Asymmetries of Left and Right Adrenal Glands in Neural Innervation and Glucocorticoids Production
Abstract
1. Introduction
2. Results
2.1. Morphology and Histology of Left and Right Adrenal Glands in Mice
2.2. Comparison of the Major Markers of Adrenal Zones and the Subcellular Structure in the Left and Right Adrenal Glands
2.3. Differentially Expressed Genes (DEGs) in the Left and Right Adrenal Glands
2.3.1. DEGs Involved in the Capability of Glucocorticoid Production
2.3.2. DEGs Involved in Protein Synthesis and Energy Expenditure
2.3.3. DEGs Involved in Different Neural Innervation and Adrenal Regeneration
2.3.4. Construction of the ceRNA Network and Hub miRNA Identification
3. Discussion
4. Materials and Methods
4.1. Animal Experiment
4.2. Adrenal Gland Histology and Oil Red O Staining
4.3. Transmission Electron Microscopy (TEM) and Immunohistochemistry
4.4. RNA Extraction and RNA Sequencing Analysis
4.5. Functional Analysis and PPI Network Establishment
4.6. Construction of the ceRNA Regulatory Network
4.7. RT-qPCR
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gerendai, I.; Halasz, B. Neuroendocrine asymmetry. Front. Neuroendocrinol. 1997, 18, 354–381. [Google Scholar] [CrossRef]
- Gallo-Payet, N.; Battista, M.C. Steroidogenesis-adrenal cell signal transduction. Compr. Physiol. 2014, 4, 889–964. [Google Scholar] [CrossRef] [PubMed]
- Ehrhart-Bornstein, M.; Bornstein, S.R. Cross-talk between adrenal medulla and adrenal cortex in stress. Ann. N. Y. Acad. Sci. 2008, 1148, 112–117. [Google Scholar] [CrossRef] [PubMed]
- Delarue, C.; Contesse, V.; Lenglet, S.; Sicard, F.; Perraudin, V.; Lefebvre, H.; Kodjo, M.; Leboulenger, F.; Yon, L.; Gallo-Payet, N.; et al. Role of neurotransmitters and neuropeptides in the regulation of the adrenal cortex. Rev. Endocr. Metab. Disord. 2001, 2, 253–267. [Google Scholar] [CrossRef] [PubMed]
- Gerendai, I.; Toth, I.E.; Boldogkoi, Z.; Halasz, B. Recent findings on the organization of central nervous system structures involved in the innervation of endocrine glands and other organs; observations obtained by the transneuronal viral double-labeling technique. Endocrine 2009, 36, 179–188. [Google Scholar] [CrossRef] [PubMed]
- Gerendai, I.; Halasz, B. Asymmetry of the neuroendocrine system. News Physiol. Sci. 2001, 16, 92–95. [Google Scholar] [CrossRef] [PubMed]
- Mizunuma, H.; DePalatis, L.R.; McCann, S.M. Effect of unilateral orchidectomy on plasma FSH concentration: Evidence for a direct neural connection between testes and CNS. Neuroendocrinology 1983, 37, 291–296. [Google Scholar] [CrossRef] [PubMed]
- Frankel, A.I.; Chapman, J.C.; Cook, B. Testes are asymmetric in the testicular hemicastration response of the male rat. J. Endocrinol. 1989, 122, 485–488. [Google Scholar] [CrossRef]
- Gerendai, I.; Rotsztejn, W.; Marchetti, B.; Kordon, C.; Scapagnini, U. Unilateral ovariectomy-induced luteinizing hormone-releasing hormone content changes in the two halves of the mediobasal hypothalamus. Neurosci. Lett. 1978, 9, 333–336. [Google Scholar] [CrossRef]
- Gerendi, I.; Kiss, J.; Molmar, J.; Halasz, B. Further data on the existance of a neural pathway from the adrenal gland to the hypothalamus. Cell Tissue Res. 1974, 153, 559–564. [Google Scholar] [CrossRef]
- Holzwarth, M.A.; Dallman, M.F. The effect of hypothalamic hemi-islands on compensatory adrenal growth. Brain Res. 1979, 162, 33–43. [Google Scholar] [CrossRef] [PubMed]
- Toth, I.E.; Wiesel, O.; Toth, D.E.; Boldogkoi, Z.; Halasz, B.; Gerendai, I. Transneuronal retrograde viral labeling in the brain stem and hypothalamus is more intense from the left than from the right adrenal gland. Microsc. Res. Tech. 2008, 71, 503–509. [Google Scholar] [CrossRef] [PubMed]
- Szigethy, E.; Conwell, Y.; Forbes, N.T.; Cox, C.; Caine, E.D. Adrenal weight and morphology in victims of completed suicide. Biol. Psychiatry 1994, 36, 374–380. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, R.M.; Gratton, A. Lateralized effects of medial prefrontal cortex lesions on neuroendocrine and autonomic stress responses in rats. J. Neurosci. 1999, 19, 2834–2840. [Google Scholar] [CrossRef] [PubMed]
- Wada, N.; Shibayama, Y.; Yoneda, T.; Katabami, T.; Kurihara, I.; Tsuiki, M.; Ichijo, T.; Ogawa, Y.; Kawashima, J.; Sone, M.; et al. Lateralizing Asymmetry of Adrenal Imaging and Adrenal Vein Sampling in Patients With Primary Aldosteronism. J. Endocr. Soc. 2019, 3, 1393–1402. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, C.C.; Trichopoulos, D. Breast size, handedness and breast cancer risk. Eur. J. Cancer 1991, 27, 131–135. [Google Scholar] [CrossRef]
- Barbara, R.C.; Piotr, R.; Kornel, B.; Elzbieta, Z.; Danuta, R.; Eduardo, N. Divergent Impact of Breast Cancer Laterality on Clinicopathological, Angiogenic, and Hemostatic Profiles: A Potential Role of Tumor Localization in Future Outcomes. J. Clin. Med. 2020, 9, 1708. [Google Scholar] [CrossRef]
- Caspary, T.; Garcia-Garcia, M.J.; Huangfu, D.; Eggenschwiler, J.T.; Wyler, M.R.; Rakeman, A.S.; Alcorn, H.L.; Anderson, K.V. Mouse Dispatched homolog1 is required for long-range, but not juxtacrine, Hh signaling. Curr. Biol. 2002, 12, 1628–1632. [Google Scholar] [CrossRef]
- Tian, H.; Jeong, J.; Harfe, B.D.; Tabin, C.J.; McMahon, A.P. Mouse Disp1 is required in sonic hedgehog-expressing cells for paracrine activity of the cholesterol-modified ligand. Development 2005, 132, 133–142. [Google Scholar] [CrossRef]
- Timmermans, S.; Souffriau, J.; Libert, C. A General Introduction to Glucocorticoid Biology. Front. Immunol. 2019, 10, 1545. [Google Scholar] [CrossRef]
- Banegas, I.; Prieto, I.; Vives, F.; Alba, F.; Duran, R.; Segarra, A.B.; de Gasparo, M.; Ramirez, M. Plasma aminopeptidase activities in rats after left and right intrastriatal administration of 6-hydroxydopamine. Neuroendocrinology 2004, 80, 219–224. [Google Scholar] [CrossRef] [PubMed]
- Nakayama, T.; Imai, S.; Soma, M.; Izumi, Y.; Kanmatsuse, K. Compensatory adrenal growth and steroidogenesis after unilateral adrenalectomy. Endocr. J. 1993, 40, 523–527. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Dallman, M.F.; Engeland, W.C.; Shinsako, J. Compensatory adrenal growth: A neurally mediated reflex. Am. J. Physiol. 1976, 231, 408–414. [Google Scholar] [CrossRef] [PubMed]
- Ulrich-Lai, Y.M.; Engeland, W.C. Hyperinnervation during adrenal regeneration influences the rate of functional recovery. Neuroendocrinology 2000, 71, 107–123. [Google Scholar] [CrossRef] [PubMed]
- Ulrich-Lai, Y.M.; Arnhold, M.M.; Engeland, W.C. Adrenal splanchnic innervation contributes to the diurnal rhythm of plasma corticosterone in rats by modulating adrenal sensitivity to ACTH. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2006, 290, R1128–R1135. [Google Scholar] [CrossRef] [PubMed]
- Echelard, Y.; Epstein, D.J.; St-Jacques, B.; Shen, L.; Mohler, J.; McMahon, J.A.; McMahon, A.P. Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 1993, 75, 1417–1430. [Google Scholar] [CrossRef]
- King, P.; Paul, A.; Laufer, E. Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages. Proc. Natl. Acad. Sci. USA 2009, 106, 21185–21190. [Google Scholar] [CrossRef]
- Ching, S.; Vilain, E. Targeted disruption of Sonic Hedgehog in the mouse adrenal leads to adrenocortical hypoplasia. Genesis 2009, 47, 628–637. [Google Scholar] [CrossRef]
- Huang, C.C.; Miyagawa, S.; Matsumaru, D.; Parker, K.L.; Yao, H.H. Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog. Endocrinology 2010, 151, 1119–1128. [Google Scholar] [CrossRef]
- Roychoudhuri, R.; Putcha, V.; Moller, H. Cancer and laterality: A study of the five major paired organs (UK). Cancer Causes Control 2006, 17, 655–662. [Google Scholar] [CrossRef]
- Tsukui, T.; Capdevila, J.; Tamura, K.; Ruiz-Lozano, P.; Rodriguez-Esteban, C.; Yonei-Tamura, S.; Magallon, J.; Chandraratna, R.A.; Chien, K.; Blumberg, B.; et al. Multiple left-right asymmetry defects in Shh(-/-) mutant mice unveil a convergence of the shh and retinoic acid pathways in the control of Lefty-1. Proc. Natl. Acad. Sci. USA 1999, 96, 11376–11381. [Google Scholar] [CrossRef] [PubMed]
- Komatsu, Y.; Mishina, Y. Establishment of left-right asymmetry in vertebrate development: The node in mouse embryos. Cell. Mol. Life Sci. 2013, 70, 4659–4666. [Google Scholar] [CrossRef] [PubMed]
- Ryan, A.K.; Blumberg, B.; Rodriguez-Esteban, C.; Yonei-Tamura, S.; Tamura, K.; Tsukui, T.; de la Pena, J.; Sabbagh, W.; Greenwald, J.; Choe, S.; et al. Pitx2 determines left-right asymmetry of internal organs in vertebrates. Nature 1998, 394, 545–551. [Google Scholar] [CrossRef] [PubMed]
- Robichaux, J.P.; Hallett, R.M.; Fuseler, J.W.; Hassell, J.A.; Ramsdell, A.F. Mammary glands exhibit molecular laterality and undergo left-right asymmetric ductal epithelial growth in MMTV-cNeu mice. Oncogene 2015, 34, 2003–2010. [Google Scholar] [CrossRef] [PubMed]
- Delahunt, B.; Bethwaite, P.; Nacey, J.N. Renal cell carcinoma in New Zealand: A national survival study. Urology 1994, 43, 300–309. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.; Yao, K.; He, X.; Wu, S.; Ye, Y.; Chen, J.; Wu, C.L. Prognostic significance of laterality in renal cell carcinoma: A population-based study from the surveillance, epidemiology, and end results (SEER) database. Cancer Med. 2019, 8, 5629–5637. [Google Scholar] [CrossRef] [PubMed]
- Yamada, Y.; Mabuchi, S.; Kawahara, N.; Kawaguchi, R. Prognostic significance of tumor laterality in advanced ovarian cancer. Obstet. Gynecol. Sci. 2021, 64, 524–531. [Google Scholar] [CrossRef]
- Abdou, Y.; Gupta, M.; Asaoka, M.; Attwood, K.; Mateusz, O.; Gandhi, S.; Takabe, K. Left sided breast cancer is associated with aggressive biology and worse outcomes than right sided breast cancer. Sci. Rep. 2022, 12, 13377. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Pihlajoki, M.; Dorner, J.; Cochran, R.S.; Heikinheimo, M.; Wilson, D.B. Adrenocortical zonation, renewal, and remodeling. Front. Endocrinol. 2015, 6, 27. [Google Scholar] [CrossRef]
- Menzies, R.I.; Zhao, X.; Mullins, L.J.; Mullins, J.J.; Cairns, C.; Wrobel, N.; Dunbar, D.R.; Bailey, M.A.; Kenyon, C.J. Transcription controls growth, cell kinetics and cholesterol supply to sustain ACTH responses. Endocr. Connect. 2017, 6, 446–457. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [PubMed]
- Trapnell, C.; Hendrickson, D.G.; Sauvageau, M.; Goff, L.; Rinn, J.L.; Pachter, L. Differential analysis of gene regulation at transcript resolution with RNA-seq. Nat. Biotechnol. 2013, 31, 46–53. [Google Scholar] [CrossRef]
- Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.Y.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef] [PubMed]
- Jiao, X.; Sherman, B.T.; Huang, D.W.; Stephens, R.; Baseler, M.W.; Lane, H.C.; Lempicki, R.A. DAVID-WS: A stateful web service to facilitate gene/protein list analysis. Bioinformatics 2012, 28, 1805–1806. [Google Scholar] [CrossRef]
- Nangraj, A.S.; Selvaraj, G.; Kaliamurthi, S.; Kaushik, A.C.; Cho, W.C.; Wei, D.Q. Integrated PPI- and WGCNA-Retrieval of Hub Gene Signatures Shared Between Barrett’s Esophagus and Esophageal Adenocarcinoma. Front. Pharmacol. 2020, 11, 881. [Google Scholar] [CrossRef]
- Salmena, L.; Poliseno, L.; Tay, Y.; Kats, L.; Pandolfi, P.P. A ceRNA hypothesis: The Rosetta Stone of a hidden RNA language? Cell 2011, 146, 353–358. [Google Scholar] [CrossRef]
(a) | |||
Areas | Left Adrenal | Right Adrenal | p-Value |
Entire gland | 1.867 ± 0.155 a* | 1.691 ± 0.147 | 0.049 |
Capsule | 0.081 ± 0.019 b** | 0.052 ± 0.006 | 0.005 |
Cortex | 1.210 ± 0.102 | 1.138 ± 0.112 | 0.272 |
zG | 0.267 ± 0.046 | 0.243 ± 0.037 | 0.343 |
zF | 0.943 ± 0.060 | 0.895 ± 0.091 | 0.307 |
Medulla | 0.540 ± 0.10 | 0.503 ± 0.129 | 0.589 |
(b) | |||
Ratio | Left Adrenal | Right Adrenal | p-Value |
Capsule/gland | 0.044 ± 0.012 a* | 0.031 ± 0.003 | 0.021 |
Cortex/gland | 0.661 ± 0.041 | 0.674 ± 0.058 | 0.681 |
zG/Cortex | 0.219 ± 0.022 | 0.213 ± 0.022 | 0.645 |
zF/Cortex | 0.781 ± 0.022 | 0.787 ± 0.022 | 0.645 |
Medulla/gland | 0.294 ± 0.045 | 0.295 ± 0.061 | 0.976 |
Pathway | Level 1 | Level 2 | ID | Up/Down Number | DEG Number | Total Number | p-Value |
---|---|---|---|---|---|---|---|
Thermogenesis | Organismal Systems | Environmental adaptation | ko04714 | 11/48 | 59 | 232 | 1.92 × 10−5 |
Axon guidance | Organismal Systems | Development and regeneration | ko04360 | 13/25 | 38 | 156 | 0.00129021 |
PPAR signaling pathway | Organismal Systems | Endocrine system | ko03320 | 8/15 | 23 | 82 | 0.001617661 |
Corticosterone synthesis and secretion | Organismal Systems | Endocrine system | ko04927 | 12/6 | 18 | 59 | 0.00180696 |
Adrenergic signaling in cardiomyocyte | Organismal Systems | Circulatory system | ko04261 | 13/16 | 29 | 126 | 0.010343082 |
Cholinergic synapse | Organismal Systems | Nervous system | ko04725 | 6/16 | 22 | 96 | 0.02441011 |
Chemokine signaling pathway | Organismal Systems | Immune system | ko04062 | 18/17 | 35 | 170 | 0.028186015 |
Platelet activation | Organismal Systems | Immune system | ko04611 | 12/13 | 25 | 115 | 0.031805019 |
Retrograde endocannabinoid signaling | Organismal Systems | Nervous system | ko04723 | 5/23 | 28 | 134 | 0.038658635 |
Aldosterone synthesis and secretion | Organismal Systems | Endocrine system | ko04925 | 10/9 | 19 | 84 | 0.039170725 |
Gene Symbol | KEGG | Description | Fold Change (L/R) |
---|---|---|---|
Plcb1 | K05858 | 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase beta-1 isoform X2 | 1.27 |
Agtr1b | K04166 | type-1B angiotensin II receptor | 1.31 |
Hsd3b1 | K00070 | 3 beta-hydroxysteroid dehydrogenase/Delta 5--4-isomerase type 1 | 1.50 |
Hsd3b6 | K00070 | 3 beta-hydroxysteroid dehydrogenase/Delta 5--4-isomerase type 6 | 1.64 |
Creb3 | K09048 | cyclic AMP-responsive element-binding protein 3 | 1.33 |
Kcnk3 | K04914 | potassium channel subfamily K member 3 | 0.77 |
Creb3l2 | K09048 | cyclic AMP-responsive element-binding protein 3-like protein 2 | 0.76 |
Agt | K09821 | angiotensinogen isoform X1 | 1.94 |
Star | K16931 | steroidogenic acute regulatory protein, mitochondrial progenitor | 1.20 |
Adcy1 | K08041 | adenylate cyclase type 1 | 0.75 |
Adcy3 | K08043 | adenylate cyclase type 3 isoform 2 | 0.82 |
Agtr1a | K04166 | type-1A angiotensin II receptor isoform X1 | 1.23 |
Adcy6 | K08046 | adenylate cyclase type 6 isoform 1 | 0.77 |
Cacna1i | K04856 | voltage-dependent T-type calcium channel subunit alpha-1I isoform X2 | 0.61 |
Cyp11b2 | K00497 | cytochrome P450 11B2, mitochondrial | 1.36 |
Mrap | K22398 | melanocortin-2 receptor accessory protein | 1.23 |
Mc2r | K04200 | adrenocorticotropic hormone receptor | 1.21 |
Nr0b1 | K08562 | nuclear receptor subfamily 0 group B member 1 | 1.64 |
Pathway | Level 1 | Level 2 | ID | Up/Down NO. | DEG NO. | Total NO. | p-Value |
---|---|---|---|---|---|---|---|
Ribosome | Genetic Information Processing | Translation | ko03010 | 5/59 | 64 | 247 | 4.54 × 10−6 |
Oxidative phosphorylation | Metabolism | Energy metabolism | ko00190 | 3/32 | 35 | 141 | 0.001383233 |
cGMP-PKG signaling pathway | Environmental Information Processing | Signal transduction | ko04022 | 14/18 | 32 | 149 | 0.019947882 |
Glycosphingolipid biosynthesis-ganglio series | Metabolism | Glycan biosynthesis and metabolism | ko00604 | 2/3 | 5 | 12 | 0.023467218 |
Ras signaling pathway | Environmental Information Processing | Signal transduction | ko04014 | 17/23 | 40 | 197 | 0.024806251 |
MAPK signaling pathway | Environmental Information Processing | Signal transduction | ko04010 | 20/28 | 48 | 247 | 0.031550245 |
Valine, leucine, and isoleucine degradation | Metabolism | Amino acid metabolism | ko00280 | 8/5 | 13 | 52 | 0.039016313 |
Gene Symbol | NCBI Accession No. | Product Size | Primer Sequence (5′ to 3′) |
---|---|---|---|
Hsd3b1 | NM_001304800.1 | 85 | TGCTGCACAGCCCTCCTA |
TCCATCCAGCCATGGTCAAC | |||
Cyp11b2 | NM_009991.4 | 251 | TGGCATTGTGGCGGAACTAA |
AAGGGGATTGCTGTCGTGTC | |||
Cyp11b1 | NM_001033229.3 | 162 | CGCTGCAAATCCTCAGAAGG |
ACATTGAGGACTGTCCCAGCA | |||
Cyp11a1 | NM_001346787.1 | 189 | CCCGGAGAGCTTGTGCAAAT |
CCCATGCTGAGCCAGATGTC | |||
Star | NM_011485.5 | 184 | TCGCTACGTTCAAGCTGTGT |
GCTTCCAGTTGAGAACCAAGC | |||
Ngfr | NM_033217.3 | 102 | CCCTGCCTGGACAGTGTTAC |
ACAGGGAGCGGACATACTCT | |||
Cend1 | NM_001360485.1 | 159 | CAGGACGGGGAGACCCAT |
CCTTGGTATCTGGCTTGGGG | |||
Cdh6 | NM_007666.4 | 106 | CAGCAAGAAGCACAGAGCAG |
CTTTCAGAGGGTACCTCGGTT | |||
Tox | NM_001377078.1 | 142 | TGGTCAGCTGCACACTAGAA |
ACTCCTTTTCTTTTCTCCTGCC | |||
Shh | NM_009170.3 | 168 | ACGTAGCCGAGAAGACCCTA |
ACTTGTCTTTGCACCTCTGAGT | |||
Gata2 | NM_001355253.1 | 104 | TGTCAGACGACAACCACCAC |
AGTGGCCTGTTAACATTGTGC | |||
Gapdh | NM_001411840.1 | 166 | AGGTCGGTGTGAACGGATTT |
ACTGTGCCGTTGAATTTGCC | |||
U6 | NR_138085.1 | 79 | CTCGCTTCGGCAGCACA |
AACGCTTCACGAATTTGCGT | |||
miR-466i-5p | NR_035412.1 | 65 | AATCGGCGTGTGTGTGTGTGT |
ATCCAGTGCAGGGTCCGAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saxu, R.; Yang, Y.; Gu, H.F. Asymmetries of Left and Right Adrenal Glands in Neural Innervation and Glucocorticoids Production. Int. J. Mol. Sci. 2023, 24, 17456. https://doi.org/10.3390/ijms242417456
Saxu R, Yang Y, Gu HF. Asymmetries of Left and Right Adrenal Glands in Neural Innervation and Glucocorticoids Production. International Journal of Molecular Sciences. 2023; 24(24):17456. https://doi.org/10.3390/ijms242417456
Chicago/Turabian StyleSaxu, Rengui, Yong Yang, and Harvest F. Gu. 2023. "Asymmetries of Left and Right Adrenal Glands in Neural Innervation and Glucocorticoids Production" International Journal of Molecular Sciences 24, no. 24: 17456. https://doi.org/10.3390/ijms242417456
APA StyleSaxu, R., Yang, Y., & Gu, H. F. (2023). Asymmetries of Left and Right Adrenal Glands in Neural Innervation and Glucocorticoids Production. International Journal of Molecular Sciences, 24(24), 17456. https://doi.org/10.3390/ijms242417456