Nuclear α-Synuclein-Derived Cytotoxic Effect via Altered Ribosomal RNA Processing in Primary Mouse Embryonic Fibroblasts
Abstract
1. Introduction
2. Results
2.1. Nuclear αSyn Increases Cytotoxicity Via Oxidative Stress
2.2. Nuclear αSyn Promotes Apoptosis Via Abnormal rRNA Processing
2.3. The Control of NCL Levels Is Critical for the Clearance of αSyn
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Transfection
4.2. Measurement of Cytotoxicity
4.3. Analysis of Hydrogen Peroxide (H2O2) Level
4.4. Immunofluorescence Staining
4.5. Western Blot Analysis
4.6. mRNA Isolation and cDNA Synthesis
4.7. DNA Gel Electrophoresis
4.8. Quantitative PCR (qPCR)
4.9. Sandwich Enzyme-Linked Immunosorbent Assay (ELISA)
4.10. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sawada, H.; Kohno, R.; Kihara, T.; Izumi, Y.; Sakka, N.; Ibi, M.; Nakanishi, M.; Nakamizo, T.; Yamakawa, K.; Shibasaki, H.; et al. Proteasome mediates dopaminergic neuronal degeneration, and its inhibition causes alpha-synuclein inclusions. J. Biol. Chem. 2004, 279, 10710–10719. [Google Scholar] [CrossRef] [PubMed]
- Dionísio, P.A.; Amaral, J.D.; Rodrigues, C.M.P. Oxidative stress and regulated cell death in Parkinson’s disease. Ageing Res. Rev. 2021, 67, 101263. [Google Scholar] [CrossRef] [PubMed]
- Nagley, P.; Higgins, G.C.; Atkin, J.D.; Beart, P.M. Multifaceted deaths orchestrated by mitochondria in neurones. Biochim. Biophys. Acta 2010, 1802, 167–185. [Google Scholar] [CrossRef] [PubMed]
- Surguchov, A. Biomarkers in Parkinson’s Disease. In Neurodegenerative Diseases Biomarkers: Towards Translating Research to Clinical Practice; Peplow, P.V., Martinez, B., Gennarelli, T.A., Eds.; Springer: New York, NY, USA, 2022; pp. 155–180. [Google Scholar]
- El-Agnaf, O.M.; Jakes, R.; Curran, M.D.; Middleton, D.; Ingenito, R.; Bianchi, E.; Pessi, A.; Neill, D.; Wallace, A. Aggregates from mutant and wild-type alpha-synuclein proteins and NAC peptide induce apoptotic cell death in human neuroblastoma cells by formation of beta-sheet and amyloid-like filaments. FEBS Lett. 1998, 440, 71–75. [Google Scholar] [CrossRef]
- Koss, D.J.; Erskine, D.; Porter, A.; Palmoski, P.; Menon, H.; Todd, O.G.J.; Leite, M.; Attems, J.; Outeiro, T.F. Nuclear alpha-synuclein is present in the human brain and is modified in dementia with Lewy bodies. Acta Neuropathol. Commun. 2022, 10, 98. [Google Scholar] [CrossRef]
- Rousseaux, M.W.; de Haro, M.; Lasagna-Reeves, C.A.; De Maio, A.; Park, J.; Jafar-Nejad, P.; Al-Ramahi, I.; Sharma, A.; See, L.; Lu, N.; et al. TRIM28 regulates the nuclear accumulation and toxicity of both alpha-synuclein and tau. eLife 2016, 5, e19809. [Google Scholar] [CrossRef]
- Weston, L.J.; Bowman, A.M.; Osterberg, V.R.; Meshul, C.K.; Woltjer, R.L.; Unni, V.K. Aggregated Alpha-Synuclein Inclusions within the Nucleus Predict Impending Neuronal Cell Death in a Mouse Model of Parkinsonism. Int. J. Mol. Sci. 2022, 23, 15294. [Google Scholar] [CrossRef]
- Pieger, K.; Schmitt, V.; Gauer, C.; Gießl, N.; Prots, I.; Winner, B.; Winkler, J.; Brandstätter, J.H.; Xiang, W. Translocation of Distinct Alpha Synuclein Species from the Nucleus to Neuronal Processes during Neuronal Differentiation. Biomolecules 2022, 12, 1108. [Google Scholar] [CrossRef]
- Ho, D.H.; Nam, D.; Jeong, S.; Seo, M.K.; Park, S.W.; Seol, W.; Son, I. Expression of transduced nucleolin promotes the clearance of accumulated α-synuclein in rodent cells and animal model. Neurobiol. Dis. 2021, 154, 105349. [Google Scholar] [CrossRef]
- Mogi, M.; Kondo, T.; Mizuno, Y.; Nagatsu, T. p53 protein, interferon-gamma, and NF-kappaB levels are elevated in the parkinsonian brain. Neurosci. Lett. 2007, 414, 94–97. [Google Scholar] [CrossRef]
- Qi, X.; Davis, B.; Chiang, Y.-H.; Filichia, E.; Barnett, A.; Greig, N.H.; Hoffer, B.; Luo, Y. Dopaminergic neuron-specific deletion of p53 gene is neuroprotective in an experimental Parkinson’s disease model. J. Neurochem. 2016, 138, 746–757. [Google Scholar] [CrossRef] [PubMed]
- He, Z.Q.; Huan, P.F.; Wang, L.; He, J.C. Paeoniflorin ameliorates cognitive impairment in Parkinson’s disease via JNK/p53 signaling. Metab. Brain Dis. 2022, 37, 1057–1070. [Google Scholar] [CrossRef] [PubMed]
- Shcherbik, N.; Pestov, D.G. The Impact of Oxidative Stress on Ribosomes: From Injury to Regulation. Cells 2019, 8, 1379. [Google Scholar] [CrossRef]
- Szaflarski, W.; Leśniczak-Staszak, M.; Sowiński, M.; Ojha, S.; Aulas, A.; Dave, D.; Malla, S.; Anderson, P.; Ivanov, P.; Lyons, S.M. Early rRNA processing is a stress-dependent regulatory event whose inhibition maintains nucleolar integrity. Nucleic Acids Res. 2022, 50, 1033–1051. [Google Scholar] [CrossRef]
- Daniely, Y.; Dimitrova, D.D.; Borowiec, J.A. Stress-dependent nucleolin mobilization mediated by p53-nucleolin complex formation. Mol. Cell. Biol. 2002, 22, 6014–6022. [Google Scholar] [CrossRef] [PubMed]
- Pakrashi, S.; Chakraborty, J.; Bandyopadhyay, J. Neuroprotective Role of Quercetin on Rotenone-Induced Toxicity in SH-SY5Y Cell Line Through Modulation of Apoptotic and Autophagic Pathways. Neurochem. Res. 2020, 45, 1962–1973. [Google Scholar] [CrossRef] [PubMed]
- Su, H.; Kodiha, M.; Lee, S.; Stochaj, U. Identification of Novel Markers That Demarcate the Nucleolus during Severe Stress and Chemotherapeutic Treatment. PLoS ONE 2013, 8, e80237. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Stedman, A.; Beck-Cormier, S.; Le Bouteiller, M.; Raveux, A.; Vandormael-Pournin, S.; Coqueran, S.; Lejour, V.; Jarzebowski, L.; Toledo, F.; Robine, S.; et al. Ribosome biogenesis dysfunction leads to p53-mediated apoptosis and goblet cell differentiation of mouse intestinal stem/progenitor cells. Cell Death Differ. 2015, 22, 1865–1876. [Google Scholar] [CrossRef] [PubMed]
- Teixeira, M.; Sheta, R.; Idi, W.; Oueslati, A. Alpha-Synuclein and the Endolysosomal System in Parkinson’s Disease: Guilty by Association. Biomolecules 2021, 11, 1333. [Google Scholar] [CrossRef]
- Vidyadhara, D.J.; Lee, J.E.; Chandra, S.S. Role of the endolysosomal system in Parkinson’s disease. J. Neurochem. 2019, 150, 487–506. [Google Scholar] [CrossRef]
- Sepúlveda, D.; Cisternas-Olmedo, M.; Arcos, J.; Nassif, M.; Vidal, R.L. Contribution of Autophagy-Lysosomal Pathway in the Exosomal Secretion of Alpha-Synuclein and Its Impact in the Progression of Parkinson’s Disease. Front. Mol. Neurosci. 2022, 15, 805087. [Google Scholar] [CrossRef]
- Ho, D.H.; Nam, D.; Seo, M.; Park, S.W.; Seol, W.; Son, I. LRRK2 Inhibition Mitigates the Neuroinflammation Caused by TLR2-Specific α-Synuclein and Alleviates Neuroinflammation-Derived Dopaminergic Neuronal Loss. Cells 2022, 11, 861. [Google Scholar] [CrossRef] [PubMed]
- Danzer, K.M.; Kranich, L.R.; Ruf, W.P.; Cagsal-Getkin, O.; Winslow, A.R.; Zhu, L.; Vanderburg, C.R.; McLean, P.J. Exosomal cell-to-cell transmission of alpha synuclein oligomers. Mol. Neurodegener. 2012, 7, 42. [Google Scholar] [CrossRef] [PubMed]
- Fremerey, J.; Morozov, P.; Meyer, C.; Garzia, A.; Teplova, M.; Tuschl, T.; Borkhardt, A. Nucleolin Controls Ribosome Biogenesis through Its RNA-Binding Properties. Blood 2016, 128, 5056. [Google Scholar] [CrossRef]
- Ginisty, H.; Amalric, F.; Bouvet, P. Nucleolin functions in the first step of ribosomal RNA processing. EMBO J. 1998, 17, 1476–1486. [Google Scholar] [CrossRef]
- Ugrinova, I.; Monier, K.; Ivaldi, C.; Thiry, M.; Storck, S.; Mongelard, F.; Bouvet, P. Inactivation of nucleolin leads to nucleolar disruption, cell cycle arrest and defects in centrosome duplication. BMC Mol. Biol. 2007, 8, 66. [Google Scholar] [CrossRef]
- Caudle, W.M.; Kitsou, E.; Li, J.; Bradner, J.; Zhang, J. A role for a novel protein, nucleolin, in Parkinson’s disease. Neurosci. Lett. 2009, 459, 11–15. [Google Scholar] [CrossRef]
- Jin, J.; Li, G.J.; Davis, J.; Zhu, D.; Wang, Y.; Pan, C.; Zhang, J. Identification of Novel Proteins Associated with Both α-Synuclein and DJ-1. Mol. Cell. Proteom. 2007, 6, 845–859. [Google Scholar] [CrossRef]
- Haeusler, A.R.; Donnelly, C.J.; Periz, G.; Simko, E.A.; Shaw, P.G.; Kim, M.S.; Maragakis, N.J.; Troncoso, J.C.; Pandey, A.; Sattler, R.; et al. C9orf72 nucleotide repeat structures initiate molecular cascades of disease. Nature 2014, 507, 195–200. [Google Scholar] [CrossRef]
- Aladesuyi Arogundade, O.; Nguyen, S.; Leung, R.; Wainio, D.; Rodriguez, M.; Ravits, J. Nucleolar stress in C9orf72 and sporadic ALS spinal motor neurons precedes TDP-43 mislocalization. Acta Neuropathol. Commun. 2021, 9, 26. [Google Scholar] [CrossRef]
- Kim, J.W.; Yin, X.; Martin, I.; Xiong, Y.; Eacker, S.M.; Ingolia, N.T.; Dawson, T.M.; Dawson, V.L. Dysregulated mRNA Translation in the G2019S LRRK2 and LRRK2 Knock-Out Mouse Brains. Eneuro 2021, 8, ENEURO.0310-21.2021. [Google Scholar] [CrossRef]
- Martin, I.; Kim, J.W.; Lee, B.D.; Kang, H.C.; Xu, J.C.; Jia, H.; Stankowski, J.; Kim, M.S.; Zhong, J.; Kumar, M.; et al. Ribosomal protein s15 phosphorylation mediates LRRK2 neurodegeneration in Parkinson’s disease. Cell 2014, 157, 472–485. [Google Scholar] [CrossRef] [PubMed]
- Repici, M.; Hassanjani, M.; Maddison, D.C.; Garção, P.; Cimini, S.; Patel, B.; Szegö, E.M.; Straatman, K.R.; Lilley, K.S.; Borsello, T.; et al. The Parkinson’s Disease-Linked Protein DJ-1 Associates with Cytoplasmic mRNP Granules During Stress and Neurodegeneration. Mol. Neurobiol. 2019, 56, 61–77. [Google Scholar] [CrossRef] [PubMed]
- Díaz-Muñoz, M.D.; Kiselev, V.Y.; Le Novère, N.; Curk, T.; Ule, J.; Turner, M. Tia1 dependent regulation of mRNA subcellular location and translation controls p53 expression in B cells. Nat. Commun. 2017, 8, 530. [Google Scholar] [CrossRef] [PubMed]
- Le Goff, S.; Boussaid, I.; Floquet, C.; Raimbault, A.; Hatin, I.; Andrieu-Soler, C.; Salma, M.; Leduc, M.; Gautier, E.-F.; Guyot, B.; et al. p53 activation during ribosome biogenesis regulates normal erythroid differentiation. Blood 2021, 137, 89–102. [Google Scholar] [CrossRef]
- Ho, D.H.; Kim, H.; Kim, J.; Sim, H.; Ahn, H.; Kim, J.; Seo, H.; Chung, K.C.; Park, B.J.; Son, I.; et al. Leucine-Rich Repeat Kinase 2 (LRRK2) phosphorylates p53 and induces p21(WAF1/CIP1) expression. Mol. Brain 2015, 8, 54. [Google Scholar] [CrossRef]
- Hallacli, E.; Kayatekin, C.; Nazeen, S.; Wang, X.H.; Sheinkopf, Z.; Sathyakumar, S.; Sarkar, S.; Jiang, X.; Dong, X.; Di Maio, R.; et al. The Parkinson’s disease protein alpha-synuclein is a modulator of processing bodies and mRNA stability. Cell 2022, 185, 2035–2056. [Google Scholar] [CrossRef]
- Deckert, A.; Waudby, C.A.; Wlodarski, T.; Wentink, A.S.; Wang, X.; Kirkpatrick, J.P.; Paton, J.F.S.; Camilloni, C.; Kukic, P.; Dobson, C.M.; et al. Structural characterization of the interaction of α-synuclein nascent chains with the ribosomal surface and trigger factor. Proc. Natl. Acad. Sci. USA 2016, 113, 5012–5017. [Google Scholar] [CrossRef]
- Popova, B.; Wang, D.; Pätz, C.; Akkermann, D.; Lázaro, D.F.; Galka, D.; Kolog Gulko, M.; Bohnsack, M.T.; Möbius, W.; Bohnsack, K.E.; et al. DEAD-box RNA helicase Dbp4/DDX10 is an enhancer of α-synuclein toxicity and oligomerization. PLoS Genet. 2021, 17, e1009407. [Google Scholar] [CrossRef]
- Wang, S.A.; Li, H.Y.; Hsu, T.I.; Chen, S.H.; Wu, C.J.; Chang, W.C.; Hung, J.J. Heat shock protein 90 stabilizes nucleolin to increase mRNA stability in mitosis. J. Biol. Chem. 2011, 286, 43816–43829. [Google Scholar] [CrossRef]
DNA Plasmid | Origin | Abbreviation |
---|---|---|
pcDNA 3.1 | - | Vector |
Flag-tagged wild-type αSyn | Human | WT |
Flag-tagged wild-type αSyn conjugated with nuclear export signal | Human | NES |
Flag-tagged wild-type αSyn conjugated with nuclear localization signal | Human | NLS |
Short hairpin RNA for green fluorescent protein | - | shGFP |
Short hairpin RNA for nucleolin | - | shNCL |
Green fluorescent protein | - | GFP |
Nucleolin conjugated with green fluorescent protein | Human | GFP-NCL |
Genes | Sequence (5′–3′) | Annealing Temp (°C) | |
---|---|---|---|
Flag tag | Forward | TACAAGGATGACGATGACAAGCTT | 54 |
Human αSyn | Reverse | GGCTTCAGGTTCGTAGTCTTG | |
28S rRNA | Forward | GGAAACTCTGGTGGAGGTCC | |
28S rRNA | Reverse | CCTTAGCGGATTCCGACTTC | |
18S rRNA | Forward | CTTAGAGGGACAAGTGGCG | |
18S rRNA | Reverse | ACGCTGAGCCAGTCAGTGTA | |
GAPDH | Forward | ACACTGAGGACCAGGTTGTC | |
GAPDH | Reverse | TCCACCACCCTGTTGCTGTAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ho, D.H.; Kim, H.; Nam, D.; Heo, J.; Son, I. Nuclear α-Synuclein-Derived Cytotoxic Effect via Altered Ribosomal RNA Processing in Primary Mouse Embryonic Fibroblasts. Int. J. Mol. Sci. 2023, 24, 2132. https://doi.org/10.3390/ijms24032132
Ho DH, Kim H, Nam D, Heo J, Son I. Nuclear α-Synuclein-Derived Cytotoxic Effect via Altered Ribosomal RNA Processing in Primary Mouse Embryonic Fibroblasts. International Journal of Molecular Sciences. 2023; 24(3):2132. https://doi.org/10.3390/ijms24032132
Chicago/Turabian StyleHo, Dong Hwan, Hyejung Kim, Daleum Nam, Jinju Heo, and Ilhong Son. 2023. "Nuclear α-Synuclein-Derived Cytotoxic Effect via Altered Ribosomal RNA Processing in Primary Mouse Embryonic Fibroblasts" International Journal of Molecular Sciences 24, no. 3: 2132. https://doi.org/10.3390/ijms24032132
APA StyleHo, D. H., Kim, H., Nam, D., Heo, J., & Son, I. (2023). Nuclear α-Synuclein-Derived Cytotoxic Effect via Altered Ribosomal RNA Processing in Primary Mouse Embryonic Fibroblasts. International Journal of Molecular Sciences, 24(3), 2132. https://doi.org/10.3390/ijms24032132