Estradiol and Estrone Have Different Biological Functions to Induce NF-κB-Driven Inflammation, EMT and Stemness in ER+ Cancer Cells
Abstract
1. Introduction
2. Results
2.1. Estrogen Receptor Is Expressed in HeLa Cells
2.2. TNF-α Exposure Activates the NF-κB Signalling Pathway in HeLa Cells
2.3. The Activation of the NF-κB Signalling Pathway Induces the EMT Process in HeLa Cells
2.4. Estrone, but Not Estradiol, Increases TNF-α-Induced Inflammation in HeLa Cells
2.5. TNF-α and Estrone, but Not Estradiol, Increase Stemness Properties of HeLa Cells
2.6. Estrone, but Not Estradiol, Induces Epithelial-to-Mesenchymal Transition in HeLa Cells
2.7. Generation of HeLa pERα Cells
2.8. TNF-α and Estrone, but Not Estradiol, Increases ES-TF Expression in HeLa pERα Cells
2.9. Estrone Induces Epithelial-to-Mesechymal Transition in HeLa pERα Cells
2.10. HSD17B Enzymes Involved in Estrone Synthesis Have an Oncogenic Role in Hormone-Dependent Cancer Diseases
2.11. HSD17B Enzymes Involved in Estradiol Synthesis Have a Protection Role in Hormone-Dependent Cancer Diseases
2.12. Low Expression of HSD17B Enzymes Involved in Estradiol Synthesis Combined with High Expression of HSD17B Enzymes Involved in Estrone Synthesis Correlate with a Worse Patient Outcome in ER+ Ovarian Cancer Diseases
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Cultures
4.2. Protein Isolation and Western Blot
4.3. RNA Isolation and Real-Time PCR Analysis
4.4. Flow Cytometry
4.5. MTT Assay
4.6. Immunofluorescence
4.7. Cells Transfection
4.8. Statistical Analysis
4.9. KM-Plotter and UALCAN Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| ALDH | Aldehyde dehydrogenase |
| ACC | Adrenocortical carcinoma |
| BCA | Bicinchoninic Acid |
| BSA | Bovine serum albumin |
| CCL2 | C-C Motif Chemokine Ligand 2 |
| CSC | Cancer Stem cell |
| DAPI | 4′:6-diamidino-2-phenylindole |
| DMSO | Dimethyl sulfoxide |
| E1 | Estrone |
| E2 | Estradiol |
| EMT | Epithelial-to-Mesenchymal Transition |
| ER | Estrogen receptor |
| ES-TF | Embryonic Stem Cell-Transcription Factors |
| IL-6 | Interleukin-6 |
| IL-8 | Interleukin-8 |
| iPS | Induced Pluripotent Stem Cells |
| MTT | 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide |
| N-Cad | N-Cadherine |
| NF-κB | Nuclear factor kappa B |
References
- Bhardwaj, P.; Au, C.C.; Benito-Martin, A.; Ladumor, H.; Oshchepkova, S.; Moges, R.; Brown, K.A. Estrogens and breast cancer: Mechanisms involved in obesity-related development, growth and progression. J. Steroid Biochem. Mol. Biol. 2019, 189, 161–170. [Google Scholar] [CrossRef] [PubMed]
- Deroo, B.J.; Korach, K.S. Estrogen receptors and human disease. J. Clin. Investig. 2006, 116, 561–570. [Google Scholar] [CrossRef] [PubMed]
- Richardson, H.; Ho, V.; Pasquet, R.; Singh, R.J.; Goetz, M.P.; Tu, D.; Goss, P.E.; Ingle, J.N. Baseline estrogen levels in postmenopausal women participating in the MAP.3 breast cancer chemoprevention trial. Menopause 2020, 27, 693–700. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.; Shen, Y.; Li, R. Estrogen synthesis and signaling pathways during aging: From periphery to brain. Trends Mol. Med. 2013, 19, 197–209. [Google Scholar] [CrossRef]
- Ferlay, J.; Soerjomataram, I.; Dikshit, R.; Eser, S.; Mathers, C.; Rebelo, M.; Parkin, D.M.; Forman, D.; Bray, F. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int. J. Cancer 2015, 136, E359–E386. [Google Scholar] [CrossRef]
- Loibl, S.; Poortmans, P.; Morrow, M.; Denkert, C.; Curigliano, G. Epidemiology and risk factors, Breast Cancer. Lancet 2021, 397, 1750–1769. [Google Scholar] [CrossRef]
- Raglan, O.; Kalliala, I.; Markozannes, G.; Cividini, S.; Gunter, M.J.; Nautiyal, J.; Gabra, H.; Paraskevaidis, E.; Martin-Hirsch, P.; Tsilidis, K.K.; et al. Risk factors for endometrial cancer: An umbrella review of the literature. Int. J. Cancer 2019, 145, 1719–1730. [Google Scholar] [CrossRef]
- La Vecchia, C. Ovarian cancer: Epidemiology and risk factors. Eur. J. Cancer Prev. 2017, 26, 55–62. [Google Scholar] [CrossRef]
- Coscia, E.B.; Sabha, M.; Gerenutti, M.; Groppo, F.C.; Bergamaschi, C.D.C. Estrone and Estradiol Levels in Breast Cancer Patients Using Anastrozole Are Not Related to Body Mass Index. Rev. Bras. Ginecol. Obstet. 2017, 39, 14–20. [Google Scholar] [CrossRef]
- Andarieh, M.G.; Delavar, M.A.; Moslemi, D.; Esmaeilzadeh, S. Risk Factors for Endometrial Cancer: Results from a Hospital-Based Case-Control Study. Asian Pac. J. Cancer Prev. 2016, 17, 4791–4796. [Google Scholar] [CrossRef]
- Foong, K.W.; Bolton, H. Obesity and ovarian cancer risk: A systematic review. Post Reprod. Health 2017, 23, 183–198. [Google Scholar] [CrossRef]
- Karim, R.; Mack, W.J.; Hodis, H.N.; Roy, S.; Stanczyk, F.Z. Influence of Age and Obesity on Serum Estradiol, Estrone, and Sex Hormone Binding Globulin Concentrations following Oral Estrogen Administration in Postmenopausal Women. J. Clin. Endocrinol. Metab. 2009, 94, 4136–4143. [Google Scholar] [CrossRef] [PubMed]
- Purnell, J.Q. Definitions, classification, and epidemiology of obesity. In Endotext [Internet]; MDText. com, Inc.: Portland, OR, USA, 2018. [Google Scholar]
- García-Estévez, L.; Cortés, J.; Pérez, S.; Calvo, I.; Gallegos, I.; Moreno-Bueno, G. Obesity and Breast Cancer: A Paradoxical and Controversial Relationship Influenced by Menopausal Status. Front. Oncol. 2021, 11, 705911. [Google Scholar] [CrossRef] [PubMed]
- Deng, T.; Lyon, C.J.; Bergin, S.; Caligiuri, M.A.; Hsueh, W.A. Obesity, Inflammation, and Cancer. Annu. Rev. Pathol. Mech. Dis. 2016, 11, 421–449. [Google Scholar] [CrossRef] [PubMed]
- Picon-Ruiz, M.; Pan, C.; Drews-Elger, K.; Jang, K.; Besser, A.H.; Zhao, D.; Morata-Tarifa, C.; Kim, M.; Ince, T.A.; Azzam, D.J.; et al. Interactions between Adipocytes and Breast Cancer Cells Stimulate Cytokine Production and Drive Src/Sox2/miR-302b–Mediated Malignant Progression. Cancer Res. 2016, 76, 491–504. [Google Scholar] [CrossRef]
- Hayden, M.S. Signaling to NF-kB. Genes Dev. 2004, 18, 2195–2224. [Google Scholar] [CrossRef]
- Clarke, M.A.; Long, B.J.; Morillo, A.D.M.; Arbyn, M.; Bakkum-Gamez, J.N.; Wentzensen, N. Association of Endometrial Cancer Risk With Postmenopausal Bleeding in Women: A Systematic Review and Meta-analysis. Obstet. Gynecol. Surv. 2018, 73, 687–688. [Google Scholar] [CrossRef]
- Wentzensen, N.; Poole, E.M.; Trabert, B.; White, E.; Arslan, A.A.; Patel, A.V.; Setiawan, V.W.; Visvanathan, K.; Weiderpass, E.; Adami, H.-O.; et al. Ovarian Cancer Risk Factors by Histologic Subtype: An Analysis From the Ovarian Cancer Cohort Consortium. J. Clin. Oncol. 2016, 34, 2888–2898. [Google Scholar] [CrossRef]
- Howe, L.R.; Subbaramaiah, K.; Hudis, C.A.; Dannenberg, A.J. Molecular Pathways: Adipose Inflammation as a Mediator of Obesity-Associated Cancer. Clin. Cancer Res. 2013, 19, 6074–6083. [Google Scholar] [CrossRef]
- Tornatore, L.; Thotakura, A.K.; Bennett, J.; Moretti, M.; Franzoso, G. The nuclear factor kappa B signaling pathway: Integrating metabolism with inflammation. Trends Cell Biol. 2012, 22, 557–566. [Google Scholar] [CrossRef]
- Ma, C.X.; Reinert, T.; Chmielewska, I.; Ellis, M.J. Mechanisms of aromatase inhibitor resistance. Nat. Rev. Cancer 2015, 15, 261–275. [Google Scholar] [CrossRef] [PubMed]
- Liedtke, S.; Schmidt, M.E.; Vrieling, A.; Lukanova, A.; Becker, S.; Kaaks, R.; Zaineddin, A.K.; Buck, K.; Benner, A.; Chang-Claude, J.; et al. Postmenopausal Sex Hormones in Relation to Body Fat Distribution. Obesity 2012, 20, 1088–1095. [Google Scholar] [CrossRef] [PubMed]
- Kalaitzidis, D.; Gilmore, T.D. Transcription factor cross-talk: The estrogen receptor and NF-kappaB. Trends Endocrinol. Metab. 2005, 16, 46–52. [Google Scholar] [CrossRef] [PubMed]
- Qureshi, R.; Picon-Ruiz, M.; Aurrekoetxea-Rodriguez, I.; de Paiva, V.N.; D’Amico, M.; Yoon, H.; Radhakrishnan, R.; Morata-Tarifa, C.; Ince, T.; Lippman, M.E.; et al. The major pre- and post-menopausal estrogens play opposing roles in obesity driven mammary inflammation and breast cancer development. Cell Metab. 2020, 31, 1154–1172.e9. [Google Scholar] [CrossRef] [PubMed]
- Qureshi, R.; Picon-Ruiz, M.; Sho, M.; Van Booven, D.; de Paiva, V.N.; Diaz-Ruano, A.B.; Ince, T.A.; Slingerland, J. Estrone, the major postmenopausal estrogen, binds ERa to induce SNAI2, epithelial-to-mesenchymal transition, and ER+ breast cancer metastasis. Cell Rep. 2022, 41, 111672. [Google Scholar] [CrossRef]
- Liu, Y.; Tian, L.-B.; Yang, H.-Y.; Zhang, H.-P. Effects of estradiol and progesterone on the growth of HeLa cervical cancer cells. Eur. Rev. Med. Pharmacol. Sci. 2017, 21, 3959–3965. [Google Scholar]
- Hilborn, E.; Stål, O.; Jansson, A. Estrogen and androgen-converting enzymes 17β-hydroxysteroid dehydrogenase and their involvement in cancer: With a special focus on 17β-hydroxysteroid dehydrogenase type 1, 2, and breast cancer. Oncotarget 2017, 8, 30552. [Google Scholar] [CrossRef]
- Sinreih, M.; Knific, T.; Anko, M.; Hevir, N.; Vouk, K.; Jerin, A.; Grazio, S.F.; Rižner, T.L. The Significance of the Sulfatase Pathway for Local Estrogen Formation in Endometrial Cancer. Front. Pharmacol. 2017, 8, 368. [Google Scholar] [CrossRef]
- Schütze, S.; Wiegmann, K.; Machleidt, T.; Krönke, M. TNF-induced activation of NF-kappa B. Immunobiology 1995, 193, 193–203. [Google Scholar] [CrossRef]
- Lin, C.-Y.; Ström, A.; Vega, V.B.; Kong, S.L.; Yeo, A.L.; Thomsen, J.S.; Chan, W.C.; Doray, B.; Bangarusamy, D.K.; Ramasamy, A.; et al. Discovery of estrogen receptor α target genes and response elements in breast tumor cells. Genome Biol. 2004, 5, R66. [Google Scholar] [CrossRef]
- Picon-Ruiz, M.; Morata-Tarifa, C.; Valle-Goffin, J.J.; Friedman, E.R.; Slingerland, J.M. Obesity and adverse breast cancer risk and outcome: Mechanistic insights and strategies for intervention. CA Cancer J. Clin. 2017, 67, 378–397. [Google Scholar] [CrossRef] [PubMed]
- Esquivel-Velázquez, M.; Ostoa-Saloma, P.; Palacios-Arreola, M.I.; Nava-Castro, K.E.; Castro, J.I.; Morales-Montor, J. The Role of Cytokines in Breast Cancer Development and Progression. J. Interf. Cytokine Res. 2015, 35, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Ray, P.; Ghosh, S.K.; Zhang, D.H.; Ray, A. Repression of interleukin-6 gene expression by 17 beta-estradiol: Inhibition of the DNA-binding activity of the transcription factors NF-IL6 and NF-kappa B by the estrogen receptor. FEBS Lett. 1997, 409, 79–85. [Google Scholar] [CrossRef] [PubMed]
- Huang, R.; Rofstad, E.K. Cancer stem cells (CSCs), cervical CSCs and targeted therapies. Oncotarget 2017, 8, 35351–35367. [Google Scholar] [CrossRef] [PubMed]
- Ginestier, C.; Hur, M.H.; Charafe-Jauffret, E.; Monville, F.; Dutcher, J.; Brown, M.; Jacquemier, J.; Viens, P.; Kleer, C.G.; Liu, S.; et al. ALDH1 Is a Marker of Normal and Malignant Human Mammary Stem Cells and a Predictor of Poor Clinical Outcome. Cell Stem Cell 2007, 1, 555–567. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.-Q. Master Stem Cell Transcription Factors and Signaling Regulation. Cell. Reprogram. 2010, 12, 3–13. [Google Scholar] [CrossRef]
- Takahashi, K.; Yamanaka, S. Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef]
- Knut & Alice Wallenberg foundation. 2022. Stockholm (Denmark). The Human Protein Atlas. The Human Protein Atlas. Available online: https://www.proteinatlas.org/ (accessed on 12 December 2022).
- Maminta, M.; Molteni, A.; Rosen, S. Stable expression of the human estrogen receptor in HeLa cells by infection: Effect of estrogen on cell proliferation and c-myc expression. Mol. Cell. Endocrinol. 1991, 78, 61–69. [Google Scholar] [CrossRef]
- Chen, T.; You, Y.; Jiang, H.; Wang, Z.Z. Epithelial-mesenchymal transition (EMT): A biological process in the development, stem cell differentiation, and tumorigenesis. J. Cell. Physiol. 2017, 232, 3261–3272. [Google Scholar] [CrossRef]
- Pires, B.R.B.; Mencalha, A.L.; Ferreira, G.M.; de Souza, W.F.; Morgado-Díaz, J.A.; Maia, A.M.; Corrêa, S.; Abdelhay, E.S.F.W. NF-kappaB Is Involved in the Regulation of EMT Genes in Breast Cancer Cells. PLoS ONE 2017, 12, e0169622. [Google Scholar] [CrossRef]
- Li, C.-W.; Xia, W.; Huo, L.; Lim, S.-O.; Wu, Y.; Hsu, J.L.; Chao, C.-H.; Yamaguchi, H.; Yang, N.-K.; Ding, Q.; et al. Epithelial-mesenchymal transition induced by TNF-α requires NF-κB-mediated transcriptional upregulation of Twist1. Cancer Res. 2012, 72, 1290–1300. [Google Scholar] [CrossRef] [PubMed]
- Dong, W.; Sun, S.; Cao, X.; Cui, Y.; Chen, A.; Li, X.; Zhang, J.; Cao, J.; Wang, Y. Exposure to TNF-α combined with TGF-β induces carcinogenesis in vitro via NF-κB/Twist axis. Oncol. Rep. 2017, 37, 1873–1882. [Google Scholar] [CrossRef] [PubMed]
- Santamaria, P.G.; Moreno-Bueno, G.; Portillo, F.; Cano, A. EMT: Present and future in clinical oncology. Mol. Oncol. 2017, 11, 718–738. [Google Scholar] [CrossRef] [PubMed]
- Thiery, J.P.; Acloque, H.; Huang, R.Y.J.; Nieto, M.A. Epithelial-Mesenchymal Transitions in Development and Disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef]
- Gyorffy, B.; Lánczky, A.; Szallasi, Z. Implementing an online tool for genome-wide validation of survival-associated biomarkers in ovarian-cancer using microarray data from 1287 patients. Endocr. Relat. Cancer 2012, 19, 197–208. [Google Scholar] [CrossRef]
- Levesque, E.; Guillemette, C.; Fradet, Y.; Lacombe, L. Prognostic Markers of Inhereted Variations in the β-Hydroxysteroid Dehydrogenase (HSD17B) Genes for Prostate Cancer (WO Patent No. 2013/049926). World Intellectual Property Organisation. 2013. Available online: https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2013049926 (accessed on 12 December 2022).
- Ding, G.; Liu, S.; Ding, Q.; Feng, C. Overexpression of HSD17B4 exerts tumor suppressive function in adrenocortical carcinoma and is not associated with hormone excess. Oncotarget 2017, 8, 114736–114745. [Google Scholar] [CrossRef]
- Lv, L.; Zhao, Y.; Wei, Q.; Zhao, Y.; Yi, Q. Downexpression of HSD17B6 correlates with clinical prognosis and tumor immune infiltrates in hepatocellular carcinoma. Cancer Cell Int. 2020, 20, 1–24. [Google Scholar] [CrossRef]
- Chang, W.-C.; Cheng, W.-C.; Cheng, B.-H.; Chen, L.; Ju, L.-J.; Ou, Y.-J.; Jeng, L.-B.; Yang, M.-D.; Hung, Y.-C.; Ma, W.-L. Mitochondrial Acetyl-CoA Synthetase 3 is Biosignature of Gastric Cancer Progression. Cancer Med. 2018, 7, 1240–1252. [Google Scholar] [CrossRef]
- Uhlén, M.; Zhang, C.; Lee, S.; Sjöstedt, E.; Fagerberg, L.; Bidkhori, G.; Benfeitas, R.; Arif, M.; Liu, Z.; Edfors, F.; et al. A pathology atlas of the human cancer transcriptome. Science 2017, 357, 2507. [Google Scholar] [CrossRef]
- Zhang, W.; Wang, B.; Wang, Q.; Zhang, Z.; Shen, Z.; Ye, Y.; Jiang, K.; Wang, S. Lnc-HSD17B11-1:1 Functions as a Competing Endogenous RNA to Promote Colorectal Cancer Progression by Sponging miR-338-3p to Upregulate MACC1. Front. Genet. 2020, 11, 628. [Google Scholar] [CrossRef]
- Szajnik, M.; Szczepanski, M.J.; Elishaev, E.; Visus, C.; Lenzner, D.; Zabel, M.; Glura, M.; DeLeo, A.B.; Whiteside, T.L. 17β hydroxysteroid dehydrogenase type 12 (HSD17B12) is a marker of poor prognosis in ovarian carcinoma. Gynecol. Oncol. 2012, 127, 587–594. [Google Scholar] [CrossRef] [PubMed]
- Audet-Walsh, É.; Bellemare, J.; Lacombe, L.; Fradet, Y.; Fradet, V.; Douville, P.; Guillemette, C.; Lévesque, É. The Impact of Germline Genetic Variations in Hydroxysteroid (17-Beta) Dehydrogenases on Prostate Cancer Outcomes After Prostatectomy. Eur. Urol. 2012, 62, 88–96. [Google Scholar] [CrossRef] [PubMed]
- Berthois, Y.; A Katzenellenbogen, J. Phenol red in tissue culture media is a weak estrogen: Implications concerning the study of estrogen-responsive cells in culture. Proc. Natl. Acad. Sci. USA 1986, 83, 2496–2500. [Google Scholar] [CrossRef] [PubMed]
- Nagy, Á.; Lánczky, A.; Menyhárt, O.; Győrffy, B. Validation of miRNA prognostic power in hepatocellular carcinoma using expression data of independent datasets. Sci. Rep. 2018, 8, 9227. [Google Scholar] [CrossRef]
- Chandrashekar, D.S.; Bashel, B.; Balasubramanya, S.A.H.; Creighton, C.J.; Ponce-Rodriguez, I.; Chakravarthi, B.V.S.K.; Varambally, S. UALCAN: A portal for facilitating tumor subgroup gene expression and survival analyses. Neoplasia 2017, 19, 649–658. [Google Scholar] [CrossRef]








| Gene | Primers Secuence |
|---|---|
| ESR1 | Fw: 5′- GCTTACTGACCAACCTGGCAGA -3′ Rev: 5′- GGATCTAGCCAGGCACATTC -3′ |
| ESR2 | Fw: 5′- ATGGAGTCTGGTCGTGTGAAGG -3′ Rev: 5′- TAACACTTCCGAAGTCGGCAGG -3′ |
| GREB1 | Fw: 5′- CAATTCCATCGAGGCATCC -3′ Rev: 5′- GGCTACCACCTTCTAGAGC -3′ |
| CCL2 | Fw: 5′- AAGAAGCTGTGATCTTCAAGAC -3′ Rev: 5′- CCATGGAATCCTGAACCCA -3′ |
| IL-6 | Fw: 5′- GATTCAATGAGGAGACTTGCC -3′ Rev: 5′- TGTTCTGGAGGTACTCTAGGT -3′ |
| IL-8 | Fw: 5′- TGCCAAGGAGTGCTAAAG -3′ Rev: 5′- CTCCACAACCCTCTGCAC -3′ |
| SNAIL | Fw: 5′- TGCCCTCAAGATGCACATCCGA -3′ Rev: 5′- GGGACAGGAGAAGGGCTTCTC -3′ |
| SLUG | Fw: 5′- ATCTGCGGCAAGGCGTTTTCCA -3′ Rev: 5′- GAGCCCTCAGATTTGACCTGTC -3′ |
| TWIST1 | Fw: 5′- GCCAGGTACATCGACTTCCTCT -3′ Rev: 5′- TCCATCCTCCAGACCGAGAAGG -3′ |
| N-Cad | Fw: 5′- CCTCCAGAGTTTACTGCCATGAC -3′ Rev: 5′- GTAGGATCTCCGCCACTGATTC -3′ |
| VIMENTIN | Fw: 5′- AGGCAAAGCAGGAGTCCACTGA -3′ Rev: 5′- ATCTGGCGTTCCAGGGACTCAT -3′ |
| c-MYC | Fw: 5′- CCTGGTGCTCCATGAGGAGAC -3′ Rev: 5′- CAGACTCTGACCTTTTGAACGG -3′ |
| KLF4 | Fw: 5′- CATCTCAAGGCACACCTGCGAA -3′ Rev: 5′- TCGGTCGCATTTTTGGCACTGG -3′ |
| SOX2 | Fw: 5′- GCTACAGCATGATGCAGGACCA -3′ Rev: 5′- TCTGAGAGCTGGTCATGGAGTT -3′ |
| GAPDH | Fw: 5′- ATCAAGTGGGGCGATGCTG -3′ Rev: 5′- ACCCATGACGAACATGGGG -3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Diaz-Ruano, A.B.; Martinez-Alarcon, N.; Perán, M.; Benabdellah, K.; Garcia-Martinez, M.d.l.Á.; Preda, O.; Ramirez-Tortosa, C.; Gonzalez-Hernandez, A.; Marchal, J.A.; Picon-Ruiz, M. Estradiol and Estrone Have Different Biological Functions to Induce NF-κB-Driven Inflammation, EMT and Stemness in ER+ Cancer Cells. Int. J. Mol. Sci. 2023, 24, 1221. https://doi.org/10.3390/ijms24021221
Diaz-Ruano AB, Martinez-Alarcon N, Perán M, Benabdellah K, Garcia-Martinez MdlÁ, Preda O, Ramirez-Tortosa C, Gonzalez-Hernandez A, Marchal JA, Picon-Ruiz M. Estradiol and Estrone Have Different Biological Functions to Induce NF-κB-Driven Inflammation, EMT and Stemness in ER+ Cancer Cells. International Journal of Molecular Sciences. 2023; 24(2):1221. https://doi.org/10.3390/ijms24021221
Chicago/Turabian StyleDiaz-Ruano, Ana Belén, Nuria Martinez-Alarcon, Macarena Perán, Karim Benabdellah, María de los Ángeles Garcia-Martinez, Ovidiu Preda, César Ramirez-Tortosa, Andrea Gonzalez-Hernandez, Juan Antonio Marchal, and Manuel Picon-Ruiz. 2023. "Estradiol and Estrone Have Different Biological Functions to Induce NF-κB-Driven Inflammation, EMT and Stemness in ER+ Cancer Cells" International Journal of Molecular Sciences 24, no. 2: 1221. https://doi.org/10.3390/ijms24021221
APA StyleDiaz-Ruano, A. B., Martinez-Alarcon, N., Perán, M., Benabdellah, K., Garcia-Martinez, M. d. l. Á., Preda, O., Ramirez-Tortosa, C., Gonzalez-Hernandez, A., Marchal, J. A., & Picon-Ruiz, M. (2023). Estradiol and Estrone Have Different Biological Functions to Induce NF-κB-Driven Inflammation, EMT and Stemness in ER+ Cancer Cells. International Journal of Molecular Sciences, 24(2), 1221. https://doi.org/10.3390/ijms24021221

