SOX18 Promotes the Proliferation of Dermal Papilla Cells via the Wnt/β-Catenin Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. SOX18 Is Differentially Expressed in Hu Sheep Skin and DPCs between Different Wool Phenotypes
2.2. SOX18 Promotes DPC Proliferation
2.3. SOX18 Regulates the Expression of Downstream Genes
2.4. SOX18 Enhances the Wnt/β-Catenin Pathway in DPCs
2.5. SOX18 Regulates DPC Proliferation via the Wnt/β-Catenin Pathway
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Animals and Ethics Statement
5.2. Cell Isolation, Culture, and Transfection
5.3. Total RNA Extraction, cDNA Synthesis, Primer Design, and qRT-PCR
5.4. RNA Oligonucleotides and Plasmid Construction
5.5. Immunofluorescence
5.6. CCK-8 Assay
5.7. EdU Assay
5.8. Cell Cycle Assay
5.9. TOP/FOP-Flash Wnt Report Assays
5.10. Total Protein Extraction and Western Blot Assay
5.11. RNA-Seq Analysis
5.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rogers, G.E. Improvement of wool production through genetic engineering. Trends Biotechnol. 1990, 8, 6–11. [Google Scholar] [CrossRef] [Scilit]
- Houschyar, K.S.; Borrelli, M.R.; Tapking, C.; Popp, D.; Puladi, B.; Ooms, M.; Chelliah, M.P.; Rein, S.; Pförringer, D.; Thor, D.; et al. Molecular Mechanisms of Hair Growth and Regeneration: Current Understanding and Novel Paradigms. Dermatology 2020, 236, 271–280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, B.; Sha, R.N.; Yuan, J.L.; Liu, D.J. Multiple potential roles of thymosin beta4 in the growth and development of hair follicles. J. Cell Mol. Med. 2021, 25, 1350–1358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cotsarelis, G.; Sun, T.-T.; Lavker, R.M. Label-retaining cells reside in the bulge area of pilosebaceous unit: Implications for follicular stem cells, hair cycle, and skin carcinogenesis. Cell 1990, 61, 1329–1337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, H.; Adam, R.C.; Ge, Y.; Hua, Z.L.; Fuchs, E. Epithelial-Mesenchymal Micro-niches Govern Stem Cell Lineage Choices. Cell 2017, 169, 483–496.e13. [Google Scholar] [CrossRef] [Scilit]
- Clavel, C.; Grisanti, L.; Zemla, R.; Rezza, A.; Barros, R.; Sennett, R.; Mazloom, A.R.; Chung, C.-Y.; Cai, X.; Cai, C.-L.; et al. Sox2 in the dermal papilla niche controls hair growth by fine-tuning BMP signaling in differentiating hair shaft progenitors. Dev. Cell 2012, 23, 981–994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saxena, N.; Mok, K.-W.; Rendl, M. An updated classification of hair follicle morphogenesis. Exp. Dermatol. 2019, 28, 332–344. [Google Scholar] [CrossRef] [Scilit]
- Slominski, A.; Wortsman, J.; Płonka, P.M.; Schallreuter, K.U.; Paus, R.; Tobin, D.J. Hair follicle pigmentation. J. Investig. Dermatol. 2005, 124, 13–21. [Google Scholar] [CrossRef] [Scilit]
- Sequeira, I.; Nicolas, J.F. Redefining the structure of the hair follicle by 3D clonal analysis. Development 2012, 139, 3741–3751. [Google Scholar] [CrossRef] [Scilit]
- Legué, E.; Nicolas, J.-F. Hair follicle renewal: Organization of stem cells in the matrix and the role of stereotyped lineages and behaviors. Development 2005, 132, 4143–4154. [Google Scholar] [CrossRef] [Scilit]
- Stenn, K.S.; Paus, R.; Chuong, C.-M.; Randall, V.A.; Widelitz, R.B.; Wu, P.; Jiang, T.-X.; Paul, M.J.; George, N.T.; Zucker, I.; et al. Controls of hair follicle cycling. Physiol. Rev. 2001, 81, 449–494. [Google Scholar] [CrossRef] [Scilit]
- Chi, W.; Wu, E.; Morgan, B.A. Dermal papilla cell number specifies hair size, shape and cycling and its reduction causes follicular decline. Development 2013, 140, 1676–1683. [Google Scholar] [CrossRef] [Scilit]
- Rahmani, W.; Abbasi, S.; Hagner, A.; Raharjo, E.; Kumar, R.; Hotta, A.; Magness, S.; Metzger, D.; Biernaskie, J. Hair follicle dermal stem cells regenerate the dermal sheath, repopulate the dermal papilla, and modulate hair type. Dev. Cell 2014, 31, 543–558. [Google Scholar] [CrossRef] [Scilit]
- Zhao, B.; Li, J.; Zhang, X.; Dai, Y.; Yang, N.; Bao, Z.; Chen, Y.; Wu, X. Exosomal miRNA-181a-5p from the cells of the hair follicle dermal papilla promotes the hair follicle growth and development via the Wnt/beta-catenin signaling pathway. Int. J. Biol. Macromol. 2022, 207, 110–120. [Google Scholar] [CrossRef] [Scilit]
- Nan, W.; Li, G.; Si, H.; Lou, Y.; Wang, D.; Guo, R.; Zhang, H. All-trans-retinoic acid inhibits mink hair follicle growth via inhibiting proliferation and inducing apoptosis of dermal papilla cells through TGF-beta2/Smad2/3 pathway. Acta Histochem. 2020, 122, 151603. [Google Scholar] [CrossRef] [Scilit]
- Botchkarev, V.A.; Sharov, A.A. BMP signaling in the control of skin development and hair follicle growth. Differentiation 2004, 72, 512–526. [Google Scholar] [CrossRef] [Scilit]
- Han, M.; Li, C.; Zhang, C.; Song, C.; Xu, Q.; Liu, Q.; Guo, J.; Sun, Y. Single-cell transcriptomics reveals the natural product Shi-Bi-Man promotes hair regeneration by activating the FGF pathway in dermal papilla cells. Phytomedicine 2022, 104, 154260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rendl, M.; Polak, L.; Fuchs, E. BMP signaling in dermal papilla cells is required for their hair follicle-inductive properties. Genes Dev. 2008, 22, 543–557. [Google Scholar] [CrossRef] [Scilit]
- Kang, J.-I.; Yoon, H.-S.; Kim, S.M.; Park, J.E.; Hyun, Y.J.; Ko, A.; Ahn, Y.-S.; Koh, Y.S.; Hyun, J.W.; Yoo, E.-S.; et al. Mackerel-Derived Fermented Fish Oil Promotes Hair Growth by Anagen-Stimulating Pathways. Int. J. Mol. Sci. 2018, 19, 2770. [Google Scholar] [CrossRef] [Scilit]
- Wu, Z.; Zhu, Y.; Liu, H.; Liu, G.; Li, F. Wnt10b promotes hair follicles growth and dermal papilla cells proliferation via Wnt/beta-Catenin signaling pathway in Rex rabbits. Biosci. Rep. 2020, 40, BSR20191248. [Google Scholar]
- Bowles, J.; Schepers, G.; Koopman, P. Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators. Dev. Biol. 2000, 227, 239–255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cermenati, S.; Moleri, S.; Cimbro, S.; Corti, P.; Del Giacco, L.; Amodeo, R.; Dejana, E.; Koopman, P.; Cotelli, F.; Beltrame, M. Sox18 and Sox7 play redundant roles in vascular development. Blood 2008, 111, 2657–2666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pennisi, D.; Gardner, J.; Chambers, D.; Hosking, B.; Peters, J.; Muscat, G.; Abbott, C.; Koopman, P. Mutations in Sox18 underlie cardiovascular and hair follicle defects in ragged mice. Nat. Genet. 2000, 24, 434–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carter, T.C.; Phillips, J.S. Ragged, a semidominant coat texture mutant. J. Hered. 1954, 45, 151–154. [Google Scholar] [CrossRef] [Scilit]
- Pennisi, D.; Bowles, J.; Nagy, A.; Muscat, G.; Koopman, P. Mice null for Sox18 are viable and display a mild coat defect. Mol. Cell Biol. 2000, 20, 9331–9336. [Google Scholar] [CrossRef] [Scilit]
- Slee, J. The morphology and development of ragged—A mutant affecting the skin and hair of the house mouse II. Genetics, Embryology and Gross Juvenile Morphology. J. Genet. 1957, 55, 570–584. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Wu, T.; Sun, J.; Li, Y.; Yuan, Z.; Sun, W. Single-Cell Transcriptomics Reveals the Molecular Anatomy of Sheep Hair Follicle Heterogeneity and Wool Curvature. Front. Cell Dev. Biol. 2021, 9, 800157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jahoda, C.A.B.; Reynolds, A.J.; Chaponnier, C.; Forester, J.C.; Gabbiani, G. Smooth muscle α-actin is a marker for hair follicle dermis in vivo and in vitro. J. Cell Sci. 1991, 99, 627–636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ge, W.; Zhang, W.; Zhang, Y.; Zheng, Y.; Li, F.; Wang, S.; Liu, J.; Tan, S.; Yan, Z.; Wang, L.; et al. A Single-cell Transcriptome Atlas of Cashmere Goat Hair Follicle Morphogenesis. Genom. Proteom. Bioinform. 2021, 19, 437–451. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Hu, T.; He, M.; Gu, Y.; Cao, X.; Yuan, Z.; Lv, X.; Getachew, T.; Quan, K.; Sun, W. Defining ovine dermal papilla cell markers and identifying key signaling pathways regulating its intrinsic properties. Front. Veter. Sci. 2023, 10, 1127501. [Google Scholar] [CrossRef] [Scilit]
- Yue, Z.; Liu, M.; Zhang, B.; Li, F.; Li, C.; Chen, X.; Li, F.; Liu, L. Vitamin A regulates dermal papilla cell proliferation and apoptosis under heat stress via IGF1 and Wnt10b signaling. Ecotoxicol. Environ. Saf. 2023, 262, 115328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Driskell, R.R.; Clavel, C.; Rendl, M.; Watt, F.M. Hair follicle dermal papilla cells at a glance. J. Cell Sci. 2011, 124, 1179–1182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Villani, R.; Hodgson, S.; Legrand, J.; Greaney, J.; Wong, H.Y.; Pichol-Thievend, C.; Adolphe, C.; Wainwight, B.; Francois, M.; Khosrotehrani, K. Dominant-negative Sox18 function inhibits dermal papilla maturation and differentiation in all murine hair types. Development 2017, 144, 1887–1895. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.; Li, J.; Xu, X.; Xu, Q.; Qin, C.; Liu, G.; Wei, C.; Zhang, G.; Tian, K.; Fu, X. Effect of the FA2H Gene on cashmere fineness of Jiangnan cashmere goats based on transcriptome sequencing. BMC Genom. 2022, 23, 527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, J.; Zhuo, H.; Chen, X.; Cheng, J.; Zheng, W.; Zhong, M.; Cai, J. MiR-139-5p negatively regulates PMP22 to repress cell proliferation by targeting the NF-kappaB signaling pathway in gastric cancer. Int. J. Biol. Sci. 2020, 16, 1218–1229. [Google Scholar] [CrossRef] [Scilit]
- Kidd, M.; Modlin, I.M.; Eick, G.N.; Camp, R.L.; Mane, S.M. Role of CCN2/CTGF in the proliferation of Mastomys enterochromaffin-like cells and gastric carcinoid development. Am. J. Physiol. Gastrointest Liver Physiol. 2007, 292, G191–G200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.; Liu, J.; Chen, T.; Wang, Y.; Shi, A.; Li, K.; Li, X.; Qiu, B.; Zheng, L.; Zhao, L.; et al. Wnt-TCF7-SOX9 axis promotes cholangiocarcinoma proliferation and pemigatinib resistance in a FGF7-FGFR2 autocrine pathway. Oncogene 2022, 41, 2885–2896. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Bai, Z.; Wen, X.; Du, H.; Zhou, L.; Tang, Z.; Yang, Z.; Ma, W. MiR-152-3p regulates cell proliferation, invasion and extracellular matrix expression through by targeting FOXF1 in keloid fibroblasts. Life Sci. 2019, 234, 116779. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Ren, C.-X.; Zhang, J.-M.; Xin, X.-Y.; Hua, T.; Wang, H.-B. The Effects of miR-195-5p/MMP14 on Proliferation and Invasion of Cervical Carcinoma Cells Through TNF Signaling Pathway Based on Bioinformatics Analysis of Microarray Profiling. Cell Physiol. Biochem. 2018, 50, 1398–1413. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Liu, W.-Z.; Liu, T.; Feng, X.; Yang, N.; Zhou, H.-F. Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J. Recept. Signal Transduct. Res. 2015, 35, 600–604. [Google Scholar] [CrossRef] [Scilit]
- Huang, Z.; Gao, H.; Qing, L.; Wang, B.; He, C.; Luo, N.; Lu, C.; Fan, S.; Gu, P.; Zhao, H. A long noncoding RNA GTF2IRD2P1 suppresses cell proliferation in bladder cancer by inhibiting the Wnt/beta-catenin signaling pathway. PeerJ 2022, 10, e13220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chuong, C.-M.; Patel, N.; Lin, J.; Jung, H.-S.; Widelitz, R.B. Sonic hedgehog signaling pathway in vertebrate epithelial appendage morphogenesis: Perspectives in development and evolution. Cell Mol. Life Sci. 2000, 57, 1672–1681. [Google Scholar] [CrossRef] [Scilit]
- Andl, T.; Reddy, S.T.; Gaddapara, T.; Millar, S.E. WNT signals are required for the initiation of hair follicle development. Dev. Cell 2002, 2, 643–653. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Y.; Xu, J.; Luo, H.; Meng, X.; Chen, M.; Zhu, D. Wnt signaling pathway in cancer immunotherapy. Cancer Lett. 2022, 525, 84–96. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Li, F.; Shi, Y.; Zhang, T.; Wang, X. Comprehensive Transcriptome Analysis of Hair Follicle Morphogenesis Reveals That lncRNA-H19 Promotes Dermal Papilla Cell Proliferation through the Chi-miR-214-3p/β-Catenin Axis in Cashmere Goats. Int. J. Mol. Sci. 2022, 23, 10006. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, M.; Lv, X.; Cao, X.; Yuan, Z.; Quan, K.; Getachew, T.; Mwacharo, J.M.; Haile, A.; Li, Y.; Wang, S.; et al. CRABP2 Promotes the Proliferation of Dermal Papilla Cells via the Wnt/β-Catenin Pathway. Animals 2023, 13, 2033. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [Scilit]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. EdgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, D.W.; Sherman, B.T.; Tan, Q.; Collins, J.R.; Alvord, W.G.; Roayaei, J.; Stephens, R.; Baseler, M.W.; Lane, H.C.; Lempicki, R.A. The DAVID Gene Functional Classification Tool: A novel biological module-centric algorithm to functionally analyze large gene lists. Genome Biol. 2007, 8, R183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Gene | Primer Sequence (5′–3′) | Product Size (bp) | Annealing Temperature (°C) | Accession Number |
|---|---|---|---|---|
| SOX18 | F: TGTGGGCGAAGGACGAGC R: GCCAAGCCTGGGAGGAGGAG | 253 | 60 | XM_027976914.2 |
| PCNA | F: CGAGGGCTTCGACACTTAC | 97 | 60 | XM_004014340.5 |
| R: GTCTTCATTGCCAGCACATT | ||||
| CDK2 | F: AGAAGTGGCTGCATCACAAG R: TCTCAGAATCTCCAGGGAATAG | 92 | 60 | NM_001142509.1 |
| CTNNB1 | F: GAGGACAAGCCACAGGATTAT | 101 | 60 | NM_001308590.1 |
| R: CCAAGATCAGCGGTCTCATT | ||||
| TCF4 | F: AACCCTTTCGCCCACCAA | 299 | 60 | XM_012103768.4 |
| R: CAGGCTGATTCATCCCAC | ||||
| LEF1 | F: CAGGTGGTGTTGGACAGATAA | 179 | 60 | XM_042251146.1 |
| R: ATGAGGGATGCCAGTTGTG | ||||
| c-MYC | F: CCCTACCCGCTCAACGACA | 295 | 60 | NM_001009426.1 |
| R: GGCTGTGAGGAGGTTTGC | ||||
| cyclinD1 | F: CCGAGGAGAACAAGCAGATC | 91 | 60 | XM_027959928.2 |
| R: GAGGGTGGGTTGGAAATG | ||||
| IGF1 | F: TGTGCTTGCTCGCCTTCA | 216 | 60 | XM_027965760.2 |
| R: AGTACATCTCCAGCCTCCTCA | ||||
| IL6 | F: CCTGGTGATGACTTCTGC | 361 | 60 | NM_001009392.1 |
| R: AGTTTCCTGATTTCCCTC | ||||
| LIF | F: AGTGCCAACAGCCTCTTTATC | 337 | 60 | XM_004017472.5 |
| R: GGCCGTAGGTCACATCCA | ||||
| TGFA | F: CAGCTTCCCACAGTCAGTTC | 318 | 60 | XM_027966972.2 |
| R: AGCAAGCAGTCCTTCCCT | ||||
| CRABP1 | F: TCGGAGAAGGCTTTGAGG | 160 | 60 | XM_027966972.2 |
| R: AGGATGAGTTCGTCGTTGG | ||||
| IGF2BP2 | F: TGTTGGTGCCATCATCGG | 314 | 60 | XM_042233496.1 |
| R: TTATCTTGGTCCCTGTCTCA | ||||
| PLAT | F: GGGGACTGCTACACTGGAAA | 322 | 60 | XM_012106011.3 |
| R: TGATGTCGGCGAAGAGGC | ||||
| SCN1B | F: AGAAGGGCACAGAGGAGTTT | 207 | 60 | XM_004015635.5 |
| R: CGAAGAAGAGCAGGCGGTA | ||||
| GAPDH | F: TCTCAAGGGCATTCTAGGCTAC | 151 | 60 | NM_001190390.1 |
| R: GCCGAATTCATTGTCGTACCAG |
| Primer Name | Primer Sequence (5′–3′) | Product Size (bp) | Annealing Temperature (°C) |
|---|---|---|---|
| OE-SOX18 | F: CTAGCGTTTAAACTTAAGCTT ATGCAGAGATCGCCGCTCG | 1176 | 62 |
| R: CCACACTGGACTAGTGGATCCCTATCCAGAGATGCAGGCGCTG |
| Fragment Name | Sequence (5′–3′) |
|---|---|
| siRNA-1892 | GCAAGGCAUGGAAGGAGCUTT |
| AGCUCCUUCCAUGCCUUGCTT | |
| siRNA-2537 | ACCAGUACCUCAACUGCAGTT |
| CUGCAGUUGAGGUACUGGUTT | |
| siRNA-2672 | GCUCUGCUGUCUACUACAGTT |
| CUGUAGUAGACAGCAGAGCTT | |
| siRNA-NC | UUCUCCGAACGUGUCACGUTT |
| ACGUGACACGUUCGGAGAATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, M.; Lv, X.; Cao, X.; Yuan, Z.; Getachew, T.; Li, Y.; Wang, S.; Sun, W. SOX18 Promotes the Proliferation of Dermal Papilla Cells via the Wnt/β-Catenin Signaling Pathway. Int. J. Mol. Sci. 2023, 24, 16672. https://doi.org/10.3390/ijms242316672
He M, Lv X, Cao X, Yuan Z, Getachew T, Li Y, Wang S, Sun W. SOX18 Promotes the Proliferation of Dermal Papilla Cells via the Wnt/β-Catenin Signaling Pathway. International Journal of Molecular Sciences. 2023; 24(23):16672. https://doi.org/10.3390/ijms242316672
Chicago/Turabian StyleHe, Mingliang, Xiaoyang Lv, Xiukai Cao, Zehu Yuan, Tesfaye Getachew, Yutao Li, Shanhe Wang, and Wei Sun. 2023. "SOX18 Promotes the Proliferation of Dermal Papilla Cells via the Wnt/β-Catenin Signaling Pathway" International Journal of Molecular Sciences 24, no. 23: 16672. https://doi.org/10.3390/ijms242316672
APA StyleHe, M., Lv, X., Cao, X., Yuan, Z., Getachew, T., Li, Y., Wang, S., & Sun, W. (2023). SOX18 Promotes the Proliferation of Dermal Papilla Cells via the Wnt/β-Catenin Signaling Pathway. International Journal of Molecular Sciences, 24(23), 16672. https://doi.org/10.3390/ijms242316672

