Influence of N1-Methylpseudouridine in Guide RNAs on CRISPR/Cas9 Activity
Abstract
:1. Introduction
2. Results
2.1. Guide RNAs Modified with m1Ψ Can Cleave Plasmid DNA Substrate
2.2. Kinetics of Cas9 with Guide RNAs Containing m1Ψ Modifications
2.3. Incorporation of m1Ψ Increases CRISPR/Cas9 Specificity In Vitro
2.4. The Effect of m1Ψ on CRISPR/Cas9 Activity in Cells
3. Discussion
4. Materials and Methods
4.1. Synthesis of Guide RNAs In Vitro
4.2. Preparation of the Cas9 Protein
4.3. Biochemical In Vitro DNA Plasmid Cleavage Assays
4.4. In Vitro DNA Duplex Cleavage
4.5. Cell Culture
4.6. Neon Transfection of 293FT Cells
4.7. Digital PCR
4.8. Statistics and Quantification
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Strich, J.R.; Chertow, D.S. CRISPR-Cas Biology and Its Application to Infectious Diseases. J. Clin. Microbiol. 2019, 57, 10–1128. [Google Scholar] [CrossRef] [PubMed]
- Barrangou, R.; Doudna, J.A. Applications of CRISPR technologies in research and beyond. Nat. Biotechnol. 2016, 34, 933–941. [Google Scholar] [CrossRef] [PubMed]
- Jiang, F.; Doudna, J.A. CRISPR-Cas9 Structures and Mechanisms. Annu. Rev. Biophys. 2017, 46, 505–529. [Google Scholar] [CrossRef] [PubMed]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef] [PubMed]
- Hsu, P.D.; Scott, D.A.; Weinstein, J.A.; Ran, F.A.; Konermann, S.; Agarwala, V.; Li, Y.; Fine, E.J.; Wu, X.; Shalem, O.; et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 2013, 31, 827–832. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Foden, J.A.; Khayter, C.; Maeder, M.L.; Reyon, D.; Joung, J.K.; Sander, J.D. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol. 2013, 31, 822–826. [Google Scholar] [CrossRef] [PubMed]
- Manghwar, H.; Li, B.; Ding, X.; Hussain, A.; Lindsey, K.; Zhang, X.; Jin, S. CRISPR/Cas Systems in Genome Editing: Methodologies and Tools for sgRNA Design, Off-Target Evaluation, and Strategies to Mitigate Off-Target Effects. Adv. Sci. 2020, 7, 1902312. [Google Scholar] [CrossRef]
- Kelley, M.L.; Strezoska, Ž.; He, K.; Vermeulen, A.; Smith, A.v.B. Versatility of chemically synthesized guide RNAs for CRISPR-Cas9 genome editing. J. Biotechnol. 2016, 233, 74–83. [Google Scholar] [CrossRef]
- Sun, B.; Chen, H.; Gao, X. Versatile modification of the CRISPR/Cas9 ribonucleoprotein system to facilitate in vivo application. J. Control. Release 2021, 337, 698–717. [Google Scholar] [CrossRef]
- Chen, Q.; Zhang, Y.; Yin, H. Recent advances in chemical modifications of guide RNA, mRNA and donor template for CRISPR-mediated genome editing. Adv. Drug Deliv. Rev. 2021, 168, 246–258. [Google Scholar] [CrossRef] [PubMed]
- Rozners, E. Chemical Modifications of CRISPR RNAs to Improve Gene-Editing Activity and Specificity. J. Am. Chem. Soc. 2022, 144, 12584–12594. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Yang, D.; Zhang, J.; Xu, J.; Chen, Y.E. Recent Advances in Improving Gene-Editing Specificity through CRISPR–Cas9 Nuclease Engineering. Cells 2022, 11, 2186. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Liu, J.; Janssen, J.M.; Le Bouteiller, M.; Frock, R.L.; Gonçalves, M.A.F.V. Precise and broad scope genome editing based on high-specificity Cas9 nickases. Nucleic Acids Res. 2021, 49, 1173–1198. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.H.; Miller, S.M.; Geurts, M.H.; Tang, W.; Chen, L.; Sun, N.; Zeina, C.M.; Gao, X.; Rees, H.A.; Lin, Z.; et al. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature 2018, 556, 57–63. [Google Scholar] [CrossRef]
- Kim, N.; Kim, H.K.; Lee, S.; Seo, J.H.; Choi, J.W.; Park, J.; Min, S.; Yoon, S.; Cho, S.R.; Kim, H.H. Prediction of the sequence-specific cleavage activity of Cas9 variants. Nat. Biotechnol. 2020, 38, 1328–1336. [Google Scholar] [CrossRef]
- Karikó, K.; Buckstein, M.; Ni, H.; Weissman, D. Suppression of RNA Recognition by Toll-like Receptors: The Impact of Nucleoside Modification and the Evolutionary Origin of RNA. Immunity 2005, 23, 165–175. [Google Scholar] [CrossRef]
- Anderson, B.R.; Muramatsu, H.; Nallagatla, S.R.; Bevilacqua, P.C.; Sansing, L.H.; Weissman, D.; Karikó, K. Incorporation of pseudouridine into mRNA enhances translation by diminishing PKR activation. Nucleic Acids Res. 2010, 38, 5884–5892. [Google Scholar] [CrossRef]
- Karikó, K.; Muramatsu, H.; Welsh, F.A.; Ludwig, J.; Kato, H.; Akira, S.; Weissman, D. Incorporation of Pseudouridine Into mRNA Yields Superior Nonimmunogenic Vector With Increased Translational Capacity and Biological Stability. Mol. Ther. 2008, 16, 1833–1840. [Google Scholar] [CrossRef]
- Parr, C.J.C.; Wada, S.; Kotake, K.; Kameda, S.; Matsuura, S.; Sakashita, S.; Park, S.; Sugiyama, H.; Kuang, Y.; Saito, H. N1-Methylpseudouridine substitution enhances the performance of synthetic mRNA switches in cells. Nucleic Acids Res. 2020, 48, E35. [Google Scholar] [CrossRef]
- Nance, K.D.; Meier, J.L. Modifications in an Emergency: The Role of N1-Methylpseudouridine in COVID-19 Vaccines. ACS Cent. Sci. 2021, 7, 748–756. [Google Scholar] [CrossRef]
- Morais, P.; Adachi, H.; Yu, Y.T. The Critical Contribution of Pseudouridine to mRNA COVID-19 Vaccines. Front. Cell Dev. Biol. 2021, 9, 3187. [Google Scholar] [CrossRef] [PubMed]
- Pardi, N.; Hogan, M.J.; Naradikian, M.S.; Parkhouse, K.; Cain, D.W.; Jones, L.; Moody, M.A.; Verkerke, H.P.; Myles, A.; Willis, E.; et al. Nucleoside-modified mRNA vaccines induce potent T follicular helper and germinal center B cell responses. J. Exp. Med. 2018, 215, 1571–1588. [Google Scholar] [CrossRef] [PubMed]
- Meyer, M.; Huang, E.; Yuzhakov, O.; Ramanathan, P.; Ciaramella, G.; Bukreyev, A. Modified mRNA-Based Vaccines Elicit Robust Immune Responses and Protect Guinea Pigs From Ebola Virus Disease. J. Infect. Dis. 2018, 217, 451–455. [Google Scholar] [CrossRef] [PubMed]
- Andries, O.; Mc Cafferty, S.; De Smedt, S.C.; Weiss, R.; Sanders, N.N.; Kitada, T. N(1)-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice. J. Control. Release 2015, 217, 337–344. [Google Scholar] [CrossRef] [PubMed]
- Mokuda, S.; Watanabe, H.; Kohno, H.; Ishitoku, M.; Araki, K.; Hirata, S.; Sugiyama, E. N1-methylpseudouridine-incorporated mRNA enhances exogenous protein expression and suppresses immunogenicity in primary human fibroblast-like synoviocytes. Cytotechnology 2022, 74, 503–514. [Google Scholar] [CrossRef] [PubMed]
- Svitkin, Y.V.; Cheng, Y.M.; Chakraborty, T.; Presnyak, V.; John, M.; Sonenberg, N. N1-methyl-pseudouridine in mRNA enhances translation through eIF2α-dependent and independent mechanisms by increasing ribosome density. Nucleic Acids Res. 2017, 45, 6023–6036. [Google Scholar] [CrossRef]
- Yang, H.; Eremeeva, E.; Abramov, M.; Jacquemyn, M.; Groaz, E.; Daelemans, D.; Herdewijn, P. CRISPR-Cas9 recognition of enzymatically synthesized base-modified nucleic acids. Nucleic Acids Res. 2023, 51, 1501–1511. [Google Scholar] [CrossRef]
- Li, B.; Luo, X.; Dong, Y. Effects of Chemically Modified Messenger RNA on Protein Expression. Bioconjug. Chem. 2016, 27, 849–853. [Google Scholar] [CrossRef]
- Prokhorova, D.V.; Vokhtantsev, I.P.; Tolstova, P.O.; Zhuravlev, E.S.; Kulishova, L.M.; Zharkov, D.O.; Stepanov, G.A. Natural Nucleoside Modifications in Guide RNAs Can Modulate the Activity of the CRISPR-Cas9 System In Vitro. Cris. J. 2022, 5, 799–812. [Google Scholar] [CrossRef]
- Ryan, D.E.; Diamant-Levi, T.; Steinfeld, I.; Taussig, D.; Visal-Shah, S.; Thakker, S.; Lunstad, B.D.; Kaiser, R.J.; Mccaffrey, R.; Ortiz, M.; et al. Phosphonoacetate Modifications Enhance the Stability and Editing Yields of Guide RNAs for Cas9 Editors. Biochemistry 2022, 56, 3863–3873. [Google Scholar] [CrossRef] [PubMed]
- Yin, H.; Song, C.Q.; Suresh, S.; Wu, Q.; Walsh, S.; Rhym, L.H.; Mintzer, E.; Bolukbasi, M.F.; Zhu, L.J.; Kauffman, K.; et al. Structure-guided chemical modification of guide RNA enables potent non-viral in vivo genome editing. Nat. Biotechnol. 2017, 35, 1179–1187. [Google Scholar] [CrossRef] [PubMed]
- Mir, A.; Alterman, J.F.; Hassler, M.R.; Debacker, A.J.; Hudgens, E.; Echeverria, D.; Brodsky, M.H.; Khvorova, A.; Watts, J.K.; Sontheimer, E.J. Heavily and fully modified RNAs guide efficient SpyCas9-mediated genome editing. Nat. Commun. 2018, 9, 2641. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.H.; Potapov, V.; Dai, N.; Ong, J.L.; Roy, B. N1-methyl-pseudouridine is incorporated with higher fidelity than pseudouridine in synthetic RNAs. Sci. Rep. 2022, 12, 13017. [Google Scholar] [CrossRef] [PubMed]
- Mauger, D.M.; Joseph Cabral, B.; Presnyak, V.; Su, S.V.; Reid, D.W.; Goodman, B.; Link, K.; Khatwani, N.; Reynders, J.; Moore, M.J.; et al. mRNA structure regulates protein expression through changes in functional half-life. Proc. Natl. Acad. Sci. USA 2019, 116, 24075–24083. [Google Scholar] [CrossRef] [PubMed]
- Dutta, N.; Deb, I.; Sarzynska, J.; Lahiri, A. Structural and thermodynamic consequences of base pairs containing pseudouridine and N1-methylpseudouridine in RNA duplexes. bioRxiv 2023. bioRxiv:2023.03.19.533340. [Google Scholar] [CrossRef]
- Kim, K.Q.; Burgute, B.D.; Tzeng, S.C.; Jing, C.; Jungers, C.; Zhang, J.; Yan, L.L.; Vierstra, R.D.; Djuranovic, S.; Evans, B.S.; et al. N1-methylpseudouridine found within COVID-19 mRNA vaccines produces faithful protein products. Cell Rep. 2022, 40, 111300. [Google Scholar] [CrossRef] [PubMed]
- Fleming, A.M.; Burrows, C.J. Nanopore sequencing for N1-methylpseudouridine in RNA reveals sequence-dependent discrimination of the modified nucleotide triphosphate during transcription. Nucleic Acids Res. 2023, 51, 1914–1926. [Google Scholar] [CrossRef]
- Hendel, A.; Bak, R.O.; Clark, J.T.; Kennedy, A.B.; Ryan, D.E.; Roy, S.; Steinfeld, I.; Lunstad, B.D.; Kaiser, R.J.; Wilkens, A.B.; et al. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells. Nat. Biotechnol. 2015, 33, 985–989. [Google Scholar] [CrossRef]
- Ryan, D.E.; Taussig, D.; Steinfeld, I.; Phadnis, S.M.; Lunstad, B.D.; Singh, M.; Vuong, X.; Okochi, K.D.; McCaffrey, R.; Olesiak, M.; et al. Improving CRISPR-Cas specificity with chemical modifications in single-guide RNAs. Nucleic Acids Res. 2018, 46, 792–803. [Google Scholar] [CrossRef]
- Filippova, J.; Matveeva, A.; Zhuravlev, E.; Stepanov, G. Guide RNA modification as a way to improve CRISPR/Cas9-based genome-editing systems. Biochimie 2019, 167, 49–60. [Google Scholar] [CrossRef]
- Hoy, A.; Zheng, Y.Y.; Sheng, J.; Royzen, M. Bio-orthogonal chemistry-based conjugation strategy facilitates investigation of impacts of s2U, s4U, m1A and m6A guide RNA modifications on CRISPR activity. Cris. J. 2022, 5, 787–798. [Google Scholar] [CrossRef] [PubMed]
- Anders, C.; Jinek, M. In vitro Enzymology of Cas9. Methods Enzym. 2016, 546, 1–20. [Google Scholar] [CrossRef]
- Peng, C.; Zheng, M.; Ding, L.; Chen, X.; Wang, X.; Feng, X.; Wang, J.; Xu, J. Accurate Detection and Evaluation of the Gene-Editing Frequency in Plants Using Droplet Digital PCR. Front. Plant Sci. 2020, 11, 1919. [Google Scholar] [CrossRef] [PubMed]




| Name | Structure (5′–3′) |
|---|---|
| crRNA | atgcagctaatacgactcactataggtcagggttactatgataagg |
| tracrRNA | ucuagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuu |
| sgRNA | gguuggacaugcucgacauucguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuu |
| Name | Structure (5′-3′) |
|---|---|
| F _ANX_dPCR | cctctcaagtccatgttcccc |
| R _ANX_dPCR | ggaatgtccaagagactccca |
| Probe_cleav_FAM_ANX | [FAM]acattcgggagatcttccggaccaagt[BHQ1] |
| Probe_ref_HEX _ANX | [HEX]agctcatgggggcagagaagggagca[BHQ1] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Prokhorova, D.; Matveeva, A.; Zakabunin, A.; Ryabchenko, A.; Stepanov, G. Influence of N1-Methylpseudouridine in Guide RNAs on CRISPR/Cas9 Activity. Int. J. Mol. Sci. 2023, 24, 17116. https://doi.org/10.3390/ijms242317116
Prokhorova D, Matveeva A, Zakabunin A, Ryabchenko A, Stepanov G. Influence of N1-Methylpseudouridine in Guide RNAs on CRISPR/Cas9 Activity. International Journal of Molecular Sciences. 2023; 24(23):17116. https://doi.org/10.3390/ijms242317116
Chicago/Turabian StyleProkhorova, Daria, Anastasiya Matveeva, Alexander Zakabunin, Alexander Ryabchenko, and Grigory Stepanov. 2023. "Influence of N1-Methylpseudouridine in Guide RNAs on CRISPR/Cas9 Activity" International Journal of Molecular Sciences 24, no. 23: 17116. https://doi.org/10.3390/ijms242317116
APA StyleProkhorova, D., Matveeva, A., Zakabunin, A., Ryabchenko, A., & Stepanov, G. (2023). Influence of N1-Methylpseudouridine in Guide RNAs on CRISPR/Cas9 Activity. International Journal of Molecular Sciences, 24(23), 17116. https://doi.org/10.3390/ijms242317116

