Sodium Butyrate as Key Regulator of Mitochondrial Function and Barrier Integrity of Human Glomerular Endothelial Cells
Abstract
1. Introduction
2. Results
2.1. Butyrate Decreases Proliferation of hgMVECs
2.2. Butyrate Improves Endothelial Monolayer Integrity by Increasing the Expression of Proteins Involved in Endothelial Junction Formation
2.3. Butyrate Increases Mitochondrial Mass and Influences the Expression of Genes Involved in Mitochondrial Homeostasis in hgMVECs
2.4. Butyrate Decreases Maximal Respiratory Capacity of hgMVECs
2.5. Butyrate Reduces the Increased Maximal Respiratory Capacity Induced by LPS
3. Discussion
3.1. Butyrate Inhibits Endothelial Cell Proliferation
3.2. Butyrate and Increases the Resistance of the Endothelial Monolayer
3.3. Butyrate Regulates Mitochondrial Biogenesis and Mitochondrial Function
3.4. Possible Clinical Implications
3.5. Study Limitations
4. Materials and Methods
4.1. Primary Human Glomerular Microvascular Endothelial Cells
4.2. Ki-67 Staining for Proliferating Cells
4.3. Mitochondrial Staining with MitoTracker™
4.4. Seahorse Assay
4.5. Barrier Function Assay
4.6. Staining for VE-Cadherin and Claudin-5
4.7. Quantitative PCR
4.8. Analysis and Statistics
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kovesdy, C.P. Epidemiology of chronic kidney disease: An update 2022. Kidney Int. Suppl. 2022, 12, 7–11. [Google Scholar] [CrossRef] [Scilit]
- Barton, M.; Sorokin, A. Endothelin and the Glomerulus in Chronic Kidney Disease. Semin. Nephrol. 2015, 35, 156–167. [Google Scholar] [CrossRef] [Scilit]
- Menon, M.C.; Chuang, P.Y.; He, C.J. The glomerular filtration barrier: Components and crosstalk. Int. J. Nephrol. 2012, 2012, 749010. [Google Scholar] [CrossRef] [Scilit]
- Roumeliotis, S.; Mallamaci, F.; Zoccali, C. Endothelial Dysfunction in Chronic Kidney Dis-ease, from Biology to Clinical Outcomes: A 2020 Update. J. Clin. Med. 2020, 9, 2359. [Google Scholar] [CrossRef] [Scilit]
- Sol, M.; van den Born, J.K.J.; van den Heuvel, M.C.; van der Vlag, J.; Krenning, G.; Hillebrands, J.L. Glomerular Endothelial Cells as Instigators of Glomerular Sclerotic Diseases. Front. Pharmacol. 2020, 11, 573557. [Google Scholar] [CrossRef] [Scilit]
- Faller, D.V. Endothelial cell responses to hypoxic stress. Clin. Exp. Pharmacol. Physiol. 1999, 26, 74–84. [Google Scholar] [CrossRef] [Scilit]
- Eleftheriadis, T.; Antoniadi, G.; Pissas, G.; Liakopoulos, V.; Stefanidis, I. The renal endothelium in diabetic nephropathy. Ren. Fail. 2013, 35, 592–599. [Google Scholar] [CrossRef] [Scilit]
- Tufro, A.; Veron, D. VEGF and podocytes in diabetic nephropathy. Semin. Nephrol. 2012, 32, 385–393. [Google Scholar]
- Bhatia, D.; Capili, A.; Choi, M.E. Mitochondrial dysfunction in kidney injury, inflammation, and disease: Potential therapeutic approaches. Kidney Res. Clin. Pract. 2020, 39, 244–258. [Google Scholar] [CrossRef] [Scilit]
- Ma, K.; Chen, G.; Li, W.; Kepp, O.; Zhu, Y.; Chen, Q. Mitophagy, Mitochondrial Homeostasis, and Cell Fate. Front. Cell Dev. Biol. 2020, 8, 467. [Google Scholar]
- Ren, L.; Han, F.; Xuan, L.; Lv, Y.; Gong, L.; Yan, Y.; Wan, Z.; Guo, L.; Liu, H.; Xu, B.; et al. Clusterin ameliorates endothelial dysfunction in diabetes by suppressing mi-tochondrial fragmentation. Free Radic. Biol. Med. 2019, 145, 357–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fuhrmann, D.C.; Brune, B. Mitochondrial composition and function under the control of hypoxia. Redox Biol. 2017, 12, 208–215. [Google Scholar] [PubMed]
- Magliocca, G.; Mone, P.; Di Iorio, B.R.; Heidland, A.; Marzocco, S. Short-Chain Fatty Acids in Chronic Kidney Disease: Focus on Inflam-mation and Oxidative Stress Regulation. Int. J. Mol. Sci. 2022, 23, 5354. [Google Scholar] [CrossRef] [Scilit]
- Wehedy, E.; Shatat, I.F.; Al Khodor, S. The Human Microbiome in Chronic Kidney Dis-ease: A Double-Edged Sword. Front. Med. 2021, 8, 790783. [Google Scholar]
- Lau, W.L.; Kalantar-Zadeh, K.; Vaziri, N.D. The Gut as a Source of Inflammation in Chronic Kidney Disease. Nephron 2015, 130, 92–98. [Google Scholar] [PubMed]
- Wang, S.; Lv, D.; Jiang, S.; Jiang, J.; Liang, M.; Hou, F.; Chen, Y. Quantitative reduction in short-chain fatty acids, especially butyrate, contributes to the progression of chronic kidney disease. Clin. Sci. 2019, 133, 1857–1870. [Google Scholar]
- Gao, B.; Jose, A.; Alonzo-Palma, N.; Malik, T.; Shankaranarayanan, D.; Regunathan-Shenk, R.; Raj, D.S. Butyrate producing microbiota are reduced in chronic kidney diseases. Sci. Rep. 2021, 11, 23530. [Google Scholar] [CrossRef] [Scilit]
- Sanna, S.; van Zuydam, N.R.; Mahajan, A.; Kurilshikov, A.; Vila, A.V.; Vosa, U.; Mujagic, Z.; Masclee, A.A.M.; Jonkers, D.; Oosting, M.; et al. Causal relationships among the gut microbiome, short-chain fatty acids and metabolic diseases. Nat. Genet. 2019, 51, 600–605. [Google Scholar]
- Xiong, R.G.; Zhou, D.D.; Wu, S.X.; Huang, S.Y.; Saimaiti, A.; Yang, Z.J.; Shang, A.; Zhao, C.N.; Gan, R.Y.; Li, H.B. Health Benefits and Side Effects of Short-Chain Fatty Acids. Foods 2022, 11, 2863. [Google Scholar] [CrossRef] [Scilit]
- Chambers, E.S.; Preston, T.; Frost, G.; Morrison, D.J. Role of Gut Microbiota-Generated Short-Chain Fatty Acids in Metabolic and Cardiovascular Health. Curr. Nutr. Rep. 2018, 7, 198–206. [Google Scholar]
- Menzel, T.; Lührs, H.; Zirlik, S.; Schauber, J.; Kudlich, T.; Gerke, T.; Gostner, A.; Neumann, M.; Melcher, R.; Scheppach, W. Butyrate Inhibits Leukocyte Adhesion to Endothelial Cells viaModulation of VCAM-1. Inflamm. Bowel Dis. 2004, 10, 122–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zapolska-Downar, D.; Siennicka, A.; Kaczmarczyk, M.; Kolodziej, B.; Naruszewicz, M. Butyrate inhibits cytokine-induced VCAM-1 and ICAM-1 ex-pression in cultured endothelial cells: The role of NF-kappaB and PPARalpha. J. Nutr. Biochem. 2004, 15, 220–228. [Google Scholar] [PubMed]
- Hu, S.; Kuwabara, R.; de Haan, B.J.; Smink, A.M.; de Vos, P. Acetate and Butyrate Improve beta-cell Metabolism and Mitochondrial Respi-ration under Oxidative Stress. Int. J. Mol. Sci. 2020, 21, 1542. [Google Scholar]
- Rose, S.; Bennuri, S.C.; Davis, J.E.; Wynne, R.; Slattery, J.C.; Tippett, M.; Delhey, L.; Melnyk, S.; Kahler, S.G.; MacFabe, D.F.; et al. Butyrate enhances mitochondrial function during oxidative stress in cell lines from boys with autism. Transl. Psychiatry 2018, 8, 42. [Google Scholar] [PubMed]
- Li, M.; van Esch, B.; Henricks, P.A.J.; Folkerts, G.; Garssen, J. The Anti-inflammatory Effects of Short Chain Fatty Acids on Lipopolysaccha-ride- or Tumor Necrosis Factor alpha-Stimulated Endothelial Cells via Activation of GPR41/43 and Inhibition of HDACs. Front. Pharmacol. 2018, 9, 533. [Google Scholar] [CrossRef] [Scilit]
- Qin, X.; Zou, H. The role of lipopolysaccharides in diabetic retinopathy. BMC Ophthalmol. 2022, 22, 86. [Google Scholar]
- Cani, P.D.; Bibiloni, R.; Knauf, C.; Waget, A.; Neyrinck, A.M.; Delzenne, N.M.; Burcelin, R. Changes in gut microbiota control metabolic endotoxemia-induced in-flammation in high-fat diet-induced obesity and diabetes in mice. Diabetes 2008, 57, 1470–1481. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.M.; Song, I.H. The clinical impact of gut microbiota in chronic kidney disease. Korean J. Intern. Med. 2020, 35, 1305–1316. [Google Scholar] [CrossRef] [Scilit]
- Cani, P.D.; Bibiloni, R.; Knauf, C.; Waget, A.; Neyrinck, A.M.; Delzenne, N.M.; Burcelin, R. The role and mechanism of gut microbiota-derived short-chain fatty in the prevention and treatment of diabetic kidney disease. Front. Immunol. 2022, 13, 1080456. [Google Scholar]
- Hohenstein, B.; Hausknecht, B.; Boehmer, K.; Riess, R.; Brekken, R.A.; Hugo, C.P. Local VEGF activity but not VEGF expression is tightly regulated during diabetic nephropathy in man. Kidney Int. 2006, 69, 1654–1661. [Google Scholar]
- Cha, D.R.; Kang, Y.S.; Han, S.Y.; Jee, Y.H.; Han, K.H.; Han, J.Y.; Kim, Y.S.; Kim, N.H. Vascular endothelial growth factor is increased during early stage of diabetic nephropathy in type II diabetic rats. J. Endocrinol. 2004, 183, 183–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, H.; Harris, R.C. Renal Endothelial Dysfunction in Diabetic Nephropathy. Cardiovasc. Hematol. Disord. Targets 2014, 14, 22–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robles-Vera, I.; Toral, M.; de la Visitacion, N.; Aguilera-Sanchez, N.; Redondo, J.M.; Duarte, J. Protective Effects of Short-Chain Fatty Acids on Endothelial Dysfunc-tion Induced by Angiotensin II. Front. Physiol. 2020, 11, 277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Donohoe, D.R.; Collins, L.B.; Wali, A.; Bigler, R.; Sun, W.; Bultman, S.J. The Warburg effect dictates the mechanism of butyrate-mediated his-tone acetylation and cell proliferation. Mol. Cell 2012, 48, 612–626. [Google Scholar] [CrossRef] [Scilit]
- Eelen, G.; de Zeeuw, P.; Treps, L.; Harjes, U.; Wong, B.W.; Carmeliet, P. Endothelial Cell Metabolism. Physiol. Rev. 2018, 98, 3–58. [Google Scholar] [CrossRef] [Scilit]
- Chistiakov, D.A.; Orekhov, A.N.; Bobryshev, Y.V. Endothelial Barrier and Its Abnor-malities in Cardiovascular Disease. Front. Physiol. 2015, 6, 365. [Google Scholar] [CrossRef] [Scilit]
- Schroder-Heurich, B.; von Hardenberg, S.; Brodowski, L.; Kipke, B.; Meyer, N.; Borns, K.; von Kaisenberg, C.S.; Brinkmann, H.; Claus, P.; von Versen-Hoynck, F. Vitamin D improves endothelial barrier integrity and counteracts inflammatory effects on endothelial progenitor cells. FASEB J. 2019, 33, 9142–9153. [Google Scholar] [CrossRef] [Scilit]
- Fock, E.; Parnova, R. Mechanisms of Blood-Brain Barrier Protection by Microbiota-Derived Short-Chain Fatty Acids. Cells 2023, 12, 657. [Google Scholar]
- Galvan, D.L.; Green, N.H.; Danesh, F.R. The hallmarks of mitochondrial dysfunction in chronic kidney disease. Kidney Int. 2017, 92, 1051–1057. [Google Scholar] [CrossRef] [Scilit]
- Shurubor, Y.I.; Cooper, A.J.L.; Krasnikov, A.B.; Isakova, E.P.; Deryabina, Y.I.; Beal, M.F.; Krasnikov, B.F. Changes of Coenzyme A and Acetyl-Coenzyme A Concentrations in Rats after a Single-Dose Intraperitoneal Injection of Hepatotoxic Thioacetamide Are Not Consistent with Rapid Recovery. Int. J. Mol. Sci. 2020, 21, 8918. [Google Scholar] [CrossRef] [Scilit]
- Raulien, N.; Friedrich, K.; Strobel, S.; Rubner, S.; Baumann, S.; von Bergen, M.; Korner, A.; Krueger, M.; Rossol, M.; Wagner, U. Fatty Acid Oxidation Compensates for Lipopolysaccharide-Induced Warburg Effect in Glucose-Deprived Monocytes. Front. Immunol. 2017, 8, 609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, W.; WOldham, M.; Priolo, C.; Pandey, A.K.; Loscalzo, J. Immunometabolic Endothelial Phenotypes: Integrating Inflammation and Glucose Metabolism. Circ. Res. 2021, 129, 9–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pettersen, I.K.N.; Tusubira, D.; Ashrafi, H.; Dyrstad, S.E.; Hansen, L.; Liu, X.Z.; Nilsson, L.I.H.; Lovsletten, N.G.; Berge, K.; Wergedahl, H.; et al. Upregulated PDK4 expression is a sensitive marker of increased fatty acid oxidation. Mitochondrion 2019, 49, 97–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waldecker, M.; Kautenburger, T.; Daumann, H.; Busch, C.; Schrenk, D. Inhibition of histone-deacetylase activity by short-chain fatty acids and some polyphenol metabolites formed in the colon. J. Nutr. Biochem. 2008, 19, 587–593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moffett, J.R.; Puthillathu, N.; Vengilote, R.; Jaworski, D.M.; Namboodiri, A.M. Acetate Revisited: A Key Biomolecule at the Nexus of Metabolism, Epi-genetics and Oncogenesis-Part 1: Acetyl-CoA, Acetogenesis and Acyl-CoA Short-Chain Synthetases. Front Physiol. 2020, 11, 580167. [Google Scholar] [CrossRef] [Scilit]
- Cheng, X.; Zhou, T.; He, Y.; Xie, Y.; Xu, Y.; Huang, W. The role and mechanism of butyrate in the prevention and treatment of diabetic kidney disease. Front. Microbiol. 2022, 13, 961536. [Google Scholar]
- Gonzalez, A.; Krieg, R.; Massey, H.D.; Carl, D.; Ghosh, S.; Gehr, T.W.B.; Ghosh, S.S. Sodium butyrate ameliorates insulin resistance and renal failure in CKD rats by modulating intestinal permeability and mucin expression. Nephrol. Dial. Transplant. 2019, 34, 783–794. [Google Scholar] [CrossRef] [Scilit]
- Zybailov, B.L.; Glazko, G.V.; Rahmatallah, Y.; Andreyev, D.S.; McElroy, T.; Karaduta, O.; Byrum, S.D.; Orr, L.; Tackett, A.J.; Mackintosh, S.G.; et al. Metaproteomics reveals potential mechanisms by which dietary resistant starch supplementation attenuates chronic kidney disease progression in rats. PLoS ONE 2019, 14, e0199274. [Google Scholar] [CrossRef] [Scilit]
- Yukino-Iwashita, M.; Nagatomo, Y.; Kawai, A.; Taruoka, A.; Yumita, Y.; Kagami, K.; Yasuda, R.; Toya, T.; Ikegami, Y.; Masaki, N.; et al. Short-Chain Fatty Acids in Gut-Heart Axis: Their Role in the Pathology of Heart Failure. J. Pers. Med. 2022, 12, 1805. [Google Scholar]
- Aguilar, E.C.; da Silva, J.F.; Navia-Pelaez, J.M.; Leonel, A.J.; Lopes, L.G.; Menezes-Garcia, Z.; Ferreira, A.V.M.; Capettini, L.; Teixeira, L.G.; Lemos, V.S.; et al. Sodium butyrate modulates adipocyte expansion, adipogenesis, and insulin receptor signaling by upregulation of PPAR-gamma in obese Apo E knockout mice. Nutrition 2018, 47, 75–82. [Google Scholar] [CrossRef] [Scilit]
- Amiri, P.; Hosseini, S.A.; Ghaffari, S.; Tutunchi, H.; Ghaffari, S.; Mosharkesh, E.; Asghari, S.; Roshanravan, N. Role of Butyrate, a Gut Microbiota Derived Metabolite, in cardiovascular diseases: A comprehensive narrative review. Front. Pharmacol. 2021, 12, 837509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, T.; Zhang, Z.; Sun, Y.; Zhu, R.Y.; Wang, F.X.; Ma, L.J.; Jiang, L.; Liu, H.D. Neuroprotective Effects of Sodium Butyrate by Restoring Gut Microbiota and Inhibiting TLR4 Signaling in Mice with MPTP-Induced Parkinson’s Disease. Nutrients 2023, 15, 930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anshory, M.; Effendi, R.M.R.A.; Kalim, H.; Dwiyana, R.F.; Suwarsa, O.; Nijsten, T.E.C.; Nouwen, J.L.; Thio, H.B. Butyrate Properties in Immune-Related Diseases: Friend or Foe? Fermentation 2023, 9, 205. [Google Scholar]
- Liu, S.; Zhang, S.; Wang, Y.; Lu, S.; Han, S.; Liu, Y.; Jiang, H.; Wang, C.; Liu, H. Dietary Sodium Butyrate Improves Intestinal Health of Triploid Oncorhynchus mykiss Fed a Low Fish Meal Diet. Biology 2023, 12, 145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Yi, C.X.; Katiraei, S.; Kooijman, S.; Zhou, E.; Chung, C.K.; Gao, Y.; van den Heuvel, J.K.; Meijer, O.C.; Berbee, J.F.P.; et al. Dietary butyrate ameliorates metabolic health associated with selective proliferation of gut Lachnospiraceae bacterium 28-4. JCI Insight 2023, 8, e166655. [Google Scholar] [CrossRef] [Scilit]





| Gene Name | Forward Sequence 5′→3′ | Reverse Sequence 3′→5′ |
|---|---|---|
| DPR1 | TTCCATTATCCTCGCTGTCAC | CATCAGTACCCGCATCCATG |
| FIS1 | TGACATCCGTAAAGGCATCG | CTTCTCGTATTCCTTGAGCCG |
| MFF | TAAATGAGTAAAGGAACAAGCAGTG | AGCAGTGGGAGAAGGAAATG |
| PGC-1α | CAGGCAGTAGATCCTCTTCAAG | TCCTCGTAGCTGTCATACCTG |
| PINK | GAGTATGGAGCAGTCACTTACAG | CAGCACATCAGGGTAGTCG |
| VE-cadherin | GCACCAGTTTGGCCAATATA | GGGTTTTTGCATAATAAGCAGG |
| Claudin-5 | GTTTTACGACCCGTCTGTGC | AGTGGCAGGAGAAGGTCAGC |
| GAPDH | CCAGGCGCCCAATACG | CCACATCGCTCAGACACCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nicese, M.N.; Bijkerk, R.; Van Zonneveld, A.J.; Van den Berg, B.M.; Rotmans, J.I. Sodium Butyrate as Key Regulator of Mitochondrial Function and Barrier Integrity of Human Glomerular Endothelial Cells. Int. J. Mol. Sci. 2023, 24, 13090. https://doi.org/10.3390/ijms241713090
Nicese MN, Bijkerk R, Van Zonneveld AJ, Van den Berg BM, Rotmans JI. Sodium Butyrate as Key Regulator of Mitochondrial Function and Barrier Integrity of Human Glomerular Endothelial Cells. International Journal of Molecular Sciences. 2023; 24(17):13090. https://doi.org/10.3390/ijms241713090
Chicago/Turabian StyleNicese, Maria Novella, Roel Bijkerk, Anton Jan Van Zonneveld, Bernard M. Van den Berg, and Joris I. Rotmans. 2023. "Sodium Butyrate as Key Regulator of Mitochondrial Function and Barrier Integrity of Human Glomerular Endothelial Cells" International Journal of Molecular Sciences 24, no. 17: 13090. https://doi.org/10.3390/ijms241713090
APA StyleNicese, M. N., Bijkerk, R., Van Zonneveld, A. J., Van den Berg, B. M., & Rotmans, J. I. (2023). Sodium Butyrate as Key Regulator of Mitochondrial Function and Barrier Integrity of Human Glomerular Endothelial Cells. International Journal of Molecular Sciences, 24(17), 13090. https://doi.org/10.3390/ijms241713090

