The Inactivation of the Putative Two-Component System Sensor PA14_27940 Increases the Susceptibility to Several Antibiotics and Reduces the Motility of Pseudomonas aeruginosa
Abstract
:1. Introduction
2. Results and Discussion
2.1. PA14_27940 Deletion Renders Hypersusceptibility to Several Antibiotics in P. aeruginosa
2.2. PA14_27940 Deletion Alters the Motility of P. aeruginosa
2.3. Effect of PA14_27940 in the Production of P. aeruginosa Virulence Determinants
2.4. The Loss of PA14_27940 Impedes the Induction of armZ, Hence Reducing the Induction of mexXY by Tobramycin
2.5. Fosfomycin Hypersusceptibility of the ΔPA14_27940 Mutant Is Due to the Reduced Expression of the Genes Encoding the Alternative Peptidoglycan Recycling Pathway
3. Materials and Methods
3.1. Bacterial Strains, Plasmids and Oligonucleotides
3.2. Bacterial Growth Conditions
3.3. Construction of ΔPA14_27940 P. aeruginosa Mutant
3.4. Whole-Genome Sequencing and Bioinformatics Analysis
3.5. Analysis of Susceptibility to Antibiotics
3.6. Motility Assays
3.7. Elastase Activity and Pyocyanin Production
3.8. Biofilm Formation
3.9. Quantification of Intracellular Fosfomycin
3.10. RNA Extraction and qRT-PCR
3.11. Statistical Analyses
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Laborda, P.; Sanz-García, F.; Hernando-Amado, S.; Martínez, J.L. Pseudomonas aeruginosa: An antibiotic resilient pathogen with environmental origin. Curr. Opin. Microbiol. 2021, 64, 125–132. [Google Scholar] [CrossRef]
- Sanz-García, F.; Gil-Gil, T.; Laborda, P.; Ochoa-Sánchez, L.E.; Martínez, J.L.; Hernando-Amado, S. Coming from the Wild: Multidrug Resistant Opportunistic Pathogens Presenting a Primary, Not Human-Linked, Environmental Habitat. Int. J. Mol. Sci. 2021, 22, 8080. [Google Scholar] [CrossRef] [PubMed]
- Laborda, P.; Hernando-Amado, S.; Martínez, J.L.; Sanz-García, F. Antibiotic Resistance in Pseudomonas. Adv. Exp. Med. Biol. 2022, 1386, 117–143. [Google Scholar] [CrossRef]
- Jurado-Martín, I.; Sainz-Mejías, M.; McClean, S. Pseudomonas aeruginosa: An Audacious Pathogen with an Adaptable Arsenal of Virulence Factors. Int. J. Mol. Sci. 2021, 22, 3128. [Google Scholar] [CrossRef] [PubMed]
- Moradali, M.F.; Ghods, S.; Rehm, B.H. Pseudomonas aeruginosa Lifestyle: A Paradigm for Adaptation, Survival, and Persistence. Front. Cell. Infect. Microbiol. 2017, 7, 39. [Google Scholar] [CrossRef]
- Morales, E.; Cots, F.; Sala, M.; Comas, M.; Belvis, F.; Riu, M.; Salvado, M.; Grau, S.; Horcajada, J.P.; Montero, M.M.; et al. Hospital costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition. BMC Health Serv. Res. 2012, 12, 122. [Google Scholar] [CrossRef] [PubMed]
- Obritsch, M.D.; Fish, D.N.; MacLaren, R.; Jung, R. Nosocomial infections due to multidrug-resistant Pseudomonas aeruginosa: Epidemiology and treatment options. Pharmacotherapy 2005, 25, 1353–1364. [Google Scholar] [CrossRef] [PubMed]
- Rello, J.; Kalwaje Eshwara, V.; Lagunes, L.; Alves, J.; Wunderink, R.G.; Conway-Morris, A.; Rojas, J.N.; Alp, E.; Zhang, Z. A global priority list of the TOp TEn resistant Microorganisms (TOTEM) study at intensive care: A prioritization exercise based on multi-criteria decision analysis. Eur. J. Clin. Microbiol. Infect. Dis. 2019, 38, 319–323. [Google Scholar] [CrossRef] [PubMed]
- Pendleton, J.N.; Gorman, S.P.; Gilmore, B.F. Clinical relevance of the ESKAPE pathogens. Expert Rev. Anti-Infect. Ther. 2013, 11, 297–308. [Google Scholar] [CrossRef]
- Masuda, N.; Sakagawa, E.; Ohya, S.; Gotoh, N.; Tsujimoto, H.; Nishino, T. Contribution of the MexX-MexY-oprM efflux system to intrinsic resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2000, 44, 2242–2246. [Google Scholar] [CrossRef]
- Morita, Y.; Kimura, N.; Mima, T.; Mizushima, T.; Tsuchiya, T. Roles of MexXY- and MexAB-multidrug efflux pumps in intrinsic multidrug resistance of Pseudomonas aeruginosa PAO1. J. Gen. Appl. Microbiol. 2001, 47, 27–32. [Google Scholar] [CrossRef]
- Jeannot, K.; Sobel, M.L.; El Garch, F.; Poole, K.; Plesiat, P. Induction of the MexXY efflux pump in Pseudomonas aeruginosa is dependent on drug-ribosome interaction. J. Bacteriol. 2005, 187, 5341–5346. [Google Scholar] [CrossRef]
- Kawalek, A.; Modrzejewska, M.; Zieniuk, B.; Bartosik, A.A.; Jagura-Burdzy, G. Interaction of ArmZ with the DNA-binding domain of MexZ induces expression of mexXY multidrug efflux pump genes and antimicrobial resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2019, 63, e01199-19. [Google Scholar] [CrossRef] [PubMed]
- Rife, C.L.; Pharris, R.E.; Newcomer, M.E.; Armstrong, R.N. Crystal structure of a genomically encoded fosfomycin resistance protein (FosA) at 1.19 A resolution by MAD phasing off the L-III edge of Tl(+). J. Am. Chem. Soc. 2002, 124, 11001–11003. [Google Scholar] [CrossRef] [PubMed]
- Borisova, M.; Gisin, J.; Mayer, C. Blocking peptidoglycan recycling in Pseudomonas aeruginosa attenuates intrinsic resistance to fosfomycin. Microb. Drug Resist. 2014, 20, 231–237. [Google Scholar] [CrossRef] [PubMed]
- Hamou-Segarra, M.; Zamorano, L.; Vadlamani, G.; Chu, M.; Sanchez-Diener, I.; Juan, C.; Blazquez, J.; Hattie, M.; Stubbs, K.A.; Mark, B.L.; et al. Synergistic activity of fosfomycin, beta-lactams and peptidoglycan recycling inhibition against Pseudomonas aeruginosa. J. Antimicrob. Chemother. 2017, 72, 448–454. [Google Scholar] [CrossRef]
- Diggle, S.P.; Whiteley, M. Microbe Profile: Pseudomonas aeruginosa: Opportunistic pathogen and lab rat. Microbiology 2020, 166, 30–33. [Google Scholar] [CrossRef]
- Butler, M.T.; Wang, Q.; Harshey, R.M. Cell density and mobility protect swarming bacteria against antibiotics. Proc. Natl. Acad. Sci. USA 2010, 107, 3776–3781. [Google Scholar] [CrossRef]
- Samad, T.; Billings, N.; Birjiniuk, A.; Crouzier, T.; Doyle, P.S.; Ribbeck, K. Swimming bacteria promote dispersal of non-motile staphylococcal species. ISME J. 2017, 11, 1933–1937. [Google Scholar] [CrossRef]
- Sultan, M.; Arya, R.; Kim, K.K. Roles of Two-Component Systems in Pseudomonas aeruginosa Virulence. Int. J. Mol. Sci. 2021, 22, 12152. [Google Scholar] [CrossRef]
- Bhagirath, A.Y.; Li, Y.; Patidar, R.; Yerex, K.; Ma, X.; Kumar, A.; Duan, K. Two Component Regulatory Systems and Antibiotic Resistance in Gram-Negative Pathogens. Int. J. Mol. Sci. 2019, 20, 1781. [Google Scholar] [CrossRef] [PubMed]
- Moskowitz, S.M.; Ernst, R.K.; Miller, S.I. PmrAB, a two-component regulatory system of Pseudomonas aeruginosa that modulates resistance to cationic antimicrobial peptides and addition of aminoarabinose to lipid A. J. Bacteriol. 2004, 186, 575–579. [Google Scholar] [CrossRef] [PubMed]
- Muller, C.; Plesiat, P.; Jeannot, K. A two-component regulatory system interconnects resistance to polymyxins, aminoglycosides, fluoroquinolones, and beta-lactams in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2011, 55, 1211–1221. [Google Scholar] [CrossRef] [PubMed]
- Macfarlane, E.L.; Kwasnicka, A.; Hancock, R.E. Role of Pseudomonas aeruginosa PhoP-phoQ in resistance to antimicrobial cationic peptides and aminoglycosides. Microbiology 2000, 146 Pt 10, 2543–2554. [Google Scholar] [CrossRef]
- Gooderham, W.J.; Gellatly, S.L.; Sanschagrin, F.; McPhee, J.B.; Bains, M.; Cosseau, C.; Levesque, R.C.; Hancock, R.E. The sensor kinase PhoQ mediates virulence in Pseudomonas aeruginosa. Microbiology 2009, 155, 699–711. [Google Scholar] [CrossRef]
- Sanz-Garcia, F.; Alvarez-Ortega, C.; Olivares-Pacheco, J.; Blanco, P.; Martinez, J.L.; Hernando-Amado, S. Analysis of the Pseudomonas aeruginosa Aminoglycoside Differential Resistomes Allows Defining Genes Simultaneously Involved in Intrinsic Antibiotic Resistance and Virulence. Antimicrob. Agents Chemother. 2019, 63, e00185-19. [Google Scholar] [CrossRef]
- Krahn, T.; Gilmour, C.; Tilak, J.; Fraud, S.; Kerr, N.; Lau, C.H.; Poole, K. Determinants of intrinsic aminoglycoside resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2012, 56, 5591–5602. [Google Scholar] [CrossRef]
- Hernando-Amado, S.; Laborda, P.; Valverde José, R.; Martínez José, L. Mutational background influences P. aeruginosa ciprofloxacin resistance evolution but preserves collateral sensitivity robustness. Proc. Natl. Acad. Sci. USA 2022, 119, e2109370119. [Google Scholar] [CrossRef]
- Bassetti, M.; Vena, A.; Croxatto, A.; Righi, E.; Guery, B. How to manage Pseudomonas aeruginosa infections. Drugs Context 2018, 7, 212527. [Google Scholar] [CrossRef]
- Overhage, J.; Bains, M.; Brazas, M.D.; Hancock, R.E.W. Swarming of Pseudomonas aeruginosa is a complex adaptation leading to increased production of virulence factors and antibiotic resistance. J. Bacteriol. 2008, 190, 2671–2679. [Google Scholar] [CrossRef]
- Losito, A.R.; Raffaelli, F.; Del Giacomo, P.; Tumbarello, M. New Drugs for the Treatment of Pseudomonas aeruginosa Infections with Limited Treatment Options: A Narrative Review. Antibiotics 2022, 11, 579. [Google Scholar] [CrossRef]
- Lau, G.W.; Hassett, D.J.; Ran, H.; Kong, F. The role of pyocyanin in Pseudomonas aeruginosa infection. Trends Mol. Med. 2004, 10, 599–606. [Google Scholar] [CrossRef]
- Wretlind, B.; Pavlovskis, O.R. Pseudomonas aeruginosa elastase and its role in pseudomonas infections. Rev. Infect. Dis. 1983, 5 (Suppl. S5), S998–S1004. [Google Scholar] [CrossRef]
- Lyczak, J.B.; Cannon, C.L.; Pier, G.B. Lung infections associated with cystic fibrosis. Clin. Microbiol. Rev. 2002, 15, 194–222. [Google Scholar] [CrossRef]
- Martinez-Solano, L.; Macia, M.D.; Fajardo, A.; Oliver, A.; Martinez, J.L. Chronic Pseudomonas aeruginosa infection in chronic obstructive pulmonary disease. Clin. Infect. Dis. 2008, 47, 1526–1533. [Google Scholar] [CrossRef]
- Wagner, V.E.; Iglewski, B.H. Pseudomonas aeruginosa Biofilms in CF Infection. Clin. Rev. Allergy Immunol. 2008, 35, 124–134. [Google Scholar] [CrossRef]
- Fajardo, A.; Martinez-Martin, N.; Mercadillo, M.; Galan, J.C.; Ghysels, B.; Matthijs, S.; Cornelis, P.; Wiehlmann, L.; Tummler, B.; Baquero, F.; et al. The neglected intrinsic resistome of bacterial pathogens. PLoS ONE 2008, 3, e1619. [Google Scholar] [CrossRef]
- Hay, T.; Fraud, S.; Lau, C.H.; Gilmour, C.; Poole, K. Antibiotic inducibility of the mexXY multidrug efflux operon of Pseudomonas aeruginosa: Involvement of the MexZ anti-repressor ArmZ. PLoS ONE 2013, 8, e56858. [Google Scholar] [CrossRef]
- Gisin, J.; Schneider, A.; Nagele, B.; Borisova, M.; Mayer, C. A cell wall recycling shortcut that bypasses peptidoglycan de novo biosynthesis. Nat. Chem. Biol. 2013, 9, 491–493. [Google Scholar] [CrossRef] [PubMed]
- Laborda, P.; Martínez, J.L.; Hernando-Amado, S. Convergent phenotypic evolution towards fosfomycin collateral sensitivity of Pseudomonas aeruginosa antibiotic-resistant mutants. Microb. Biotechnol. 2022, 15, 613–629. [Google Scholar] [CrossRef] [PubMed]
- Simon, R.; Priefer, U.; Pühler, A. A broad host range mobilization system for in vivo genetic engineering: Transposon mutagenesis in gram-negative bacteria. Bio/Technology 1983, 1, 784–791. [Google Scholar] [CrossRef]
- Hoang, T.T.; Karkhoff-Schweizer, R.R.; Kutchma, A.J.; Schweizer, H.P. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: Application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 1998, 212, 77–86. [Google Scholar] [CrossRef]
- Laborda, P.; Alcalde-Rico, M.; Chini, A.; Martínez, J.L.; Hernando-Amado, S. Discovery of inhibitors of Pseudomonas aeruginosa virulence through the search for natural-like compounds with a dual role as inducers and substrates of efflux pumps. Environ. Microbiol. 2021, 23, 7396–7411. [Google Scholar] [CrossRef]
- Mulet, X.; Cabot, G.; Ocampo-Sosa, A.A.; Dominguez, M.A.; Zamorano, L.; Juan, C.; Tubau, F.; Rodriguez, C.; Moya, B.; Pena, C.; et al. Biological markers of Pseudomonas aeruginosa epidemic high-risk clones. Antimicrob. Agents Chemother. 2013, 57, 5527–5535. [Google Scholar] [CrossRef]
- O’Toole, G.A.; Kolter, R. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: A genetic analysis. Mol. Microbiol. 1998, 28, 449–461. [Google Scholar] [CrossRef] [PubMed]
- Gil-Gil, T.; Corona, F.; Martínez, J.L.; Bernardini, A. The Inactivation of Enzymes Belonging to the Central Carbon Metabolism Is a Novel Mechanism of Developing Antibiotic Resistance. mSystems 2020, 5, e00282-20. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
Antibiotic | MIC (µg/mL) | |
---|---|---|
PA14 | ΔPA14_27940 | |
TOB | 0.75 | 0.19 * |
STR | 6 | 3 * |
AMK | 1.5 | 0.25 * |
KAN | 32 | 6 * |
TGC | 3 | 1 * |
TET | 24 | 12 * |
CIP | 0.032 | 0.032 |
CAZ | 0.5 | 0.5 |
IPM | 0.75 | 0.75 |
ATM | 3 | 2 |
FOF | 16 | 4 * |
ERY | 96 | 32 * |
CHL | 32 | 24 |
CS | 1 | 1 |
PB | 1 | 1 |
Bacterial Strains | Description | Reference/Origin |
---|---|---|
Escherichia coli DH5α | Strain used for cloning | Laboratory collection |
E. coli S17-1 | Donor strain for conjugation | [41] |
Pseudomonas aeruginosa PA14 | Laboratory model strain of P. aeruginosa | Laboratory collection |
ΔPA14_27940 | Mutant of P. aeruginosa PA14 with PA14_27940 deletion | This study |
Plasmids | Description | Origin |
---|---|---|
pGEM®-T Easy | Commercial plasmid used for cloning optimization of PCR products | Promega (Madison, WI, USA) |
pEX18Ap | Cloning vector | [42] |
RGD001 | pEX18Ap containing 500 bp upstream and 500 bp downstream of the gene PA14_27940 | This study |
Oligonucleotides | Sequence 5′3′ | Utilization |
PA14_27940.ups_fw | AAGCTGGGCTTCCAGTTCCAGGC | Mutant construction |
PA14_27940.ups_rv | TTACCGGTACTCATGCAAGGCTTTATGCATGGGTCATCCA | Mutant construction |
PA14_27940.dns_fw | TGGATGACCCATGCATAAAGCCTTGCATGAGTACCGGTAA | Mutant construction |
PA14_27940.dns_rv | AAGCTAAGGGATCGACCGGTTAA | Mutant construction |
PA14_27940.comp_fw | GGCCTGCAGATCTTCGAAAG | Mutant construction |
PA14_27940.comp_rv | GTCACCGGAAGCATGTTCAT | Mutant construction |
rplU_fw | CGCAGTGATTGTTACCGGTG | qRT-PCR |
rplU_rv | AGGCCTGAATGCCGGTGATC | qRT-PCR |
mexX_fw | GTACGAGGAAGGCCAGGAC | qRT-PCR |
mexX_rv | CTTGATCAGGTCGGCGTAG | qRT-PCR |
M13_fw | CGCCAGGGTTTTCCCAGTCACGAC | Sequencing |
M13_rv | CAGGAAACAGCTATGAC | Sequencing |
armZ_RT_F | ATCCTGCAAGAGCATGTCA | qRT-PCR |
armZ_RT_R | GACGTCGAGCAGTTCCAG | qRT-PCR |
agmK_RT_F | AGCTGAATCGCTGGTTGGAC | qRT-PCR |
agmK_RT_R | AACGGTCGGCAGTCTTCCTG | qRT-PCR |
anmK_RT_F | CAACGTGCTGATGGACGCCT | qRT-PCR |
anmK_RT_R | AGCCAGGACAGGTTGAAGCG | qRT-PCR |
nagZ_RT_F | AGGTGGGCGGGCTGATCATCTT | qRT-PCR |
nagZ_RT_R | ATTGGGGTTGTCGGCGATCG | qRT-PCR |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Genova, R.; Gil-Gil, T.; Cuesta, T.; Martínez, J.L.; Sanz-García, F. The Inactivation of the Putative Two-Component System Sensor PA14_27940 Increases the Susceptibility to Several Antibiotics and Reduces the Motility of Pseudomonas aeruginosa. Int. J. Mol. Sci. 2023, 24, 17355. https://doi.org/10.3390/ijms242417355
Genova R, Gil-Gil T, Cuesta T, Martínez JL, Sanz-García F. The Inactivation of the Putative Two-Component System Sensor PA14_27940 Increases the Susceptibility to Several Antibiotics and Reduces the Motility of Pseudomonas aeruginosa. International Journal of Molecular Sciences. 2023; 24(24):17355. https://doi.org/10.3390/ijms242417355
Chicago/Turabian StyleGenova, Roberta, Teresa Gil-Gil, Trinidad Cuesta, José Luis Martínez, and Fernando Sanz-García. 2023. "The Inactivation of the Putative Two-Component System Sensor PA14_27940 Increases the Susceptibility to Several Antibiotics and Reduces the Motility of Pseudomonas aeruginosa" International Journal of Molecular Sciences 24, no. 24: 17355. https://doi.org/10.3390/ijms242417355
APA StyleGenova, R., Gil-Gil, T., Cuesta, T., Martínez, J. L., & Sanz-García, F. (2023). The Inactivation of the Putative Two-Component System Sensor PA14_27940 Increases the Susceptibility to Several Antibiotics and Reduces the Motility of Pseudomonas aeruginosa. International Journal of Molecular Sciences, 24(24), 17355. https://doi.org/10.3390/ijms242417355