCTCTGA |
NoxO1 | Fwd: GACATTTGCCTTCTCCGTGT Rev: CGTACCAGTCCTCGACCAGT |
p22Phox | Fwd: TGGACGTTTCACACAGTGGT Rev: ACCGACAACAGGAAGTGGAG |
p47Phox | Fwd: ACCTGAAACTGCCCACTGAC Rev: CTGTTCCCGAACTCTTCTCG |
p67Phox | Fwd: TGGCCTACTTCCAGAGAGGA Rev: CTTCATGTTGGTTGCCAATG |
mGAPDH | Fwd: TGCAGTGGCAAAGTGGAGATT Rev: CGTGAGTGGAGTCATACTGGAACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, K.-J.; Choi, W.J.; Chang, Y.-K.; Park, C.W.; Kim, S.Y.; Hong, Y.A. Inhibition of Xanthine Oxidase Protects against Diabetic Kidney Disease through the Amelioration of Oxidative Stress via VEGF/VEGFR Axis and NOX-FoxO3a-eNOS Signaling Pathway. Int. J. Mol. Sci. 2023, 24, 3807. https://doi.org/10.3390/ijms24043807
Yang K-J, Choi WJ, Chang Y-K, Park CW, Kim SY, Hong YA. Inhibition of Xanthine Oxidase Protects against Diabetic Kidney Disease through the Amelioration of Oxidative Stress via VEGF/VEGFR Axis and NOX-FoxO3a-eNOS Signaling Pathway. International Journal of Molecular Sciences. 2023; 24(4):3807. https://doi.org/10.3390/ijms24043807
Chicago/Turabian StyleYang, Keum-Jin, Won Jung Choi, Yoon-Kyung Chang, Cheol Whee Park, Suk Young Kim, and Yu Ah Hong. 2023. "Inhibition of Xanthine Oxidase Protects against Diabetic Kidney Disease through the Amelioration of Oxidative Stress via VEGF/VEGFR Axis and NOX-FoxO3a-eNOS Signaling Pathway" International Journal of Molecular Sciences 24, no. 4: 3807. https://doi.org/10.3390/ijms24043807
APA StyleYang, K.-J., Choi, W. J., Chang, Y.-K., Park, C. W., Kim, S. Y., & Hong, Y. A. (2023). Inhibition of Xanthine Oxidase Protects against Diabetic Kidney Disease through the Amelioration of Oxidative Stress via VEGF/VEGFR Axis and NOX-FoxO3a-eNOS Signaling Pathway. International Journal of Molecular Sciences, 24(4), 3807. https://doi.org/10.3390/ijms24043807