Analysis of Genetic Relatedness between Gastric and Oral Helicobacter pylori in Patients with Early Gastric Cancer Using Multilocus Sequence Typing
Abstract
1. Introduction
2. Results
2.1. Characteristics of Patients
2.2. Identification of H. pylori in Stomach Tissue
2.3. Nested PCR and Allele Analysis
2.4. MLST
2.5. Phylogenetic Analysis
3. Discussion
4. Materials and Methods
4.1. Participants
4.2. Oral Sample Collection
4.3. Gastrointestinal Endoscopy and Histologic Examination
4.4. DNA Extraction and Nested PCR
4.5. Sequencing and MLST Analysis
4.6. Phylogenic Tree Analysis
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Marshall, B.J.; Warren, J.R. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 1984, 1, 1311–1315. [Google Scholar] [CrossRef] [PubMed]
- Dooley, C.P.; Cohen, H.; Fitzgibbons, P.L.; Bauer, M.; Appleman, M.D.; Perez-Perez, G.I.; Blaser, M.J. Prevalence of Helicobacter pylori infection and histologic gastritis in asymptomatic persons. N. Engl. J. Med. 1989, 321, 1562–1566. [Google Scholar] [CrossRef] [PubMed]
- Parsonnet, J.; Friedman, G.D.; Vandersteen, D.P.; Chang, Y.; Vogelman, J.H.; Orentreich, N.; Sibley, R.K. Helicobacter pylori Infection and the Risk of Gastric Carcinoma. N. Engl. J. Med. 1991, 325, 1127–1131. [Google Scholar] [CrossRef]
- Nomura, A.; Stemmermann, G.N.; Chyou, P.H.; Kato, I.; Perez-Perez, G.I.; Blaser, M.J. Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii. N. Engl. J. Med. 1991, 325, 1132–1136. [Google Scholar] [CrossRef]
- Pounder, R.E.; Ng, D. The prevalence of Helicobacter pylori infection in different countries. Aliment. Pharmacol. Ther. 1995, 9 (Suppl. 2), 33–39. [Google Scholar] [PubMed]
- Kayali, S.; Manfredi, M.; Gaiani, F.; Bianchi, L.; Bizzarri, B.; Leandro, G.; Mario, F.D.; Angelis, G.L. Helicobacter pylori, transmission routes and recurrence of infection; State of the art. Acta Biomed. 2018, 89, 72–76. [Google Scholar] [CrossRef]
- Wang, C.; Nishiyama, T.; Kikuchi, S.; Inoue, M.; Sawada, N.; Tsugane, S.; Lin, Y. Changing trends in the prevalence of H. pylori infection in Japan (1908–2003): A systematic review and meta-regression analysis of 170,752 individuals. Sci. Rep. 2017, 7, 15491. [Google Scholar] [CrossRef]
- Miyamoto, R.; Okuda, M.; Lin, Y.; Murotani, K.; Okumura, A.; Kikuchi, S. Rapidly decreasing prevalence of Helicobacter pylori among Japanese children and adolescents. J. Infect. Chemother. 2019, 25, 526–530. [Google Scholar] [CrossRef]
- Dowsett, S.A.; Kowolik, M.J. Oral Helicobacter pylori: Can we stomach it? Crit. Rev. Oral Biol. Med. 2003, 14, 226–233. [Google Scholar] [CrossRef]
- Song, Q.; Lange, T.; Spahr, A.; Adler, G.; Bode, G. Characteristic distribution pattern of Helicobacter pylori in dental plaque and saliva detected with nested PCR. J. Med. Microbiol. 2000, 49, 349–353. [Google Scholar] [CrossRef]
- Miyabayashi, H.; Furihata, K.; Shimizu, T.; Ueno, I.; Akamatsu, T. Infuluence of oral Helicobacter pylori on the success of eradication therapy against gastric Helicobacter pylori. Helicobacter 2000, 5, 30–37. [Google Scholar] [CrossRef] [PubMed]
- Román-Román, A.; Giono-Cerezo, S.; Camorlinga-Ponce, M.; Martínez-Carrillo, D.N.; Loaiza-Loeza, S.; Fernández-Tilapa, G. VacA genotypes of Helicobacter pylori in the oral cavity and stomach of patients with chronic gastritis and gastric ulcer. Enferm. Infecc. Microbiol. Clin. 2013, 31, 130–135. [Google Scholar] [CrossRef] [PubMed]
- Nagata, R.; Ohsumi, T.; Takenaka, S.; Noiri, Y. Current prevalence of oral Helicobacter pylori among Japanese adults determined using a nested polymerase chain reaction assay. Pathogens 2020, 10, 10. [Google Scholar] [CrossRef] [PubMed]
- Sugimoto, M.; Wu, J.Y.; Abudayyeh, S.; Hoffman, J.; Brahem, H.; Al-Khatib, K.; Yamaoka, Y.; Graham, D. Unreliability of results of PCR detection of Helicobacter pylori in clinical or environmental samples. J. Clin. Microbiol. 2009, 47, 738–742. [Google Scholar] [CrossRef] [PubMed]
- Adler, I.; Muiño, A.; Aguas, S.; Harada, L.; Diaz, M.; Lence, A.; Labbrozzi, M.; Muiño, J.M.; Elsner, B.; Avagnina, A.; et al. Helicobacter pylori and oral pathology: Relationship with the gastric infection. World J. Gastroenterol. 2014, 20, 9922–9935. [Google Scholar] [CrossRef]
- Anand, P.S.; Kamath, K.P.; Anil, S. Role of dental plaque, saliva and periodontal disease in Helicobacter pylori infection. World J. Gastroenterol. 2014, 20, 5639–5653. [Google Scholar] [CrossRef]
- Kadota, T.; Hamada, M.; Nomura, R.; Ogaya, Y.; Okawa, R.; Uzawa, N.; Nakano, K. Distribution of Helicobacter pylori and periodontopathic bacterial species in the oral cavity. Biomedicines 2020, 8, 161. [Google Scholar] [CrossRef]
- Yee, J.K.C. Are the view of Helicobacter pylori colonized in the oral cavity an illusion? Exp. Mol. Med. 2017, 49, e397. [Google Scholar] [CrossRef]
- Iwai, K.; Watanabe, I.; Yamamoto, T.; Kuriyama, N.; Matsui, D.; Nomura, R.; Ogaya, Y.; Oseko, F.; Adachi, K.; Takizawa, S.; et al. Association between Helicobacter pylori infection and dental pulp reservoirs in Japanese adults. BMC Oral Health 2019, 19, 267. [Google Scholar] [CrossRef]
- Lauritano, D.; Cura, F.; Candotto, V.; Gaudio, R.M.; Mucchi, D.; Carinci, F. Periodontal pockets as a reservoir of Helicobacter pylori causing relapse of gastric ulcer: A review of the literature. J. Biol. Regul. Homeost. Agents 2015, 29 (Suppl. 1), 123–126. [Google Scholar]
- Payão, S.L.M.; Rasmussen, L.T. Helicobacter pylori and its reservoirs: A correlation with the gastric infection. World J. Gastrointest. Pharmacol. Ther. 2016, 7, 126–132. [Google Scholar] [CrossRef] [PubMed]
- Ren, Q.; Yan, X.; Zhou, Y.; Li, W.X. Periodontal therapy as adjunctive treatment for gastric Helicobacter pylori infection. Cochrane Database Syst. Rev. 2016, 2, CD009477. [Google Scholar] [CrossRef] [PubMed]
- Tongtawee, T.; Wattanawongdon, W.; Simawaranon, T. Effects of periodontal therapy on eradication and recurrence of Helicobacter pylori infection after successful treatment. J. Int. Med. Res. 2019, 47, 875–883. [Google Scholar] [CrossRef] [PubMed]
- López-Valverde, N.; Macedo de Sousa, B.M.; López-Valverde, A.; Suárez, A.; Rodríguez, C.; Aragoneses, J.M. Possible association of periodontal diseases with Helicobacter pylori gastric infection: A systematic review and meta-analysis. Front. Med. 2022, 9, 822194. [Google Scholar] [CrossRef] [PubMed]
- Osaki, T.; Okuda, M.; Ueda, J.; Konno, M.; Yonezawa, H.; Hojo, F.; Yagyu, K.; Lin, Y.; Fukuda, Y.; Kikuchi, M.; et al. Multilocus sequence typing of DNA from faecal specimens for the analysis of intra-familial transmission of Helicobacter pylori. J. Med. Microbiol. 2013, 62, 761–765. [Google Scholar] [CrossRef]
- Hashi, K.; Imai, C.; Yahara, K.; Tahmina, K.; Hayashi, T.; Azuma, T.; Miyabe-Nishiwaki, T.; Sato, H.; Matsuoka, M.; Niimi, A.; et al. Evaluating the origin and virulence of a Helicobacter pylori cagA-positive strain isolated from a non-human primate. Sci. Rep. 2018, 8, 15981. [Google Scholar] [CrossRef]
- Floridia-Yapur, N.; Rusman, F.; Diosque, P.; Tomasini, N. Genome data vs MLST for exploring intraspecific evolutionary history in bacteria: Much is not always better. Infect. Genet. Evol. 2021, 93, 104990. [Google Scholar] [CrossRef]
- Lee, J.Y.; Kim, N. Diagnosis of Helicobacter pylori by invasive test: Histology. Ann. Transl. Med. 2015, 3, 10. [Google Scholar] [CrossRef]
- Khan, H.; Rauf, F.; Muhammad, N.; Javaid, M.; Alam, S.; Nasir, S. Comparison of special stains (Giemsa stain and Modified toluidine blue stain) with immunohistochemistry as gold standard for the detection of H. pylori in gastric biopsies. Arab J. Gastroenterol. 2022, 23, 75–81. [Google Scholar] [CrossRef]
- Jolley, K.A.; Bray, J.E.; Maiden, M.C.J. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res. 2018, 3, 124. [Google Scholar] [CrossRef]
- Yokota, S.; Konno, M.; Fujiwara, S.; Toita, N.; Takahashi, M.; Yamamoto, S.; Ogasawara, N.; Shiraishi, T. Intrafamilial, preferentially mother-to-child and intraspousal, Helicobacter pylori infection in japan determined by mutilocus sequence typing and random amplified polymorphic DNA fingerprinting. Helicobacter 2015, 20, 334–342. [Google Scholar] [CrossRef]
- Morales-Espinosa, R.; Fernandez-Presas, A.; Gonzalez-Valencia, G.; Flores-Hernandez, S.; Delgado-Sapien, G.; Mendez-Sanchez, J.L.; Sanshez-Quezada, E.; Muñoz-Pérez, L.; Leon-Aguilar, R.; Hernandez-Guerrero, J.; et al. Helicobacter pylori in the oral cavity is associated with gastroesophageal disease. Oral Microbiol. Immunol. 2009, 24, 464–468. [Google Scholar] [CrossRef] [PubMed]
- Yahiro, K.; Niidome, T.; Kimura, M.; Hatakeyama, T.; Aoyagi, H.; Kurazono, H.; Imagawa, K.; Wada, A.; Moss, J.; Hirayama, T. Activation of Helicobacter pylori VacA toxin by alkaline or acid conditions increases its binding to a 250-kDa receptor protein-tyrosine phosphatase beta. J. Biol. Chem. 1999, 274, 36693–36699. [Google Scholar] [CrossRef]
- Yamaoka, Y.; Osato, M.S.; Sepulveda, A.R.; Gutierrez, O.; Figura, N.; Kim, J.G.; Kodama, T.; Kashima, K.; Graham, D.Y. Molecular epidemiology of Helicobacter pylori: Separation of H. pylori from East Asian and non-Asian countries. Epidemiol. Infect. 2000, 124, 91–96. [Google Scholar] [CrossRef] [PubMed]
- Yamaoka, Y.; EI-Zimaity, H.M.; Gutierrez, O.; Figura, N.; Kim, J.G.; Kodama, T.; Kashima, K.; Graham, D.Y. Relationship between the cagA3′ repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH. Gastroenterology 1999, 117, 342–349. [Google Scholar] [CrossRef] [PubMed]
- Yamaoka, Y.; Orito, E.; Mizokami, M.; Gutierrez, O.; Saitou, N.; Kodama, T.; Osato, M.S.; Kim, J.G.; Ramirez, F.C.; Mahachai, V. Helicobacter pylori in North and South America before Columbus. FEBS letters. 2002, 517, 180–184. [Google Scholar] [CrossRef]
- Silva, D.G.; Tinoco, E.M.B.; Rocha, G.A.; Rocha, A.M.C.; Guerra, J.B.; Saraiva, I.E.B.; Queiroz, D.M.M. Helicobacter pylori transiently in the mouth may participate in the transmission of infection. Mem. Inst. Oswaldo Cruz. 2010, 105, 657–660. [Google Scholar] [CrossRef]
- Sulo, P.; Šipková, B. DNA diagnostics for reliable and universal identification of Helicobacter pylori. World J. Gastroenterol. 2021, 27, 7100–7112. [Google Scholar] [CrossRef]
- Palau, M.; Piqué, N.; Ramírez-Lázaro, M.J.; Lario, S.; Calvet, X.; Miñana-Galbis, D. Whole-genome sequencing and comparative genomics of three Helicobacter pylori strains isolated from the stomach of a patient with adenocaricinoma. Pathogens 2021, 10, 331. [Google Scholar] [CrossRef]
- Yassine, I.; Lefèvre, S.; Hansen, E.E.; Ruckly, C.; Carle, I.; Lejay-Collin, M.; Fabre, L.; Rafei, R.; Clermont, D.; Gandara, M.P.; et al. Population structure analysis and laboratory monitoring of Shigella by core-genome multilocus sequence typing. Nat. Commun. 2022, 13, 551. [Google Scholar] [CrossRef]
- Takami, S.; Hayashi, T.; Akashi, H.; Shimoyama, T.; Tamura, T. Genetic heterogeneity of Helicobacter pylori by pulse-field gel electrophoresis and re-evaluation of DNA homology. Eur. J. Gastroenterol. Hepatol. 1994, 6 (Suppl. 1), S53–S56. [Google Scholar]
- Maiden, M.C.; Bygraves, J.A.; Feil, E.; Morelli, G.; Russell, J.E.; Urwin, R.; Zhang, Q.; Zhou, J.; Zurth, K.; Caugant, D.A.; et al. Multilocus sequence typing: A portable approach to the identification of clones within populations of pathogenic microorganisms. Proc. Natl. Acad. Sci. USA 1998, 95, 3140–3145. [Google Scholar] [CrossRef] [PubMed]
- Wongphutorn, P.; Chomvarin, C.; Sripa, B.; Namwat, W.; Faksri, K. Detection and genotyping of Helicobacter pylori in saliva versus stool samples from asymptomatic individuals in Northeastern Thailand reveals intra-host tissue-specific H. pylori subtypes. BMC Microbiol. 2018, 18, 10. [Google Scholar] [CrossRef] [PubMed]
- Radaic, A.; Kapila, Y.L. The oralome and its dysbiosis; New insights into oral microbiome-host interactions. Comput. Struct. Biotechnol. J. 2021, 19, 1335–1360. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, S.; Harayama, S. PCR amplification and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl. Environ. Microbiol. 1995, 61, 1104–1109. [Google Scholar] [CrossRef]
- Clarridge, J.E., III. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin. Microbiol. Rev. 2004, 17, 840–862. [Google Scholar] [CrossRef]
- Mendoza-Elizalde, S.; Arteaga-Resendiz, N.K.; Valencia-Mayoral, P.; Luna, R.C.; Moreno-Espinosa, S.; Arenas-Huertero, F.; Zúñiga, G.; Velázquez-Guadarrama, N. Diversification of the vacAs1m1 and vacAs2m2 strains of Helicobacter pylori in Meriones unguiculatus. Front. Microbiol. 2016, 7, 1758. [Google Scholar] [CrossRef]
- Mendoza-Elizalde, S.; Cortés-Márquez, A.C.; Zuñiga, G.; Cerritos, R.; Valencia-Mayoral, P.; Sánchez, A.C.; Olivares-Clavijo, H.; Velázquez-Guadarrama, N. Inference from the analysis of genetic structure of Helicobacter pylori strains isolates from two paediatric patients with recurrent infection. BMC Microbiol. 2019, 19, 184. [Google Scholar] [CrossRef]
- Linz, B.; Windsor, H.M.; McGraw, J.J.; Hansen, L.M.; Gajewski, J.P.; Tomsho, L.P.; Hake, C.M.; Solnick, J.V.; Schuster, S.C.; Marshall, B.J. A mutation burst during the acute phase of Helicobacter pylori infection in humans and rhesus macaques. Nat. Commun. 2014, 5, 4165. [Google Scholar] [CrossRef]
- Raymond, J.; Thiberg, J.M.; Chevalier, C.; Kalach, N.; Bergeret, M.; Labigne, A.; Dauga, C. Genetic and transmission analysis of Helicobacter pylori strains within a family. Emerg. Infect. Dis. 2004, 10, 1816–1821. [Google Scholar] [CrossRef]
- Sheu, S.M.; Sheu, B.S.; Lu, C.C.; Yang, H.B.; Wu, J.J. Mixed infections of Helicobacter pylori: Tissue tropism and histological significance. Clin. Microbiol. Infect. 2009, 15, 253–259. [Google Scholar] [CrossRef] [PubMed]
- Palau, M.; Kulmann, M.; Ramírez-Lázaro, M.J.; Lario, S.; Quilez, M.E.; Campo, R.; Piqué, N.; Calvet, X.; Miñana-Galbis, D. Usefulness of housekeeping genes for the diagnosis of Helicobacter pylori infection, strain discrimination and detection of multiple infection. Helicobacter 2016, 21, 481–487. [Google Scholar] [CrossRef] [PubMed]
- Momtaz, H.; Souod, N.; Dabiri, H.; Sarshar, M. Study of Helicobacter pylori genotype status in saliva, dental plaques, stool and gastric biopsy samples. World J. Gastroenterol. 2012, 18, 2105–2111. [Google Scholar] [CrossRef] [PubMed]
- Cai, H.; Li, W.; Shu, X.; Peng, K.; Zhang, Y.; Jiang, M. Genetic variation of Helicobacter pylori in the oral cavity and stomach detected using thymine adenine cloning in children with chronic gastritis. Pediatr. Infect. Dis. J. 2014, 33, e1–e6. [Google Scholar] [CrossRef]
- Wang, J.; Chi, D.S.; Laffan, J.J.; Li, C.; Ferguson Jr, D.A.; Litchfield, P.; Thomas, E. Comparison of cytotoxin genotypes of Helicobacter pylori in stomach and saliva. Dig. Dis. Sci. 2002, 47, 1850–1856. [Google Scholar] [CrossRef]
- Zou, Q.-H.; Li, R.-Q. Helicobacter pylori in the oral cavity and gastric mucosa: A meta-analysis. J. Oral. Pathol. Med. 2011, 40, 317–324. [Google Scholar] [CrossRef]
Patient No. | Sex | Age | No. of Remaining Teeth | DMFT | Frequency of Oral Cleaning | Cleaning Aid | Smoker | GI Cancer | |||
---|---|---|---|---|---|---|---|---|---|---|---|
Location | Histological Type | Differentiation | Depth of Tumor Invasion (T-Category) | ||||||||
1 | F | 78 | 18 | 18 | 1 | − | − | Corpus | Adenocarcinoma | tub1 > tub2 | T1a |
2 | F | 66 | 28 | 11 | 3 | + | − | Corpus | Adenocarcinoma | tub1, tub2 | T1a |
3 | M | 66 | 15 | 22 | 2 | − | − | Corpus | Adenocarcinoma | tub1 | T1b2 |
4 | M | 76 | 24 | 18 | 3 | − | − | Corpus | Adenocarcinoma | tub1 | T1a |
5 | F | 67 | 8 | 28 | 2 | + | − | Corpus | Adenocarcinoma | tub1 | T1a |
6 | F | 75 | 29 | 24 | 2 | + | − | Corpus | Adenocarcinoma | tub1 | T1a |
7 | M | 81 | 13 | 24 | 1 | + | − | Antrum | Adenocarcinoma | tub1 > tub2 | T1a |
8 | M | 63 | 28 | 20 | 2 | − | + | Corpus | Adenocarcinoma | tub1 | T1a |
9 | M | 86 | 5 | 28 | 1 | − | − | Antrum | Adenocarcinoma | tub1 | T1a |
10 | M | 59 | 26 | 22 | 1 | − | + | Corpus | Adenocarcinoma | tub1 | T1a |
11 | M | 78 | 29 | 5 | 1 | − | − | Corpus | Adenocarcinoma | tub1 > tub2 | T1a |
12 | F | 77 | 24 | 13 | 2 | + | − | Corpus | Adenocarcinoma | tub1, tub2 | T1a |
13 | M | 81 | 26 | 9 | 2 | + | − | Antrum | Adenocarcinoma | tub1 | T1a |
14 | F | 84 | 28 | 11 | 2 | + | − | Corpus | Adenocarcinoma | tub1 | T1a |
15 | F | 70 | 25 | 17 | 2 | + | − | Corpus | Adenocarcinoma | Por2, sig | T1a |
16 | M | 66 | 30 | 9 | 2 | + | + | Corpus | Adenocarcinoma | tub1, tub2 | T1b1 |
17 | M | 76 | 14 | 21 | 1 | − | − | Corpus | Adenocarcinoma | tub1 > tub2 | T1a |
18 | M | 79 | 15 | 27 | 0 | − | − | Corpus | Adenocarcinoma | tub1 | T1a |
19 | M | 65 | 28 | 10 | 3 | + | − | Antrum | Adenocarcinoma | tub1, pap-tub1 > tub2 | T1b2 |
20 | M | 70 | 12 | 25 | 2 | − | − | Abdominal esophagus; Corpus | Squamous cell carcinoma; Adenocarcinoma | Mod; tub1 | T1b1 |
21 | M | 66 | 6 | 26 | 3 | − | + | Corpus | Adenocarcinoma | tub1, low grade | T1a |
Mean ± SD | 72.8 ± 7.6 | 20.5 ± 8.4 | 18.5 ± 7.2 | 1.8 ± 0.8 |
Patient No. | Upper Incisor | Lower Incisor | Upper Right Molar | Lower Left Molar | Saliva | Tongue | Gastric Tissue Biopsy | Gastric Tissue Culture |
---|---|---|---|---|---|---|---|---|
1 | + | + | − | − | − | − | + | + |
2 | + | − | − | − | − | + | + | + |
3 | − | − | + | − | − | − | + | + |
4 | + | − | − | − | − | − | + | + |
5 | + | − | − | − | − | − | + | + |
6 | − | − | + | − | − | + | + | + |
7 | − | + | − | − | − | + | + | + |
8 | + | − | − | − | − | − | + | + |
9 | + | − | + | − | - | − | + | + |
10 | + | − | − | − | + | − | + | + |
11 | − | − | − | − | − | + | + | + |
12 | + | − | − | − | − | − | + | + |
13 | + | − | − | − | + | − | + | + |
14 | + | − | + | − | − | + | + | + |
15 | + | + | − | − | + | − | + | + |
16 | + | − | − | − | − | + | + | + |
17 | + | − | − | + | − | − | + | + |
18 | + | − | − | − | − | − | + | + |
19 | + | − | + | − | − | − | + | + |
20 | − | + | − | − | − | − | + | + |
21 | − | − | − | − | + | − | + | + |
Prevalence (%) | 71.4 * | 19 | 23.8 | 4.8 | 19 | 28.6 | 100 | 100 |
n/N | 15/21 | 4/21 | 5/21 | 1/21 | 4/21 | 6/21 | 21/21 | 21/21 |
OR | 10.6 | 1 | 1.32 | 0.21 | 1 | 1.7 |
Participants No. | Housekeeping Gene | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
atpA | urel | efp | mutY | ppa | trpC | yphC | vacA | |||||||||
Oral | Gastric | Oral | Gastric | Oral | Gastric | Oral | Gastric | Oral | Gastric | Oral | Gastric | Oral | Gastric | Oral | Gastric | |
1 | - | NP | n/m | 3242 | - | NP | - | NP | - | NP | - | NP | 3504 | 3488 | - | NP |
2 | - | NP | n/m | 463 | 453 | n/m | - | NP | - | NP | - | NP | - | NP | - | NP |
3 | 2364 | 963 | 2643 | 2943 | 1162 | 2421 | 2368 | 2368 | 45 | 942 | 458 | 970 | 3556 | 3538 | 573 | 573 |
4 | - | NP | - | NP | - | NP | - | NP | - | NP | - | NP | - | NP | - | NP |
5 | - | NP | - | NP | - | NP | - | NP | n/m | 823 | - | NP | 3572 | 3542 | - | NP |
6 | - | NP | - | NP | - | NP | n/m | 2476 | - | NP | 970 | 423 | - | NP | - | NP |
7 | - | NP | n/m | 2647 | - | NP | - | NP | - | NP | - | NP | - | NP | - | NP |
8 | - | NP | n/m | 67 | - | NP | - | NP | 942 | 929 | - | NP | - | NP | - | NP |
9 | - | NP | 286 | 2856 | - | NP | - | NP | 849 | 45 | - | NP | - | NP | - | NP |
10 | 2364 | 1760 | n/m | 466 | - | NP | - | NP | - | NP | - | NP | 3513 | 457 | - | NP |
11 | - | NP | - | NP | - | NP | n/m | 2360 | 420 | 945 | - | NP | 3569 | 3515 | - | NP |
12 | - | NP | - | NP | - | NP | - | NP | 420 | 448 | - | NP | 3515 | 1962 | - | NP |
13 | 2003 | 958 | - | NP | - | NP | n/m | 2729 | - | NP | - | NP | - | NP | - | NP |
14 | - | NP | - | NP | - | NP | 935 | 38 | - | NP | - | NP | - | NP | - | NP |
15 | - | NP | - | NP | 453 | 1879 | 935 | 1907 | - | NP | - | NP | - | NP | 29 | 950 |
16 | 1760 | n/m | 3243 | 966 | - | NP | - | NP | - | NP | - | NP | 3538 | 3523 | - | NP |
17 | - | NP | n/m | 2471 | - | NP | 935 | 2450 | - | NP | - | NP | 3572 | 3572 | - | NP |
18 | - | NP | n/m | 466 | - | NP | 3162 | 935 | - | NP | - | NP | - | NP | - | NP |
19 | - | NP | n/m | 825 | - | NP | 935 | 1219 | - | NP | - | NP | - | NP | 785 | 618 |
20 | - | NP | - | NP | - | NP | - | NP | 1887 | 445 | - | NP | 3513 | 3543 | - | NP |
21 | - | NP | 738 | 971 | - | NP | - | NP | - | NP | - | NP | 3542 | 3542 | - | NP |
Patient No. | Specimen Type | Candidate MLST |
---|---|---|
1 | Oral | n/m |
Gastric tissue culture | 4001, 4023 | |
2 | Oral | 1160, 1473, 2830 |
Gastric tissue culture | 669, 1290 | |
3 | Oral | 2843 |
Gastric tissue culture | 1173, 1324, 1441, 2749, 2784, 2806, 2809, 2810, 2832, 2848, 3032, 3299, 3340, 3427, 3590, 3720, 3724, 3725, 3742 | |
5 | Oral | n/m |
Gastric tissue culture | 1502, 1741, 1836, 3572. | |
6 | Oral | 1173 |
Gastric tissue culture | 550, 2822, 2830, 3034, 3442, 3666 | |
7 | Oral | n/m |
Gastric tissue culture | 3035 | |
8 | Oral | 1324, 2749, 2806, 2832, 2848 |
Gastric tissue culture | 425, 660 | |
9 | Oral | 286, 1869 |
Gastric tissue culture | 45, 2836, 3302, 3339 | |
10 | Oral | 2843 |
Gastric tissue culture | 2753, 2754, 2755, 2810 | |
11 | Oral | 550, 2822, 2835, 2847 |
Gastric tissue culture | 1228, 2750, 2756, 2757, 2758, 2790, 2807, 2827 | |
12 | Oral | 550, 854, 2822, 2835, 2847 |
Gastric tissue culture | 52, 1064, 1154, 1661, 2081, 2115, 2218, 2257, 2835, 3325, 3333, 3348, 3371, 3453, 3459, 3700, 3701, 3702, 3722, 3733, 3734, 3997, 4003, 4051, 4070, 4083 | |
13 | Oral | 2207, 3351 |
Gastric tissue culture | 1228, 3206, 3331, 3347, 3351, 3352, 3370, 3376, 3429, 3436, 3464, 3466 | |
14 | Oral | 854 |
Gastric tissue culture | 38, 42 | |
15 | Oral | 854, 1160, 1473, 2830 |
Gastric tissue culture | 2123, 2258, 3332, 3335, 3414, 3422, 3436, 3442, 3478 | |
16 | Oral | 2226, 2753, 2754, 2755, 2816, 2817, 2841, 4001, 4023 |
Gastric tissue culture | 1324, 1474, 2795, 3660, 3995 | |
17 | Oral | 854 |
Gastric tissue culture | 2802, 2811, 2812 | |
18 | Oral | 3856 |
Gastric tissue culture | 854, 1160, 3328 | |
19 | Oral | 854 |
Gastric tissue culture | 770, 921, 3350, 3405, 3446 | |
20 | Oral | n/m |
Gastric tissue culture | 1473, 2761, 2799, 2816, 2830, 2841 | |
21 | Oral | 1349 |
Gastric tissue culture | 1042 |
Locus | PCR | Name | Primer * | Amplicon (bp) | Annealing (°C) | Reference |
---|---|---|---|---|---|---|
atpA | First | atpA_for2 | GGACTAGCGTTAAACGCACG | 840 | 57 | MLST website |
atpA_rev2 | CTTGAAACCGACAAGCCCAC | MLST website | ||||
Second | atpA_for3 | GTTCCTGTTGGCGATGCGGT | 766 | 57 | MLST website | |
atpA_rev3 | CCTGAATAAAACAAATCCGTTTC | MLST website | ||||
urel | First, second | urelfor | AGGTTATTCGTAAGGTGCG | MLST website | ||
First | urel-rev3 | GAAATCCAAGGGGTTTAAATC | 695 | 57 | MLST website | |
Second | urel-rev2 | GTTTAAATCCCTTAGATTGCC | 683 | 57 | MLST website | |
efp | First | efp_for1 | GGCAATTTGGATGAGCGAGCTC | 558 | 57 | MLST website |
efp_rev1 | CTTCACCTTTTCAAGATACTC | MLST website | ||||
Second | efp_for2 | GGGCTTGAAAATTGAATTGGGCGG | 500 | 57 | MLST website | |
efp_rev2 | GTATTGACTTTAATGATCTCACCC | MLST website | ||||
mutY | First | mutY_for4 | TTATGAAGTCTCTATATCAGCGAAGT | 529 | 54 | MLST website |
mutY_rev4 | TACCTAAACAATAAGGATTGAAAGG | MLST website | ||||
Second | mutY_for5 | ATATCAGYGAAGTGATGAGC | 516 | 50 | MLST website | |
mutY_rev5 | CCYAAACAATAAGGRTTKGAA | MLST website | ||||
ppa | First | ppa_for1-1 | GAARTKAGCCATGACGCTRA | 698 | 54 | MLST website |
ppa_rev4 | GGGTTAARATCGTTAAATTGTAG | MLST website | ||||
Second | ppa_for1-2 | AGCCATGACGCTRAKYCTTT | 490 | 54 | Osaki et al. (2013) [25] | |
ppa_rev1-2 | CTCTTTGTTTTCAAACCCCTTG | Osaki et al. (2013) [25] | ||||
trpC | First | trpC_for8 | AGCATCGCCCTCTAAAGGTT | 618 | 57 | Osaki et al. (2013) [25] |
trpC_rev6 | AAGCCCGCACACTTTATTTTC | Osaki et al. (2013) [25] | ||||
Second | trpC_for9 | TCGCCCTCYAAAGGTTTRAT | 564 | 57 | Osaki et al. (2013) [25] | |
trpC_rev9 | TCAAATCCTTTTCTTTCATYA | Osaki et al. (2013) [25] | ||||
yphC | First | yphC_for2 | CACGCCTATTTTTTTGACTAAAAAC | 734 | 54 | MLST website |
yphC_rev3 | CATTYACCCTCCCAATGATGC | MLST website | ||||
Scond | yphC-for3 | GACCCTTATTTAAGCTTTAAATAAC | 688 | 54 | MLST website | |
yphC-rev3 | CCCAATGATGCCTACTTGAAT | MLST website | ||||
vacA | First | HPVacA1-4 | ATACGCTCCCACGTATTGC | 695 | 57 | Osaki et al. (2013) [25] |
OLHPVacA-3(+) | ACAACCGTGATCATTCCAGC | Osaki et al. (2013) [25] | ||||
Second | VacA-for2 | CTGCTGTAGGAACGGTCTC | 575 | 57 | Osaki et al. (2013) [25] | |
VacA-rev2 | GCGTGGCGCCATCATAAAGAG | Osaki et al. (2013) [25] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nagata, R.; Sato, H.; Takenaka, S.; Yokoyama, J.; Terai, S.; Mimuro, H.; Noiri, Y. Analysis of Genetic Relatedness between Gastric and Oral Helicobacter pylori in Patients with Early Gastric Cancer Using Multilocus Sequence Typing. Int. J. Mol. Sci. 2023, 24, 2211. https://doi.org/10.3390/ijms24032211
Nagata R, Sato H, Takenaka S, Yokoyama J, Terai S, Mimuro H, Noiri Y. Analysis of Genetic Relatedness between Gastric and Oral Helicobacter pylori in Patients with Early Gastric Cancer Using Multilocus Sequence Typing. International Journal of Molecular Sciences. 2023; 24(3):2211. https://doi.org/10.3390/ijms24032211
Chicago/Turabian StyleNagata, Ryoko, Hiroki Sato, Shoji Takenaka, Junji Yokoyama, Shuji Terai, Hitomi Mimuro, and Yuichiro Noiri. 2023. "Analysis of Genetic Relatedness between Gastric and Oral Helicobacter pylori in Patients with Early Gastric Cancer Using Multilocus Sequence Typing" International Journal of Molecular Sciences 24, no. 3: 2211. https://doi.org/10.3390/ijms24032211
APA StyleNagata, R., Sato, H., Takenaka, S., Yokoyama, J., Terai, S., Mimuro, H., & Noiri, Y. (2023). Analysis of Genetic Relatedness between Gastric and Oral Helicobacter pylori in Patients with Early Gastric Cancer Using Multilocus Sequence Typing. International Journal of Molecular Sciences, 24(3), 2211. https://doi.org/10.3390/ijms24032211