Evaluating the Antibacterial and Antivirulence Activities of Floxuridine against Streptococcus suis
Abstract
1. Introduction
2. Results
2.1. The Antibacterial Activity of Floxuridine
2.2. The Antihemolysin Activity of Floxuridine against S. suis
2.3. Mode of Action of Floxuridine
2.4. In Vivo Efficacy
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Drug
4.2. Antimicrobial Activities Assay
4.3. Time-Dependent Killing Assay
4.4. Antihemolysin Activity Assessment
4.5. RT-PCR Analysis
4.6. Molecular Docking Assay
4.7. Membrane Integrity Assay
4.8. Membrane Potential Assay
4.9. Scanning Electron Microscopy (SEM) Assay
4.10. Mouse Infection Models
4.11. Ethical Approval
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Segura, M.; Fittipaldi, N.; Calzas, C.; Gottschalk, M. Critical Streptococcus suis Virulence Factors: Are They All Really Critical? Trends Microbiol. 2017, 25, 585–599. [Google Scholar] [CrossRef]
 - Vötsch, D.; Willenborg, M.; Weldearegay, Y.B.; Valentin-Weigand, P. Streptococcus suis—The “Two Faces” of a Pathobiont in the Porcine Respiratory Tract. Front. Microbiol. 2018, 9, 480. [Google Scholar] [CrossRef]
 - Lun, Z.-R.; Wang, Q.-P.; Chen, X.-G.; Li, A.-X.; Zhu, X.-Q. Streptococcus suis: An emerging zoonotic pathogen. Lancet Infect. Dis. 2007, 7, 201–209. [Google Scholar] [CrossRef]
 - Perch, B.; Kristjansen, P.; Skadhauge, K. Group R streptococci pathogenic for man. Two cases of meningitis and one fatal case of sepsis. Acta Pathol. Microbiol. Scand. 1968, 74, 69–76. [Google Scholar] [CrossRef]
 - Goyette-Desjardins, G.; Auger, J.-P.; Xu, J.; Segura, M.; Gottschalk, M. Streptococcus suis, an important pig pathogen and emerging zoonotic agent-an update on the worldwide distribution based on serotyping and sequence typing. Emerg. Microbes. Infect. 2014, 3, e45. [Google Scholar] [CrossRef]
 - Gottschalk, M.; Xu, J.; Calzas, C.; Segura, M. Streptococcus suis: A new emerging or an old neglected zoonotic pathogen? Future Microbiol. 2010, 5, 371–391. [Google Scholar] [CrossRef]
 - Uruén, C.; García, C.; Fraile, L.; Tommassen, J.; Arenas, J. How Streptococcus suis escapes antibiotic treatments. Vet. Res. 2022, 53, 91. [Google Scholar] [CrossRef]
 - Palmieri, C.; Varaldo, P.E.; Facinelli, B. Streptococcus suis, an Emerging Drug-Resistant Animal and Human Pathogen. Front. Microbiol. 2011, 2, 235. [Google Scholar] [CrossRef]
 - Huang, J.; Ma, J.; Shang, K.; Hu, X.; Liang, Y.; Li, D.; Wu, Z.; Dai, L.; Chen, L.; Wang, L. Evolution and Diversity of the Antimicrobial Resistance Associated Mobilome in Streptococcus suis: A Probable Mobile Genetic Elements Reservoir for Other Streptococci. Front. Cell. Infect. Microbiol. 2016, 6, 118. [Google Scholar] [CrossRef]
 - Hendriksen, R.S.; Mevius, D.J.; Schroeter, A.; Teale, C.; Meunier, D.; Butaye, P.; Franco, A.; Utinane, A.; Amado, A.; Moreno, M.; et al. Prevalence of antimicrobial resistance among bacterial pathogens isolated from cattle in different European countries: 2002–2004. Acta Vet. Scand. 2008, 50, 28. [Google Scholar] [CrossRef]
 - Werinder, A.; Aspán, A.; Backhans, A.; Sjölund, M.; Guss, B.; Jacobson, M. Streptococcus suis in Swedish grower pigs: Occurrence, serotypes, and antimicrobial susceptibility. Acta Vet. Scand. 2020, 62, 36. [Google Scholar] [CrossRef] [PubMed]
 - Petrocchi-Rilo, M.; Martínez-Martínez, S.; Aguarón-Turrientes, Á.; Roca-Martínez, E.; García-Iglesias, M.-J.; Pérez-Fernández, E.; González-Fernández, A.; Herencia-Lagunar, E.; Gutiérrez-Martín, C.-B. Anatomical Site, Typing, Virulence Gene Profiling, Antimicrobial Susceptibility and Resistance Genes of Streptococcus suis Isolates Recovered from Pigs in Spain. Antibiotics 2021, 10, 707. [Google Scholar] [CrossRef] [PubMed]
 - Aradanas, M.; Poljak, Z.; Fittipaldi, N.; Ricker, N.; Farzan, A. Serotypes, Virulence-Associated Factors, and Antimicrobial Resistance of Streptococcus suis Isolates Recovered from Sick and Healthy Pigs Determined by Whole-Genome Sequencing. Front. Vet. Sci. 2021, 8, 742345. [Google Scholar] [CrossRef]
 - Athey, T.B.T.; Teatero, S.; Takamatsu, D.; Wasserscheid, J.; Dewar, K.; Gottschalk, M.; Fittipaldi, N. Population Structure and Antimicrobial Resistance Profiles of Streptococcus suis Serotype 2 Sequence Type 25 Strains. PLoS ONE 2016, 11, e0150908. [Google Scholar] [CrossRef]
 - Laxminarayan, R.; Duse, A.; Wattal, C.; Zaidi, A.K.M.; Wertheim, H.F.L.; Sumpradit, N.; Vlieghe, E.; Hara, G.L.; Gould, I.M.; Goossens, H.; et al. Antibiotic resistance-the need for global solutions. Lancet Infect. Dis. 2013, 13, 1057–1098. [Google Scholar] [CrossRef]
 - Fernandes, P.; Martens, E. Antibiotics in late clinical development. Biochem. Pharmacol. 2017, 133, 152–163. [Google Scholar] [CrossRef] [PubMed]
 - Pertusati, F.; Pileggi, E.; Richards, J.; Wootton, M.; Van Leemputte, T.; Persoons, L.; De Coster, D.; Villanueva, X.; Daelemans, D.; Steenackers, H.; et al. Drug repurposing: Phosphate prodrugs of anticancer and antiviral FDA-approved nucleosides as novel antimicrobials. J. Antimicrob. Chemother. 2020, 75, 2864–2878. [Google Scholar] [CrossRef]
 - Niu, G.; Tan, H. Nucleoside antibiotics: Biosynthesis, regulation, and biotechnology. Trends Microbiol. 2015, 23, 110–119. [Google Scholar] [CrossRef] [PubMed]
 - Thomson, J.M.; Lamont, I.L. Nucleoside Analogues as Antibacterial Agents. Front. Microbiol. 2019, 10, 952. [Google Scholar] [CrossRef] [PubMed]
 - Liu, Y.; Tong, Z.; Shi, J.; Li, R.; Upton, M.; Wang, Z. Drug repurposing for next-generation combination therapies against multidrug-resistant bacteria. Theranostics 2021, 11, 4910–4928. [Google Scholar] [CrossRef]
 - Miró-Canturri, A.; Ayerbe-Algaba, R.; Smani, Y. Drug Repurposing for the Treatment of Bacterial and Fungal Infections. Front. Microbiol. 2019, 10, 41. [Google Scholar] [CrossRef] [PubMed]
 - Jordheim, L.P.; Durantel, D.; Zoulim, F.; Dumontet, C. Advances in the development of nucleoside and nucleotide analogues for cancer and viral diseases. Nat. Rev. Drug Discov. 2013, 12, 447–464. [Google Scholar] [CrossRef] [PubMed]
 - Winn, M.; Goss, R.J.M.; Kimura, K.-I.; Bugg, T.D.H. Antimicrobial nucleoside antibiotics targeting cell wall assembly: Recent advances in structure-function studies and nucleoside biosynthesis. Nat. Prod. Rep. 2010, 27, 279–304. [Google Scholar] [CrossRef]
 - Power, D.G.; Kemeny, N.E. The role of floxuridine in metastatic liver disease. Mol. Cancer Ther. 2009, 8, 1015–1025. [Google Scholar] [CrossRef] [PubMed]
 - Bollag, W.; Hartmann, H.R. Tumor inhibitory effects of a new fluorouracil derivative: 5’-deoxy-5-fluorouridine. Eur. J. Cancer 1980, 16, 427–432. [Google Scholar] [CrossRef] [PubMed]
 - Morihiro, K.; Ishinabe, T.; Takatsu, M.; Osumi, H.; Osawa, T.; Okamoto, A. Floxuridine Oligomers Activated under Hypoxic Environment. J. Am. Chem. Soc. 2021, 143, 3340–3347. [Google Scholar] [CrossRef]
 - Myers, C.E.; Diasio, R.; Eliot, H.M.; Chabner, B.A. Pharmacokinetics of the fluoropyrimidines: Implications for their clinical use. Cancer Treat. Rev. 1976, 3, 175–183. [Google Scholar] [CrossRef] [PubMed]
 - Li, H.; Li, T.; Zhang, L.; Hu, Q.; Liao, X.; Jiang, Q.; Qiu, X.; Li, L.; Draheim, R.R.; Huang, Q.; et al. Antimicrobial compounds from an FDA-approved drug library with activity against Streptococcus suis. J. Appl. Microbiol. 2022, 132, 1877–1886. [Google Scholar] [CrossRef]
 - Yeo, W.-S.; Arya, R.; Kim, K.K.; Jeong, H.; Cho, K.H.; Bae, T. The FDA-approved anti-cancer drugs, streptozotocin and floxuridine, reduce the virulence of Staphylococcus aureus. Sci. Rep. 2018, 8, 2521. [Google Scholar] [CrossRef] [PubMed]
 - Gottschalk, M.; Segura, M.; Xu, J. Streptococcus suis infections in humans: The Chinese experience and the situation in North America. Anim. Health Res. Rev. 2007, 8, 29–45. [Google Scholar] [CrossRef]
 - Xia, X.; Qin, W.; Zhu, H.; Wang, X.; Jiang, J.; Hu, J. How Streptococcus suis serotype 2 attempts to avoid attack by host immune defenses. J. Microbiol. Immunol. Infect. 2019, 52, 516–525. [Google Scholar] [CrossRef]
 - Nicholson, T.L.; Bayles, D.O. Comparative virulence and antimicrobial resistance distribution of Streptococcus suis isolates obtained from the United States. Front. Microbiol. 2022, 13, 1043529. [Google Scholar] [CrossRef] [PubMed]
 - Haenni, M.; Lupo, A.; Madec, J.-Y. Antimicrobial Resistance in Streptococcus spp. Microbiol. Spectr. 2018, 6. [Google Scholar] [CrossRef] [PubMed]
 - Abraham, R.J.; Stevens, A.J.; Young, K.A.; Russell, C.; Qvist, A.; Khazandi, M.; Wong, H.S.; Abraham, S.; Ogunniyi, A.D.; Page, S.W.; et al. Robenidine Analogues as Gram-Positive Antibacterial Agents. J. Med. Chem. 2016, 59, 2126–2138. [Google Scholar] [CrossRef]
 - Liu, Y.; Jia, Y.; Yang, K.; Li, R.; Xiao, X.; Zhu, K.; Wang, Z. Metformin Restores Tetracyclines Susceptibility against Multidrug Resistant Bacteria. Adv. Sci. 2020, 7, 1902227. [Google Scholar] [CrossRef] [PubMed]
 - He, F.; Liu, Y.; Li, P.; Wu, X.; Xia, Y.; Zhang, D.; Li, N.; Peng, Y.; Zhu, G.; Hardeland, R.; et al. Melatonin inhibits Gram-negative pathogens by targeting citrate synthase. Sci. China Life Sci. 2022, 65, 1430–1444. [Google Scholar] [CrossRef] [PubMed]
 - Nicoletti, I.; Migliorati, G.; Pagliacci, M.C.; Grignani, F.; Riccardi, C. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J. Immunol. Methods 1991, 139, 271–279. [Google Scholar] [CrossRef]
 - Wang, C.; Wang, J.; Xue, K.; Xiao, M.; Wu, K.; Lv, S.; Hao, B.; Zhu, C. Polarity-Sensitive Fluorescent Probe for Reflecting the Packing Degree of Bacterial Membrane Lipids. Anal. Chem. 2022, 94, 3303–3312. [Google Scholar] [CrossRef]
 - Lanning, R.M.; von Roemeling, R.; Hrushesky, W.J. Circadian-based infusional FUDR therapy. Oncol. Nurs. Forum 1990, 17, 49–56. [Google Scholar]
 - von Roemeling, R.; Hrushesky, W.J. Circadian patterning of continuous floxuridine infusion reduces toxicity and allows higher dose intensity in patients with widespread cancer. J. Clin. Oncol. 1989, 7, 1710–1719. [Google Scholar] [CrossRef] [PubMed]
 - Dutkiewicz, J.; Zając, V.; Sroka, J.; Wasiński, B.; Cisak, E.; Sawczyn, A.; Kloc, A.; Wójcik-Fatla, A. Streptococcus suis: A re-emerging pathogen associated with occupational exposure to pigs or pork products. Part II—Pathogenesis. Ann. Agric. Environ. Med. 2018, 25, 186–203. [Google Scholar] [CrossRef]
 - Rasko, D.A.; Sperandio, V. Anti-virulence strategies to combat bacteria-mediated disease. Nat. Rev. Drug Discov. 2010, 9, 117–128. [Google Scholar] [CrossRef] [PubMed]
 - Dickey, S.W.; Cheung, G.Y.C.; Otto, M. Different drugs for bad bugs: Antivirulence strategies in the age of antibiotic resistance. Nat. Rev. Drug Discov. 2017, 16, 457–471. [Google Scholar] [CrossRef]
 - Escaich, S. Novel agents to inhibit microbial virulence and pathogenicity. Expert Opin. Ther. Pat. 2010, 20, 1401–1418. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, S.; Wang, J.; Chen, S.; Yin, J.; Pan, Z.; Liu, K.; Li, L.; Zheng, Y.; Yuan, Y.; Jiang, Y. Effects of Suilysin on Streptococcus suis-Induced Platelet Aggregation. Front. Cell. Infect. Microbiol. 2016, 6, 128. [Google Scholar] [CrossRef][Green Version]
 - Takeuchi, D.; Akeda, Y.; Nakayama, T.; Kerdsin, A.; Sano, Y.; Kanda, T.; Hamada, S.; Dejsirilert, S.; Oishi, K. The contribution of suilysin to the pathogenesis of Streptococcus suis meningitis. J. Infect. Dis. 2014, 209, 1509–1519. [Google Scholar] [CrossRef]
 - Zuo, J.; Shen, Y.; Wang, H.; Gao, S.; Yuan, S.; Song, D.; Wang, Y.; Wang, Y. Effects of metformin on Streptococcus suis LuxS/AI-2 quorum sensing system and biofilm formation. Microb. Pathog. 2023, 181, 106183. [Google Scholar] [CrossRef] [PubMed]
 - Feng, Y.; Zhang, H.; Ma, Y.; Gao, G.F. Uncovering newly emerging variants of Streptococcus suis, an important zoonotic agent. Trends Microbiol. 2010, 18, 124–131. [Google Scholar] [CrossRef]
 - Yi, L.; Li, J.; Fan, Q.; Mao, C.; Jin, M.; Liu, Y.; Sun, L.; Grenier, D.; Wang, Y. The otc gene of Streptococcus suis plays an important role in biofilm formation, adhesion, and virulence in a murine model. Vet. Microbiol. 2020, 251, 108925. [Google Scholar] [CrossRef]
 - Wang, Y.; Gong, S.; Dong, X.; Li, J.; Grenier, D.; Yi, L. In vitro Mixed Biofilm of Streptococcus suis and Actinobacillus pleuropneumoniae Impacts Antibiotic Susceptibility and Modulates Virulence Factor Gene Expression. Front. Microbiol. 2020, 11, 507. [Google Scholar] [CrossRef] [PubMed]
 - Niu, X.; Sun, L.; Wang, G.; Gao, Y.; Yang, Y.; Wang, X.; Wang, H. Investigation of the inhibition effect and mechanism of myricetin to Suilysin by molecular modeling. Sci. Rep. 2017, 7, 11748. [Google Scholar] [CrossRef] [PubMed]
 - Li, J.; Zhang, X.; Han, N.; Wan, P.; Zhao, F.; Xu, T.; Peng, X.; Xiong, W.; Zeng, Z. Mechanism of Action of Isopropoxy Benzene Guanidine against Multidrug-Resistant Pathogens. Microbiol. Spectr. 2023, 11, e0346922. [Google Scholar] [CrossRef] [PubMed]
 






| Isolate | MLST | MIC (μg/mL) | MIC (μg/mL) | 
|---|---|---|---|
| Floxuridine | Tetracycline | ||
| ATCC 43765 | - | 0.25 | 1 | 
| SS3 | 7 | 0.5 | 64 | 
| SS30 | 25 | 0.12 | 64 | 
| SS14 | 27 | 0.25 | 1 | 
| SS37 | 242 | 0.12 | 64 | 
| SS12 | 850 | 0.06 | 64 | 
| SS25 | 308 | 0.5 | 2 | 
| SS26 | 839 | 0.12 | 8 | 
| SS35 | 28 | 0.12 | 64 | 
| SS40 | 87 | 0.25 | 16 | 
| Target | Primer | Sequence (5′-3′) | Source | 
|---|---|---|---|
| 16S rRNA | 16S rRNA-F | CATCCATAACAGCCATACCAG | [49] | 
| 16S rRNA-R | TAAACCACATGCTCCACCGC | ||
| gapdh | gapdh-F | GCTGAAGAAGTAAACGCTGCT | [49] | 
| gapdh-R | GTCGCATCAAACAATGAACC | ||
| ef | ef-F | TCCAATCACAGATCCAGATAGCG | [49] | 
| ef-R | CTGACCCATTTGGACCATCTAAG | ||
| fbps | fbps-F | AACCATCTTGCCAGGCTCCAC | [50] | 
| fbps-R | CAGTTCAGAAGCCGTATCCCGAC | ||
| sly | sly-F | TCATTCAGGTGCTTATGTTGCG | [50] | 
| sly-R | GAAGATTGCGAGCATTTCCTGG | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Han, N.; Li, Y.; Zhao, F.; Xiong, W.; Zeng, Z. Evaluating the Antibacterial and Antivirulence Activities of Floxuridine against Streptococcus suis. Int. J. Mol. Sci. 2023, 24, 14211. https://doi.org/10.3390/ijms241814211
Li J, Han N, Li Y, Zhao F, Xiong W, Zeng Z. Evaluating the Antibacterial and Antivirulence Activities of Floxuridine against Streptococcus suis. International Journal of Molecular Sciences. 2023; 24(18):14211. https://doi.org/10.3390/ijms241814211
Chicago/Turabian StyleLi, Jie, Ning Han, Yangyang Li, Feifei Zhao, Wenguang Xiong, and Zhenling Zeng. 2023. "Evaluating the Antibacterial and Antivirulence Activities of Floxuridine against Streptococcus suis" International Journal of Molecular Sciences 24, no. 18: 14211. https://doi.org/10.3390/ijms241814211
APA StyleLi, J., Han, N., Li, Y., Zhao, F., Xiong, W., & Zeng, Z. (2023). Evaluating the Antibacterial and Antivirulence Activities of Floxuridine against Streptococcus suis. International Journal of Molecular Sciences, 24(18), 14211. https://doi.org/10.3390/ijms241814211
        