Dietary Potassium Supplementation Reduces Chronic Kidney Lesions Independent of Blood Pressure in Deoxycorticosterone-Acetate and High Sodium Chloride-Treated Mice
Abstract
:1. Introduction
2. Results
2.1. DOCA/Salt-Induced Renal Lesion and Proinflammatory and Fibrotic Marker Genes in the Absence of Hypertension
2.2. Dietary Potassium Supplementation Reduces Renal Lesion and Proinflammatory and Fibrotic Marker Gene Expressions in DOCA/Salt Normotensive Mice
3. Discussion
4. Materials and Methods
4.1. Mice and Experimental Protocol
4.2. Blood Pressure, Serum and Urinary Electrolytes, Creatinine, and Protein
4.3. Renal Pathology
4.4. Renal Proinflammatory Marker Genes
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Belden, Z.; Deiuliis, J.A.; Dobre, M.; Rajagopalan, S. The Role of the Mineralocorticoid Receptor in Inflammation: Focus on Kidney and Vasculature. Am. J. Nephrol. 2017, 46, 298–314. [Google Scholar] [CrossRef] [PubMed]
- Brown, N.J. Contribution of aldosterone to cardiovascular and renal inflammation and fibrosis. Nat. Rev. Nephrol. 2013, 9, 459–469. [Google Scholar] [CrossRef] [PubMed]
- Banek, C.T.; Gauthier, M.M.; Van Helden, D.A.; Fink, G.D.; Osborn, J.W. Renal Inflammation in DOCA-Salt Hypertension. Hypertension 2019, 73, 1079–1086. [Google Scholar] [CrossRef] [PubMed]
- Harrison, D.G.; Coffman, T.M.; Wilcox, C.S. Pathophysiology of hypertension: The mosaic theory and beyond. Circ. Res. 2021, 128, 847–863. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Soltero, L.; Zhang, P.; Huang, X.R.; Lan, H.Y.; Adrogue, H.J. Renal inflammation is modulated by potassium in chronic kidney disease: Possible role of Smad7. Am. J. Physiol. Renal Physiol. 2007, 293, F1123–F1130. [Google Scholar] [CrossRef] [PubMed]
- Kirchhoff, F.; Krebs, C.; Abdulhag, U.N.; Meyer-Schwesinger, C.; Maas, R.; Helmchen, U.; Hilgers, K.F.; Wolf, G.; Stahl, R.A.K.; Wenzel, U. Rapid development of severe end-organ damage in C57BL/6 mice by combining DOCA salt and angiotensin II. Kidney Int. 2008, 73, 643–650. [Google Scholar] [CrossRef]
- Wang, Q.; Domenighetti, A.A.; Schäfer, S.C.; Weber, J.; Simon, A.; Maillard, M.P.; Pedrazzini, T.; Chen, J.; Lehr, H.A.; Burnier, M. Impact of salt on cardiac differential gene expression and coronary lesion in normotensive mineralocorticoid-treated mice. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2012, 302, R1025–R1033. [Google Scholar] [CrossRef]
- Wang, Q.; Domenighetti, A.A.; Pedrazzini, T.; Burnier, M. Potassium supplementation reduces cardiac and renal hypertrophy independently of blood pressure in DOCA/salt mice. Hypertension 2005, 46, 547–554. [Google Scholar] [CrossRef]
- Reungjui, S.; Roncal, C.A.; Sato, W.; Glushakova, O.Y.; Croker, B.P.; Suga, S.; Ouyang, X.; Tungsanga, K.; Nakagawa, T.; Johnson, R.J.; et al. Hypokalemic nephropathy is associated with impaired angiogenesis. J. Am. Soc. Nephrol. 2008, 19, 125–134. [Google Scholar] [CrossRef]
- Suga, S.I.; Phillips, M.I.; Ray, P.E.; Raleigh, J.A.; Vio, C.P.; Kim, Y.G.; Mazzali, M.; Gordon, K.L.; Hughes, J.; Johnson, R.J. Hypokalaemia induces renal injury and alterations in vasoactive mediators that favor salt sensitivity. Am. J. Physiol. Renal. Physiol. 2001, 281, F620–F629. [Google Scholar] [CrossRef]
- Ray, P.E.; Suga, S.; Liu, X.H.; Huang, X.; Johnson, R.J. Chronic potassium depletion induces renal injury, salt sensitivity, and hypertension in young rats. Kidney Int. 2001, 59, 1850–1858. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Rahman, E.M.; Moorthy, A.V. End-stage renal disease (ESRD) in patients with eating disorders. Clin. Nephrol. 1997, 47, 106–111. [Google Scholar] [PubMed]
- Basting, T.; Lazartigues, E. DOCA-Salt Hypertension: An Update. Curr. Hypertens Rep. 2017, 19, 32. [Google Scholar] [CrossRef] [PubMed]
- Jia, G.; Hill, M.A.; Sowers, J.R. Vascular endothelial mineralocorticoid receptors and epithelial sodium channels in metabolic syndrome and related cardiovascular disease. J. Mol. Endocrinol. 2023, 71, e230066. [Google Scholar] [CrossRef] [PubMed]
- Kusche-Vihrog, K.; Jeggle, P.; Oberleithner, H. The role of ENaC in vascular endothelium. Pflugers Arch. 2014, 466, 851–859. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Yang, Y.; Aroor, A.R.; Jia, G.; Sun, Z.; Parrish, A.; Litherland, G.; Bonnard, B.; Jaisser, F.; Sowers, J.R.; et al. Endothelial sodium channel activation mediates DOCA-salt-induced endothelial cell and arterial stiffening. Metab. Clin. Exp. 2022, 130, 155165. [Google Scholar] [CrossRef] [PubMed]
- Wyss, C.; Wang, Q.; Golshayan, D.; Nussberger, J.; Burnier, M.; Lehr, H.A.; Schaefer, S.C. Potassium restores vasorelaxation of resistance arterioles in non-hypertensive DOCA/salt fed mice. Microvasc. Res. 2012, 84, 340–344. [Google Scholar] [CrossRef]
- Linas, S.L.; Dickmann, D. Mechanism of the decreased renal blood flow in the potassium-depleted conscious rat. Kidney Int. 1982, 21, 757–764. [Google Scholar] [CrossRef]
- Gómez-Chiarri, M.; Ortiz, A.; González-Cuadrado, S.; Serón, D.; Emancipator, S.N.; Hamilton, T.A.; Barat, A.; Plaza, J.J.; González, E.; Egido, J. Interferon-inducible protein-10 is highly expressed in rats with experimental nephrosis. Am. J. Pathol. 1996, 148, 301–311. [Google Scholar]
- Luster, A.; Unkeless, J.; Ravetch, J. γ-Interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature 1985, 315, 672–676. [Google Scholar] [CrossRef]
- Navarro, J.F.; Mora-Fernandez, C. The role of TNF-α in diabetic nephropathy: Pathogenic and therapeutic implications. Cytokine Growth Factor Rev. 2006, 17, 441–450. [Google Scholar] [CrossRef] [PubMed]
- Crorkin, P.; Hao, S.; Ferreri, N.R. Responses to Ang II (Angiotensin II), Salt Intake, and Lipopolysaccharide Reveal the Diverse Actions of TNF-α (Tumor Necrosis Factor-α) on Blood Pressure and Renal Function. Hypertension. 2022, 79, 2656–2670. [Google Scholar] [CrossRef] [PubMed]
- Lund, S.A.; Giachelli, C.M.; Scatena, M. The role of osteopontin in inflammatory processes. J. Cell Commun. Signal 2009, 3, 311–322. [Google Scholar] [CrossRef] [PubMed]
- Pankov, R.; Yamada, K.M. Fibronectin at a glance. J. Cell Sci. 2002, 115 Pt 20, 3861–3863. [Google Scholar] [CrossRef]
- Williams, C.M.; Engler, A.J.; Slone, R.D.; Galante, L.L.; Schwarzbauer, J.E. Fibronectin expression modulates mammary epithelial cell proliferation during acinar differentiation. Cancer Res. 2008, 68, 3185–3192. [Google Scholar] [CrossRef] [PubMed]
- Tesch, G.H.; Schwarting, A.; Kinoshita, K.; Lan, H.Y.; Rollins, B.J.; Kelley, V.R. Monocyte chemoattractant protein-1 promotes macrophage-mediated tubular injury, but not glomerular injury, in nephrotoxic serum nephritis. J. Clin. Investig. 1999, 103, 73–80. [Google Scholar] [CrossRef]
- Pétrilli, V.; Papin, S.; Dostert, C.; Mayor, A.; Martinon, F.; Tschopp, J. Activation of the NALP3 inflammasome is triggered by low intracellular potassium concentration. Cell Death Differ. 2007, 14, 1583–1589. [Google Scholar] [CrossRef] [PubMed]
- Hirooka, Y.; Nozaki, Y. Interleukin-18 in Inflammatory Kidney Disease. Front. Med. 2021, 8, 639103. [Google Scholar] [CrossRef]
- Wang, Q.; So, A.; Nussberger, J.; Ives, A.; Bagnoud, N.; Shäefer, S.; Tschopp, J.; Burnier, M. Renin-Dependent Hypertension in Mice Requires the NLRP3-Inflammasome. J. Hypertens 2014, 3, 187. [Google Scholar] [CrossRef]
- Haefliger, J.-A.; Krattinger, N.; Martin, D.; Pedrazzini, T.; Capponi, A.; Döring, B.; Plum, A.; Charollais, A.; Willecke, K.; Meda, P. Connexin43-dependent mechanism modulates renin secretion and hypertension. J. Clin. Investig. 2006, 116, 405–413. [Google Scholar] [CrossRef]
- Gonçalves, C.; Abreu, S. Sodium and Potassium Intake and Cardiovascular Disease in Older People: A Systematic Review. Nutrients 2020, 12, 3447. [Google Scholar] [CrossRef] [PubMed]
- Neal, B.; Wu, Y.; Feng, X. Effect of salt substitution on cardiovascular events and death. N. Engl. J. Med. 2021, 385, 1067–1077. [Google Scholar] [CrossRef] [PubMed]
- Markland, M.; Tullu, F.; Thout, S.; Yu, J.; Brady, T.; Appel, L.; Neal, B.; Wu, J.; Gupta, R. Estimated benefits and risk of lowering dietary sodium through potassium-enriched salt substitution in India: A modeling study. Hypertension 2022, 79, 2188–2198. [Google Scholar] [CrossRef] [PubMed]





| TAP | DOCS | DOCS + KCl | ||||||
|---|---|---|---|---|---|---|---|---|
| 5 Weeks | 8 Weeks | 11 Weeks | 5 Weeks | 8 Weeks | 11 Weeks | 8 + 3 Weeks | 11 + 6 Weeks | |
| Number of mice | 9 | 12 | 12 | 10 | 9 | 10 | 11 | 12 |
| Body weight (g) | 27 ± 0.4 | 28 ± 0.4 | 28 ± 0.3 | 28 ± 0.5 | 29 ± 0.3 | 29 ± 0.4 | 29 ± 0.4 | 29 ± 0.4 |
| MBP (mmHg) | 113 ± 2 | 114 ± 2 | 114 ± 2 | 112 ± 2 | 110 ± 2 | 109 ± 3 | 109 ± 3 | 112 ± 3 |
| Heart rate (beats/min) | 604 ± 20 | 601 ± 12 | 591 ± 15 | 600 ± 6 | 585 ± 8 | 578 ± 12 | 596 ± 10 | 577 ± 12 |
| Serum Na+ (mmol/L) | 150 ± 1 | 151 ± 1 | 152 ± 1 | 153 ± 1 | 154 ± 1 | 154 ± 1 | 154 ± 1 | 154 ± 1 |
| Kidney weight (mg) | 204 ± 4 | 236 ± 9 | 253 ± 6 | 357 ± 8 *** | 376 ± 9 *** | 399 ± 12 *** | 350 ± 6 † | 350 ± 4 †† |
| UNa/Creat | 57 ± 4 | 54 ± 5 | 73 ± 6 | 289 ± 56 *** | 366 ± 5 *** | 389 ± 44 *** | 250 ± 44 | 444 ± 86 |
| UK/Creat | 50 ± 2 | 55 ± 4 | 62 ± 4 | 56 ± 6 | 68 ± 3 | 62 ± 4 | 141 ± 14 ††† | 204 ± 29 †† |
| UProt/Creat (g/mmol) | 0.8 ± 0.1 | 0.7 ± 0.03 | 0.7 ± 0.1 | 1.7 ± 0.2 ** | 1.1 ± 0.1 ** | 1.1 ± 0.1 ** | 0.8 ± 0.1 | 0.5 ± 0.1 † |
| TAP | DOCS | DOCS+KCl | ||||
|---|---|---|---|---|---|---|
| 8 weeks | 11 weeks | 8 Weeks | 11 Weeks | 8 + 3 Weeks | 11 + 6 Weeks | |
| Number of mice | 9 | 10 | 11 | 8 | 9 | 12 |
| Vascular wall thickness | none | none | yes | yes | focal | focal |
| Tubular hypertrophy | none | none | focal | yes | focal or no | focal or yes |
| Gene | Sense Primer (5′-3′) | Antisense Primer (5′-3′) |
|---|---|---|
| PAI-1 | GACTGGGTGGAAAGGCATAC | GCGTGTCAGCTCGTCTACAG |
| Fibronectin | TCCTGCCTGGGACAGAATAC | TGAATGAGTTGGCGGTGATA |
| Collagen type I | GATGGATTCCCGTTCGAGTA | AGGCCTCGGTGGACATTAG |
| Collagen type III | TTGGAATTGCAGGGCTAACT | AGGACCACGTTCCCCATTAT |
| IP-10 | CCCACGTGTTGAGATCATTG | CACTGGGTAAAGGGGAGTGA |
| MCP-1 | CCCACTCACCTGCTGCTACT | GCTGCTGGTGATCCTCTTGTA |
| TGF-β | CTGCTGACCCCCACTGATAC | GCTGAATCGAAAGCCCTGTA |
| TNF-α | CGTCAGCCGATTTGCTATCT | CGGACTCCGCAAAGTCTAAG |
| Osteopontin | TGCACCCAGATCCTATAGCC | CTCCATCGTCATCATCATCG |
| P65 | GAGCCCATGGAGTTCCAGTA | TCGGGTAGGCACAGCAATAC |
| ICAM | GGGGAACCCATCTCCTAAGA | AGGCATGGCACACGTATGTA |
| ANP | ATGCTGGCAGCTAGGAGACA | AGGCCAAGACGAGGAAGAAG |
| α-skeletal actin | GGACCTGTACGCCAACAACG | AGCCACCGATCCACACTGAG |
| 18S | CTCAACACGGGAAACCTCAC | AGACAAATCGCTCCACCAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Q.; Schäfer, S.C.; Haefliger, J.-A.; Maillard, M.P.; Alonso, F. Dietary Potassium Supplementation Reduces Chronic Kidney Lesions Independent of Blood Pressure in Deoxycorticosterone-Acetate and High Sodium Chloride-Treated Mice. Int. J. Mol. Sci. 2023, 24, 16858. https://doi.org/10.3390/ijms242316858
Wang Q, Schäfer SC, Haefliger J-A, Maillard MP, Alonso F. Dietary Potassium Supplementation Reduces Chronic Kidney Lesions Independent of Blood Pressure in Deoxycorticosterone-Acetate and High Sodium Chloride-Treated Mice. International Journal of Molecular Sciences. 2023; 24(23):16858. https://doi.org/10.3390/ijms242316858
Chicago/Turabian StyleWang, Qing, Stephan C. Schäfer, Jacques-Antoine Haefliger, Marc P. Maillard, and Florian Alonso. 2023. "Dietary Potassium Supplementation Reduces Chronic Kidney Lesions Independent of Blood Pressure in Deoxycorticosterone-Acetate and High Sodium Chloride-Treated Mice" International Journal of Molecular Sciences 24, no. 23: 16858. https://doi.org/10.3390/ijms242316858
APA StyleWang, Q., Schäfer, S. C., Haefliger, J.-A., Maillard, M. P., & Alonso, F. (2023). Dietary Potassium Supplementation Reduces Chronic Kidney Lesions Independent of Blood Pressure in Deoxycorticosterone-Acetate and High Sodium Chloride-Treated Mice. International Journal of Molecular Sciences, 24(23), 16858. https://doi.org/10.3390/ijms242316858

