Next Article in Journal
Understanding the Role of Oxidative Stress, Neuroinflammation and Abnormal Myelination in Excessive Aggression Associated with Depression: Recent Input from Mechanistic Studies
Previous Article in Journal
Leukocyte Telomere Length Predicts Severe Disability in Relapsing-Remitting Multiple Sclerosis and Correlates with Mitochondrial DNA Copy Number
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 2
10.3390/ijms24020906
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Overexpression of Liriodenron WOX5 in Arabidopsis Leads to Ectopic Flower Formation and Altered Root Morphology

by
Dandan Wang
†,
Xiaoxiao Ma
†,
Zhaodong Hao
,
Xiaofei Long
,
Jisen Shi
and
Jinhui Chen
*
Key Laboratory of Forest Genetics & Biotechnology of Ministry of Education, Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2023, 24(2), 906; https://doi.org/10.3390/ijms24020906
Submission received: 17 November 2022 / Revised: 23 December 2022 / Accepted: 26 December 2022 / Published: 4 January 2023
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Review Reports Versions Notes

Abstract

:
Roots are essential for plant growth, and studies on root-related genes, exemplified by WUSCHEL-RELATED HOMEOBOX5 (WOX5), have mainly concentrated on model organisms with less emphasis on the function of these genes in woody plants. Here, we report that overexpression of the WOX5 gene from Liriodendron hybrid (LhWOX5) in Arabidopsis leads to significant morphological changes in both the aerial and subterranean organs. In the Arabidopsis aerial parts, overexpression of LhWOX5 results in the production of ectopic floral meristems and leaves, possibly via the ectopic activation of CLV3 and LFY. In addition, in the Arabidopsis root, overexpression of LhWOX5 alters root apical meristem morphology, leading to a curled and shortened primary root. Importantly, these abnormal phenotypes in the aerial and subterranean organs caused by constitutive ectopic expression of LhWOX5 mimic the observed phenotypes when overexpressing AtWUS and AtWOX5 in Arabidopsis, respectively. Taken together, we propose that the LhWOX5 gene, originating from the Magnoliaceae plant Liriodendron, is a functional homolog of the AtWUS gene from Arabidopsis, while showing the highest degree of sequence similarity with its ortholog, AtWOX5. Our study provides insight into the potential role of LhWOX5 in the development of both the shoot and root.

1. Introduction

The WUSCHEL HOMEOBOX (WOX) gene family is found only in plants and plays an important role in plant development and growth [1,2]. Two signaling loops critical for plant development are the WUSCHEL/CLAVATA3 (WUS/CLV3) and WUSCHELRELATED HOMEOBOX 5/CLAVATA3/ESR-RELATED40 (WOX5/CLE40) pathways, which both have a member of the WOX gene family at their center and are known for their important roles in shoot and root apical meristem maintenance, respectively [3,4]. In addition, WUS is involved in the maintenance of floral meristems, together with a collection of other developmental genes such as AGAMOUS (AG), KNUCKLES (KNU), CLV3, and LEAFY (LFY), which regulate the complete flowering pathway [5,6]. Of the genes mentioned above, LFY is involved in the first step of the transition from vegetative to reproductive development [7]. To be more specific, LFY induces floral meristem development and controls their morphology by activating floral organ identity genes such as AG [5,8].
It has been demonstrated that AtWUS can substitute for WOX5 when expressed in the quiescent center (QC) of the root apical meristem and vice versa, but they are interchangeable only in stem cell maintenance [9]. WOX5/7 of Arabidopsis is a pair of genes with a high degree of homology [2]. WOX5 is involved not only in the development of primary and lateral roots but also in leaf medio-lateral axis formation [10]. Whereas WOX7 was found to be involved in the development of lateral roots in response to sugar, the number of lateral root primordia was increased in a wox7 mutant but reduced upon over-expressing WOX7 [11].
Overexpression of AtWOX5 resulted in the absence of starch granules, which are involved in gravitropic sensing, in the differentiated column cell zone, whereas in the wox5 mutant, column stem cells become differentiated and contain starch granules [9]. It was subsequently confirmed that the WOX5-IAA17 (indole-3-acetic acid 17) feedback circuit mediates the maintenance of the auxin gradient in the root tip, which is crucial for the patterning of root stem cell niches in Arabidopsis. [12]. Furthermore, WOX5 functions together with TOPLESS/TOPLESS-RELATED (TPL/TPR) co-repressors and HISTONE DEACETYLASE 19 (HDA19) to silence the differentiation factor CYCLING DOF FACTOR 4 (CDF4) and regulate stem cell maintenance [13].
Heterologous expression of Arabidopsis WOX5/WUS in tobacco can significantly alter the morphology of the tobacco root tip and induce adventitious shoot formation within the root region, which is similar to the phenotype of WUS overexpressing tobacco itself [14,15,16]. Because of the importance of the WOX5 gene in root tip development in Arabidopsis, many functional studies of WOX5 in other species have also been reported. For example, QUIESCENT-CENTER-SPECIFIC HOMEOBOX (QHB), a WOX5 ortholog in rice, is expressed in the QC and metaxylem, while a similar CLE-WOX regulatory loop as is present in Arabidopsis functions in the root apical meristem in rice [17]. Over-expressed PtWOX5 in Populus trichocarpa promotes lateral root organogenesis but inhibits lateral root growth by restricting cell division and suppressing differentiation-related genes such as D-type cyclins (CYCD) [18]. Interestingly, overexpression of wheat TaWOX5 can reduce genotype dependence during wheat gene transformation while improving the efficiency of genetic transformation and genome editing in wheat and other crops, which is an important aspect in the application of the WOX5 gene [19].
There are many reports on WOX5 function in various crops, as mentioned above, but limited research has been performed on the WOX5 ortholog in woody plants, especially in non-model organisms. Liriodendron is widely distributed in Eastern North America [20] and has a high commercial value in China [21]. Liriodendron belongs to the Magnoliidae family, which takes up an evolutionarily intermediate position in between basal angiosperms and eudicots [20]. The study of Liriodendron may help us better understand the functional diversification of genes during plant evolution. Moreover, Liriodendron has a mature somatic embryogenesis and transgenesis system [21], making it an ideal woody plant. Although transgenic Liriodendron can be obtained through gene transformation, it requires significantly more time than the quintessential model plant, Arabidopsis.
Here, we performed functional studies on LhWOX5 by expressing it heterologously in Arabidopsis, comparing a WOX5 gene originating from magnoliids to its eudicot counterpart. We provide evidence that LhWOX5 shares functional homology not only with AtWOX5 but also with AtWUS, suggesting that both Arabidopsis genes may have diverged from an ancestral gene that combined both of their functionalities. Hypothetically, the dramatic phenotype caused by LhWOX5 overexpression, being the ectopic induction of floral organs, could be applied in an industrial setting to stimulate flower production in i.e., ornamental plants.

2. Results

2.1. Identification and Tissue-Specific Expression Pattern Analysis of LhWOX5

To identify the WOX5 ortholog protein in Liriodendron, we searched the genome [20] and transcriptome of Liriodendron using the WOX5/7 protein sequences from Arabidopsis thaliana, Vitis vinifera, and Oryza sativa as queries. We identified a putative WOX5 gene and, through protein sequence alignment, found that this gene contains the typical conserved HD domain and shares the same WUS-box (amino acids, TLLFP) with the WOX5 genes from rice, Arabidopsis, and grape [1,2] (Figure 1A). Furthermore, a phylogenetic tree showed that this candidate gene from Liriodendron belongs to the WOX5 clade (Figure 1B). Therefore, we named this protein LhWOX5.
To examine the expression pattern of LhWOX5 in Liriodendron hybrid seedlings, we collected several major tissues for quantitative reverse transcription PCR (qRT-PCR) analysis. We found that LhWOX5 is expressed most strongly in the bud, followed by the root and stalk, with the lowest expression observed in the leaf (Figure 2A). This suggests that LhWOX5 may function in root and shoot development.

2.2. LhWOX5 Overexpression Causes Ectopic Organogenesis in the Arabidopsis Rosette, Leaf, and Stalk

To further investigate the function of LhWOX5, we overexpressed this gene in Arabidopsis using the 35S cauliflower mosaic virus promoter. More than 50% of the T1 generation plants displayed flower buds and new leaves on the veins of rosette leaves and a curly stalk with undetermined hyperplasia (Figure 3A–D). From the T2 generation, we counted 102 plants from three individual lines (T2-1, T2-2, and T2-3) and found that 45% of the plants showed incomplete cotyledons, 53% showed curled stalks, 45% showed rosette leaves with ectopic leaves and flower buds, and 21% of the plants showed fused stalks (Figure 3E–H). It shows that the transgene-induced phenotype can be passed down from the T1 to the T2 generation.
To investigate whether shoot architecture had been altered or not, we counted the number of branches, inflorescences, and rosette leaves, then determined plant height for the overexpression lines (Table 1). The number of leaves and plant height were not significantly different in the overexpression lines in comparison to the control lines, and only a single overexpression line showed an increased number of branches and inflorescences, respectively (Table 1). Taken together, these results show that overexpression of LhWOX5 not only promotes new organs on the abaxial side of leaves but also slightly affects the number of branches and inflorescences in different lines.

2.3. LhWOX5 Overexpression Leads to the Transcriptional Upregulation of LFY and CLV3

We wondered what specific genes might be responsible for ectopic flowers and leaves induced by LhWOX5 overexpression. We focused on the CLV3 and LFY genes because of their importance in floral and shoot meristem identity, respectively. LFY participates in the formation of floral meristem identity and is strongly expressed in floral primordia [22,23], while CLV3, a marker for the shoot meristem, forms a regulatory loop with WUS for shoot apical meristem maintenance [24]. We collected tissues as shown in Figure 4B–G and analyzed LFY and CLV3 expression levels via qRT-PCR. We found that the expression of LFY and CLV3 was significantly increased (Figure 4A), suggesting that the formation of ectopic organs on leaf veins is likely due to the abnormal expression of LFY and CLV3, which was induced by LhWOX5.

2.4. LhWOX5 Overexpression Affects Arabidopsis Root Morphology and Root Length

It is well known that the WOX5 gene is associated with root development, and our preliminary data shows that LhWOX5 is indeed expressed in roots (Figure 2A). We therefore asked whether overexpression of LhWOX5 affects root development and morphology. Thus, we examined the phenotype of the roots using LhWOX5 overexpressing plants of the T3-generation. The overexpression lines showed 30–60% curly roots (Figure 5A–D, Table 2) in 8-day seedlings, suggesting changes in root morphology. Meanwhile, 4.70% (12/254) of the overexpression lines have a flower-like shoot structure growing from their root (Figure S1). We also found that the root length was significantly reduced in all three transgenic lines (Figure 5E). We observed 5–7 days root tips and found that the cells of overexpression root tips are not as well layered as in the wild type (Figure 6). In overexpressing lines, we found that there are more undifferentiated cells and fewer starch grains present in the root apical areas, which might account for the observed root tip curling Figure 6 and Figure S2).

3. Discussion

Plant roots are fundamental for plant growth, and their morphology strongly influences their ability to absorb nutrients and water. A stable root system can ensure that woody plants grow to form wood or produce fruit. Several factors have been found to affect root growth in the model organism Arabidopsis thaliana [25]. WOX5, a member of the WOX family, has been intensively studied because of its important role in root stem cell niche maintenance. In woody plants, Li et al. found that PtWOX5 in poplar promotes lateral root initiation but inhibits lateral root growth [18]. However, similar studies in woody plants are relatively rare due to their long life cycles and the fact that transgenesis is still uncommon. Here, we identified a single copy of the WOX5 gene in a Liriodendron hybrid and performed a pilot study on the function of this gene by overexpressing it in Arabidopsis through a heterologous expression system.
Although previous studies have demonstrated that WOX5 has an important role in root development in many different plant species [9,14,18,19,26,27], we found that the expression pattern of LhWOX5 is not the highest in the root of Liriodendron hybrid. The highest LhWOX5 expression is present in the bud, suggesting that WOX5 may not only affect root development but also shoot apical formation in this species.
Overexpression of LhWOX5 in Arabidopsis activates ectopic leaf and floral formation from the rosette leaves, as well as ectopic cell proliferation at curled stalk sites (Figure 3), a phenotype that is similar to that of AtWUS overexpression in Arabidopsis, which can induce ectopic flower buds on non-reproductive organs [28], suggesting that LhWOX5 may function similarly to AtWUS in converting nutritive organs to reproductive organs in Arabidopsis.
Overexpression of LhWOX5 in Arabidopsis promotes the expression of a set of meristem-related genes, such as AtCLV3 and AtLFY. Notably, we found AtLFY to be expressed at an exceptionally high level, which might be related to the fact that we collected materials with numerous ectopic flower buds rather than ectopic leaves. Furthermore, overexpression of AtWUS in Arabidopsis elevated expression of AtCLV3, AtLFY, and AtAG [28]. AtLFY promotes the transition from vegetative to reproductive organs and the differentiation of floral meristems [22,29]. It is expressed at subsequent stages of floral development, which may explain the production of ectopic floral buds in both AtWUS and LhWOX5 overexpressed lines [28]. In fact, when AtLFY is overexpressed in Arabidopsis, ectopic flowers develop at the base of rosette leaves [23]. These data suggest that LhWOX5 may share functional homology with AtWUS in initiating floral meristems on non-reproductive organs in Arabidopsis and that they may accomplish this process via inducing AtLFY expression.
We found root length to be significantly shorter in all OE-LhWOX5 lines compared to WT (Figure 5E). This could be explained due to stem cell production being increased in the root tip, causing less differentiation to occur and the root to grow abnormally (Figure 6 and Figure S2), as it does upon AtWOX5 overexpression in Arabidopsis (Figure S2) [25]. The morphology of the root tip was altered, with a reduced number of starch grains (Figure 6 and Figure S2), a defect that may lead to loss of gravitropic sensing and a curly root phenotype, a phenotype that is also similar to that observed upon AtWOX5 overexpression in Arabidopsis [9,25]. Moreover, OE-AtWOX5 induced nutrient leaf growth in rosette leaves [25], analogous to the OE-LhWOX5 phenotype (Figure 3). These findings suggest functional similarity between AtWOX5 and LhWOX5.
Thus, heterologous expression of the LhWOX5 gene in Arabidopsis causes very similar phenotypes to those of overexpressed AtWUS and AtWOX5, implying a biochemical functional similarity. We propose that the LhWOX5 protein in Liriodendron may combine the functions of both the AtWUS and AtWOX5 proteins from Arabidopsis, as it affects the development of the root apical meristem and the formation of floral meristems equally.
We found LhWOX5 overexpression to have a dramatic effect on plant architecture, leading to the overproduction of floral organs as well as the alteration of shoot and root morphology. Potentially, being able to increase the floral organ production can be very useful for certain industrial applications of plants, for example in the ornamental sector or in fruit crops/trees. Furthermore, members of the WOX gene family have been shown to contribute to a plant’s ability to cope with stress via direct control of root growth, such as in poplar, where PagWOX11/12a stimulates root elongation and biomass growth, helping it to resist drought [30]. Therefore, LhWOX5 may prove to have industrial applicability in the plant biotechnology sector in the future.

4. Materials and Methods

4.1. Plant Materials and Growth Conditions

Arabidopsis thaliana Columbia ecotype-0 (Col-0) and J2341 were provided by Prof. Thomas Laux (Signalling Research Centres BIOSS and CIBSS, Faculty of Biology, University of Freiburg, Germany). Wild type (Col-0), T3 generation, J2341, p35S: AtWOX5 in J2341 seeds were cultured on 1/2 MS medium without antibiotic selection (kanamycin), while three overexpression (T1/T2 generation) lines were cultured on 1/2 MS medium containing 50 mg/L kanamycin. After 2 days of cold stratification, all seeds were germinated in an incubator. Plants were transplanted onto soil after the first pair of true leaves appeared and placed in an incubator. Growth conditions were 22 °C with a 16 h light/8 h dark cycle and 70% humidity [31].

4.2. Identification of the LhWOX5 Gene

To identify the LhWOX5 gene, we retrieved sequences of WOX5 and its close homolog WOX7 from Arabidopsis thaliana, Amborella trichopoda, Vitis vinifera, and Oryza sativa (http://planttfdb.gao-lab.org/index.php) and compared these WOX5 sequences with the genome [20] and transcriptome (unpublished) of Liriodendron by a local blast to find candidate genes. The candidate sequences were then aligned with the WOX5 amino acid sequences from the species mentioned above by MAFFT [32]. Texshade [33] was used to visualize conserved domains. Multiple full-length sequences (the candidate sequences with all WOXs from Arabidopsis thaliana, Amborella trichopoda, Selaginella moellendorffii, Physcomitrella patens subsp. patens, Populus trichocarpa, and Vitis vinifera (http://planttfdb.gao-lab.org/index.php) (accessed on 10 October 2022) were aligned using MAFFT [32]. RAxML v8.2.11 [34] was used to construct a phylogenetic tree with the PROTGAMMAAUTO mode and 1000 bootstrap replications to determine to which branch the candidate sequences belonged.

4.3. qRT-PCR Analysis

Material derived from four Liriodendron hybrid seedling tissues (leaf, shoot apex (1 cm), shoot (1 cm), and root (1 cm); Figure 3) was collected for the analysis of the LhWOX5 gene expression pattern. Total RNA was obtained using a Bioteke plant total RNA extraction kit (RP3301). Quantitative real-time PCR (qRT-PCR) reactions were performed using the Vazyme AceQ qPCR SYBR Green Master Mix (without ROX) (Q121-02) on a LightCycler 480 II (Roche). For each sample, three technical and biological replicates were used, and the result was normalized with 18S rRNA as a reference.
The same qRT-PCR protocol was applied for expression analysis in LhWOX5 overexpressing lines. Rosette leaves with flower buds and leaves and curly stems with undetermined hyperplasia were collected, using UBQ10 as an internal reference. The primers used for qRT-PCR are listed in Table S1. Expression data were calculated using the Livak calculation method [35] and visualized by GraphPad Prism 8 (https://www.graphpad-prism.cn/) (accessed on 25 Octorber 2022).

4.4. Gene Cloning, Transformation, and Screening of Transgenic Plants

Based on the LhWOX5 gene sequence we obtained in the previous step, we designed primers (LhW5F: GAAGATCCGATCATAGAAACAGAG and LhW5R: CTCAGATTGGAATCGTATCCG) and extracted RNA from a Liriodendron hybrid leaf from the campus of Nanjing Forestry University (Nanjing, China). LhWOX5 cDNA was then cloned into pBI121 to generate the p35S:LhWOX5 vector. The vector was transformed into the Agrobacterium strain GV3101 and subsequently into wild type Arabidopsis (Col-0) using the floral dip transformation method [31]. Transgenic plants were grown on kanamycin-containing selection medium, then PCR tested using specific primers (35S-F: TGAAGATAGTGGAAAAGGAAGGTG and LhW5R: CTCAGATTGGAATCGTATCCG) to confirm the presence of the transgene.

4.5. Data Analysis and Microscopy

Statistical analysis was performed using IBM SPSS Statistics (26) and bar charts were visualized with GraphPad Prism 8. Microscopy analysis of 5–7 days root was performed using 10% glycerin/10 mg/mL propidium iodide (PI) [13] as mounting solution with a Zeiss LSM 800 system. Starch granules in the 5–7 days root apical region were visualized with 1% lugol solution [36] on a Zeiss Axio Vert A1 microscope.

5. Conclusions

In summary, we identified and cloned the LhWOX5 gene in Liriodendron and overexpressed it in Arabidopsis, identifying strong phenotypes in both the aerial and subterranean parts of transgenic plants. First, in the aerial parts, the overexpression of LhWOX5 induced ectopic floral meristems and even the formation of mature flowers, while in the root, it caused an altered root apical cell morphology, resulting in curly roots. These phenotypes mimic those of overexpressed Arabidopsis AtWUS and AtWOX5, respectively. We propose that LhWOX5 from Liriodendron may combine the functionality of Arabidopsis AtWUS and AtWOX5. Such findings suggest that the WOX genes in woody plants may have a more complex functionality than their herbaceous plant homologues and provide a basis for us to investigate the function of LhWOX5 in Liriodendron. Furthermore, we speculate that heterologous expression of this gene may prove to be a useful application in the ornamental plant and fruit tree cultivation sectors in the future.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24020906/s1.

Author Contributions

Conceptualization, J.S. and J.C.; data curation, D.W.; formal analysis, D.W.; investigation, X.M.; methodology, D.W. and X.M.; software, Z.H.; supervision, J.S. and J.C.; visualization, D.W. and X.M.; writing—original draft, D.W. and X.M.; writing—review and editing, Z.H., X.L., J.S. and J.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key R&D Program of China (2021YFD2200103), the Nature Science Foundation of China (32071784), the Youth Foundation of the Natural Science Foundation of Jiangsu Province (Grant No. BK20210614), and the Priority Academic Program Development of the Jiangsu Higher Education Institutions (PAPD).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are available within the article or upon request from the corresponding author.

Acknowledgments

The authors wish to thank the editor and reviewers for their helpful comments and suggestions.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhang, X.; Zong, J.; Liu, J.; Yin, J.; Zhang, D. Genome-wide analysis of WOX gene family in rice, sorghum, maize, Arabidopsis and poplar. J. Integr. Plant Biol. 2010, 52, 1016–1026. [Google Scholar] [CrossRef] [PubMed]
  2. Dolzblasz, A.; Nardmann, J.; Clerici, E.; Causier, B.; van der Graaff, E.; Chen, J.; Davies, B.; Werr, W.; Laux, T. Stem Cell Regulation by Arabidopsis WOX Genes. Mol. Plant 2016, 9, 1028–1039. [Google Scholar] [CrossRef] [PubMed]
  3. Schoof, H.; Lenhard, M.; Haecker, A.; Mayer, K.F.X.; Jürgens, G.; Laux, T. The Stem Cell Population of Arabidopsis Shoot Meristems Is Maintained by a Regulatory Loop between the CLAVATA and WUSCHEL Genes. Cell 2000, 100, 635–644. [Google Scholar] [CrossRef] [Green Version]
  4. Stahl, Y.; Wink, R.H.; Ingram, G.C.; Simon, R. A signaling module controlling the stem cell niche in Arabidopsis root meristems. Curr. Biol. 2009, 19, 909–914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Sablowski, R. Flowering and determinacy in Arabidopsis. J. Exp. Bot. 2007, 58, 899–907. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Kwaśniewska, K.; Breathnach, C.; Fitzsimons, C.; Goslin, K.; Thomson, B.; Beegan, J.; Finocchio, A.; Prunet, N.; Ó’Maoiléidigh, D.S.; Wellmer, F. Expression of KNUCKLES in the Stem Cell Domain Is Required for Its Function in the Control of Floral Meristem Activity in Arabidopsis. Front. Plant Sci. 2021, 12, 1479. [Google Scholar] [CrossRef]
  7. Hempel, F.; Weigel, D.; Mandel, M.; Ditta, G.; Zambryski, P.; Feldman, L.; Yanofsky, M. Floral determination and expression of floral regulatory genes in Arabidopsis. Development 1997, 124, 3845–3853. [Google Scholar] [CrossRef]
  8. Moyroud, E.; Tichtinsky, G.; Parcy, F. The LEAFY Floral Regulators in Angiosperms: Conserved Proteins with Diverse Roles. J. Plant Biol. 2009, 52, 177–185. [Google Scholar] [CrossRef]
  9. Sarkar, A.K.; Luijten, M.; Miyashima, S.; Lenhard, M.; Hashimoto, T.; Nakajima, K.; Scheres, B.; Heidstra, R.; Laux, T. Conserved factors regulate signalling in Arabidopsis thaliana shoot and root stem cell organizers. Nature 2007, 446, 811–814. [Google Scholar] [CrossRef]
  10. Zhang, Z.; Runions, A.; Mentink, R.A.; Kierzkowski, D.; Karady, M.; Hashemi, B.; Huijser, P.; Strauss, S.; Gan, X.; Ljung, K.; et al. A WOX/Auxin Biosynthesis Module Controls Growth to Shape Leaf Form. Curr. Biol. 2020, 30, 4857–4868.e6. [Google Scholar] [CrossRef]
  11. Kong, D.; Hao, Y.; Cui, H. The WUSCHEL Related Homeobox Protein WOX7 Regulates the Sugar Response of Lateral Root Development in Arabidopsis thaliana. Mol. Plant 2016, 9, 261–270. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Tian, H.; Wabnik, K.; Niu, T.; Li, H.; Yu, Q.; Pollmann, S.; Vanneste, S.; Govaerts, W.; Rolcik, J.; Geisler, M.; et al. WOX5-IAA17 feedback circuit-mediated cellular auxin response is crucial for the patterning of root stem cell niches in Arabidopsis. Mol. Plant 2014, 7, 277–289. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Pi, L.; Aichinger, E.; van der Graaff, E.; Llavata-Peris, C.I.; Weijers, D.; Hennig, L.; Groot, E.; Laux, T. Organizer-Derived WOX5 Signal Maintains Root Columella Stem Cells through Chromatin-Mediated Repression of CDF4 Expression. Dev. Cell 2015, 33, 576–588. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Rashid, S.Z.; Kyo, M. Ectopic Expression of WOX5 Dramatically Alters Root-tip Morphology in Transgenic Tobacco. Transgenic Plant J. 2009, 3, 92–96. [Google Scholar]
  15. Rashid, S.Z.; Yamaji, N.; Kyo, M. Shoot formation from root tip region: A developmental alteration by WUS in transgenic tobacco. Plant Cell Rep. 2007, 26, 1449–1455. [Google Scholar] [CrossRef]
  16. Rashid, S.Z.; Kyo, M. In Vivo Functional Assay of WUS Ortholog in Tobacco. Int. Symp. Cult. Hortic. Breed. 2009, 829, 161–166. [Google Scholar] [CrossRef]
  17. Chu, H.; Liang, W.; Li, J.; Hong, F.; Wu, Y.; Wang, L.; Wang, J.; Wu, P.; Liu, C.; Zhang, Q.; et al. A CLE-WOX signalling module regulates root meristem maintenance and vascular tissue development in rice. J. Exp. Bot. 2013, 64, 5359–5369. [Google Scholar] [CrossRef] [Green Version]
  18. Li, J.; Zhang, J.; Jia, H.; Liu, B.; Sun, P.; Hu, J.; Wang, L.; Lu, M. The WUSCHEL-related homeobox 5a (PtoWOX5a) is involved in adventitious root development in poplar. Tree Physiol. 2018, 38, 139–153. [Google Scholar] [CrossRef] [Green Version]
  19. Wang, K.; Shi, L.; Liang, X.; Zhao, P.; Wang, W.; Liu, J.; Chang, Y.; Hiei, Y.; Yanagihara, C.; Du, L.; et al. The gene TaWOX5 overcomes genotype dependency in wheat genetic transformation. Nat. Plants 2022, 8, 110–117. [Google Scholar] [CrossRef]
  20. Chen, J.; Hao, Z.; Guang, X.; Zhao, C.; Wang, P.; Xue, L.; Zhu, Q.; Yang, L.; Sheng, Y.; Zhou, Y.; et al. Liriodendron genome sheds light on angiosperm phylogeny and species-pair differentiation. Nat. Plants 2019, 5, 18–25. [Google Scholar] [CrossRef] [Green Version]
  21. Li, M.; Wang, D.; Long, X.; Hao, Z.; Lu, Y.; Zhou, Y.; Peng, Y.; Cheng, T.; Shi, J.; Chen, J. Agrobacterium-Mediated Genetic Transformation of Embryogenic Callus in a Liriodendron Hybrid (L. Chinense × L. Tulipifera). Front. Plant Sci. 2022, 13, 802128. [Google Scholar] [CrossRef] [PubMed]
  22. Weigel, D.; Alvarez, J.; Smyth, D.R.; Yanofsky, M.F.; Meyerowitz, E.M. LEAFY controls floral meristem identity in Arabidopsis. Cell 1992, 69, 843–859. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Chahtane, H.; Zhang, B.; Norberg, M.; LeMasson, M.; Thévenon, E.; Bakó, L.; Benlloch, R.; Holmlund, M.; Parcy, F.; Nilsson, O.; et al. LEAFY activity is post-transcriptionally regulated by BLADE ON PETIOLE2 and CULLIN3 in Arabidopsis. New Phytol. 2018, 220, 579–592. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Laux, T.; Mayer, K.F.; Berger, J.; Jurgens, G. The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 1996, 122, 87–96. [Google Scholar] [CrossRef] [PubMed]
  25. Su, Y.H. Screening of PLT2 Interacting Proteins/Genes and Functional Analysis of WOX5 in Arabidopsis. Master’s Thesis, Chongqing Normal University, Chongqing, China, 2018. [Google Scholar]
  26. Zhao, S.; Jiang, Q.T.; Ma, J.; Zhang, X.W.; Zhao, Q.Z.; Wang, X.Y.; Wang, C.S.; Cao, X.; Lu, Z.X.; Zheng, Y.L.; et al. Characterization and expression analysis of WOX5 genes from wheat and its relatives. Gene 2014, 537, 63–69. [Google Scholar] [CrossRef]
  27. Xu, S.; Zeng, B.; Fan, C. Expression Analysis and Molecular Cloning of WOX5 in Eucalyptus grandis and Over-expression Vector Constructed. Chin. J. Trop. Crops 2014, 35, 1957–1962. [Google Scholar] [CrossRef]
  28. Wang, X.M. Analysis of A Gain-Of-Function Mutant Sef in Arabidopsis. Ph.D. Thesis, Institute of Botany, The Chinese Academy of Sciences, Beijing, China, 2006. [Google Scholar]
  29. Blázquez, M.; Soowal, L.; Lee, I.; Weigel, D. LEAFY expression and flower initiation in. Development 1997, 124, 3835–3844. [Google Scholar] [CrossRef]
  30. Wang, L.-Q.; Li, Z.; Wen, S.-S.; Wang, J.-N.; Zhao, S.-T.; Lu, M.-Z. WUSCHEL-related homeobox gene PagWOX11/12a responds to drought stress by enhancing root elongation and biomass growth in poplar. J. Exp. Bot. 2020, 71, 1503–1513. [Google Scholar] [CrossRef]
  31. Bent, A. Arabidopsis thaliana floral dip transformation method. Methods Mol. Biol. 2006, 343, 87–103. [Google Scholar] [CrossRef]
  32. Katoh, K.; Misawa, K.; Kuma, K.-i.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef] [Green Version]
  33. Beitz, E. TEXshade: Shading and labeling of multiple sequence alignments using LATEX2 epsilon. Bioinformatics 2000, 16, 135–139. [Google Scholar] [CrossRef] [PubMed]
  34. Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [Green Version]
  35. Livak, K.J. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods A Companion Methods Enzymol. 2001, 4, 402–408. [Google Scholar] [CrossRef] [PubMed]
  36. Willemsen, V.; Wolkenfelt, H.; Vrieze, G.D.; Weisbeek, P.; Scheres, B. The HOBBIT gene is required for formation of the root meristem in the Arabidopsis embryo. Development 1998, 125, 521–531. [Google Scholar] [CrossRef] [PubMed]
Ijms 24 00906 g001 550
Figure 1. The identification of LhWOX5 in Liriodendron hybrids. (A) Protein sequences from Arabidopsis thaliana (AT3G11260.1_WOX5 and AT5G05770.1_WOX7), Amborella trichopoda (AmTr_00029.349_WOX5), Vitis vinifera (GSVIVT01016360001_WOX5), and Oryza sativa (LOC_Os01g62310.1_WOX5 and LOC_Os01g47710.1_WOX7) were aligned. The conserved Homeodomain (HD domain) [1] and WUS-box [2] are shown. (B) Phylogeny of the WOX gene family from various species. WOX genes from Arabidopsis thaliana, Amborella trichopoda, Selaginella moellendorffii, Physcomitrella patens subsp. patens, Populus trichocarpa, and Vitis vinifera were used to construct the phylogenetic tree.
Figure 1. The identification of LhWOX5 in Liriodendron hybrids. (A) Protein sequences from Arabidopsis thaliana (AT3G11260.1_WOX5 and AT5G05770.1_WOX7), Amborella trichopoda (AmTr_00029.349_WOX5), Vitis vinifera (GSVIVT01016360001_WOX5), and Oryza sativa (LOC_Os01g62310.1_WOX5 and LOC_Os01g47710.1_WOX7) were aligned. The conserved Homeodomain (HD domain) [1] and WUS-box [2] are shown. (B) Phylogeny of the WOX gene family from various species. WOX genes from Arabidopsis thaliana, Amborella trichopoda, Selaginella moellendorffii, Physcomitrella patens subsp. patens, Populus trichocarpa, and Vitis vinifera were used to construct the phylogenetic tree.
Ijms 24 00906 g001
Ijms 24 00906 g002 550
Figure 2. Relative expression of LhWOX5 in Liriodendron hybrids. (A) Relative expression levels of LhWOX5 in different tissues. (B–E) Different tissues were collected from 3-month-old plants for qRT-PCR, indicated as (B) root, (C) bud, (D) stalk (only the orange area was used for sampling), and (E) leaf. Scale bars = 1 cm.
Figure 2. Relative expression of LhWOX5 in Liriodendron hybrids. (A) Relative expression levels of LhWOX5 in different tissues. (B–E) Different tissues were collected from 3-month-old plants for qRT-PCR, indicated as (B) root, (C) bud, (D) stalk (only the orange area was used for sampling), and (E) leaf. Scale bars = 1 cm.
Ijms 24 00906 g002
Ijms 24 00906 g003 550
Figure 3. The phenotypes of p35S:LhWOX5 (LhWOX5-OE) transgenic Arabidopsis. Hand-drawn images showing transgenic (OE line) and wild type (WT) plants. (a) Ectopic flower buds growing on rosette leaf veins. (b) Ectopic leaves growing on rosette leaf veins. (c) Curly stalk. (d) Incomplete cotyledon. (A–D) Phenotypes of T1-generation plants. (A) rosette leaves of WT and LhWOX5-OE lines. (B,C) Ectopic leaves and/or flower buds growing from rosette leaf veins. (D) A curly stalk with undetermined hyperplasia at the curling site. (E–H) Phenotypes of T2 generation plants. (E) Incomplete cotyledon. (F) A rosette leaf with ectopic leaves, flower buds, and pods growing on its leaf veins. (G) Curly stalk with undetermined hyperplasia. (H) Fused stalk. Scale bar = 0.5 um.
Figure 3. The phenotypes of p35S:LhWOX5 (LhWOX5-OE) transgenic Arabidopsis. Hand-drawn images showing transgenic (OE line) and wild type (WT) plants. (a) Ectopic flower buds growing on rosette leaf veins. (b) Ectopic leaves growing on rosette leaf veins. (c) Curly stalk. (d) Incomplete cotyledon. (A–D) Phenotypes of T1-generation plants. (A) rosette leaves of WT and LhWOX5-OE lines. (B,C) Ectopic leaves and/or flower buds growing from rosette leaf veins. (D) A curly stalk with undetermined hyperplasia at the curling site. (E–H) Phenotypes of T2 generation plants. (E) Incomplete cotyledon. (F) A rosette leaf with ectopic leaves, flower buds, and pods growing on its leaf veins. (G) Curly stalk with undetermined hyperplasia. (H) Fused stalk. Scale bar = 0.5 um.
Ijms 24 00906 g003
Ijms 24 00906 g004 550
Figure 4. Relative expression of shoot meristem identity genes in Arabidopsis (T2 generation) (A). (B) Shows rosette leaves with ectopic flower buds and leaves. (C) Shows the same tissue as (B), focusing on the presence of organ primordia on rosette leaves. (D) Curly stalk with undetermined hyperplasia. (E–G) Show enlarged images of square in (B–D). White arrow indicates opened-flower (E), organ primordia (F), and undetermined hyperplasia (G), respectively. Scale bars: (B–D), 0.2 um; (E–G), 0.05 um.
Figure 4. Relative expression of shoot meristem identity genes in Arabidopsis (T2 generation) (A). (B) Shows rosette leaves with ectopic flower buds and leaves. (C) Shows the same tissue as (B), focusing on the presence of organ primordia on rosette leaves. (D) Curly stalk with undetermined hyperplasia. (E–G) Show enlarged images of square in (B–D). White arrow indicates opened-flower (E), organ primordia (F), and undetermined hyperplasia (G), respectively. Scale bars: (B–D), 0.2 um; (E–G), 0.05 um.
Ijms 24 00906 g004
Ijms 24 00906 g005 550
Figure 5. Root phenotypes of Arabidopsis p35S: LhWOX5. Analysis of four individual lines, using 8-day-old seedlings for quantification. (A) WT, wild type (n = 162). (B) Line T3-1 (n = 185). (C) Line T3-2 (n = 172). (D) Line T3-3 (n = 199). Scale bar = 1 cm. (E) Root length in mm, the average ± SE is shown. An ANOVA test was used for statistical analysis. The letters a, b, and c indicate significant differences, with groups marked by identical letters having no significant difference between them.
Figure 5. Root phenotypes of Arabidopsis p35S: LhWOX5. Analysis of four individual lines, using 8-day-old seedlings for quantification. (A) WT, wild type (n = 162). (B) Line T3-1 (n = 185). (C) Line T3-2 (n = 172). (D) Line T3-3 (n = 199). Scale bar = 1 cm. (E) Root length in mm, the average ± SE is shown. An ANOVA test was used for statistical analysis. The letters a, b, and c indicate significant differences, with groups marked by identical letters having no significant difference between them.
Ijms 24 00906 g005
Ijms 24 00906 g006 550
Figure 6. Root morphology of Arabidopsis p35S: LhWOX5. The roots of 5–7 days seedlings were analyzed. (A) WT, wild type. (B) Line T3-1. (C) Line T3-2. (D) Line T3-3. Scale bar = 50 um, dark gray granules in the root tip indicate starch grains.
Figure 6. Root morphology of Arabidopsis p35S: LhWOX5. The roots of 5–7 days seedlings were analyzed. (A) WT, wild type. (B) Line T3-1. (C) Line T3-2. (D) Line T3-3. Scale bar = 50 um, dark gray granules in the root tip indicate starch grains.
Ijms 24 00906 g006
Table
Table 1. Shoot architecture phenotypes of p35S:LhWOX5 Arabidopsis.
Table 1. Shoot architecture phenotypes of p35S:LhWOX5 Arabidopsis.
LineBranchesInflorescencesLeavesHeight (cm)Number
WT2.5 ± 0.99.38 ± 3.120.3 ± 3.640.8 ± 1.330
T2-13.28 ± 1.9 *9.15 ± 4.720.36 ± 5.042.9 ± 1.234
T2-23.19 ± 0.912.03 ± 2.6 *18.83 ± 3.236.9 ± 1.430
T2-32.61 ± 1.48.42 ± 4.320.69 ± 3.443.6 ± 1.439
The number of Arabidopsis branches, inflorescences, and rosette leaves were counted one month after seedlings were planted in the soil. Height data were collected when plants stopped growing (seedlings were planted in the soil for 42 days). An ANOVA test was used for statistical analysis. p < 0.05 (*).
Table
Table 2. The analysis of curly roots in p35S:LhWOX5.
Table 2. The analysis of curly roots in p35S:LhWOX5.
LinePercentage of Curly RootsNumber
WT1.22%246
Line 151.69%267
Line 233.07%254
Line 361.29%279
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, D.; Ma, X.; Hao, Z.; Long, X.; Shi, J.; Chen, J. Overexpression of Liriodenron WOX5 in Arabidopsis Leads to Ectopic Flower Formation and Altered Root Morphology. Int. J. Mol. Sci. 2023, 24, 906. https://doi.org/10.3390/ijms24020906

AMA Style

Wang D, Ma X, Hao Z, Long X, Shi J, Chen J. Overexpression of Liriodenron WOX5 in Arabidopsis Leads to Ectopic Flower Formation and Altered Root Morphology. International Journal of Molecular Sciences. 2023; 24(2):906. https://doi.org/10.3390/ijms24020906

Chicago/Turabian Style

Wang, Dandan, Xiaoxiao Ma, Zhaodong Hao, Xiaofei Long, Jisen Shi, and Jinhui Chen. 2023. "Overexpression of Liriodenron WOX5 in Arabidopsis Leads to Ectopic Flower Formation and Altered Root Morphology" International Journal of Molecular Sciences 24, no. 2: 906. https://doi.org/10.3390/ijms24020906

APA Style

Wang, D., Ma, X., Hao, Z., Long, X., Shi, J., & Chen, J. (2023). Overexpression of Liriodenron WOX5 in Arabidopsis Leads to Ectopic Flower Formation and Altered Root Morphology. International Journal of Molecular Sciences, 24(2), 906. https://doi.org/10.3390/ijms24020906

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop