Identification of the Solid Stem Suppressor Gene Su-TdDof in Synthetic Hexaploid Wheat Syn-SAU-117
Abstract
:1. Introduction
2. Results
2.1. Differential Expression of the TdDof Gene in Different Materials
2.2. Genetic Analysis of the Solid Stem Suppressor Gene Su-TdDof
2.3. BSR-Seq Analysis of the RNA of Bulks with Contrasting Stem Solidity
2.4. Molecular Mapping of Su-TdDof
2.5. Gene Analysis of the Genomic Region of Su-TdDof
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Population Construction and Phenotypic Investigation
4.3. Observation of the Anatomical Structures of Stems
4.4. Solid Stem Gene Expression Analysis
4.5. Bulked Segregant RNA-Seq (BSR-Seq)
4.6. Kompetitive Allele-Specific PCR (KASP) Assays
4.7. Data Analysis
4.8. Candidate Gene Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAOSTAT. Food and Agricultural Organization of the United Nations. 2022. Available online: https://www.fao.org/faostat/en/ (accessed on 28 January 2022).
- UN (United Nations, Department of Economic and Social Affairs, Population Division). World Population Prospects: The 2015 Revision, Key Findings and Advance Tables; United Nations: New York, NY, USA, 2015. [Google Scholar]
- Keller, M.; Karutz, C.; Schmid, J.E.; Stamp, P.; Winzeler, M.; Keller, B.; Messmer, M.M. Quantitative trait loci for lodging resistance in a segregating wheat× spelt population. Theor. Appl. Genet. 1999, 98, 1171–1182. [Google Scholar] [CrossRef]
- Islam, M.S.; Peng, S.B.; Visperas, R.; Ereful, N.; Bhuiya, M.S.; Julfiquar, A.W. Lodging-related morphological traits of hybrid rice in a tropical irrigated ecosystem. Field Crop Res. 2007, 101, 240–248. [Google Scholar] [CrossRef]
- Acreche, M.M.; Slafer, G.A. Lodging yield penalties as affected by breeding in Mediterranean wheats. Field Crop Res. 2011, 122, 40–48. [Google Scholar] [CrossRef]
- Berry, P.M.; Spink, J. Predicting yield losses caused by lodging in wheat. Field Crop Res. 2012, 137, 19–26. [Google Scholar] [CrossRef]
- Peake, A.S.; Huth, N.I.; Carberry, P.S.; Raine, S.R.; Smith, R.J. Quantifying potential yield and lodging-related yield gaps for irrigated spring wheat in sub-tropical Australia. Field Crop Res. 2014, 158, 1–14. [Google Scholar] [CrossRef]
- Flintham, J.E.; Börner, A.; Worland, A.J.; GALE, M.D. Optimizing wheat grain yield: Effects of Rht (gibberellin-insensitive) dwarfing genes. J. Agr. Sci. 1997, 128, 11–25. [Google Scholar] [CrossRef]
- Hirano, K.; Ordonio, R.L.; Matsuoka, M. Engineering the lodging resistance mechanism of post-Green Revolution rice to meet future demands. Proc. Jpn. Acad. Ser. B 2017, 93, 220–233. [Google Scholar] [CrossRef]
- Larson, R.I.; MacDonald, M.D. Inheritance of the type of solid stem in Golden Ball (Triticum durum). III. The effect of selection for solid stem beyond F5 in hexaploid segregates of the hybrid Rescue (T. aestivum) × Golden Ball. Can. J. Genet. Cytol. 1963, 5, 437–444. [Google Scholar] [CrossRef]
- Kong, E.Y.; Liu, D.C.; Guo, X.L.; Yang, W.L.; Sun, J.Z.; Li, X.; Zhan, K.H.; Cui, D.Q.; Lin, J.X.; Zhang, A.M. Anatomical and chemical characteristics associated with lodging resistance in wheat. Crop J. 2013, 1, 43–49. [Google Scholar] [CrossRef]
- Beres, B.L.; Cárcamo, H.A.; Byers, J.R.; Clarke, F.R.; Pozniak, C.J.; Basu, S.K.; DePauw, R.M. Host plant interactions between wheat germplasm source and wheat stem sawfly Cephus cinctus Norton (Hymenoptera: Cephidae) I. Commercial cultivars. Can. J. Plant Sci. 2013, 93, 607–617. [Google Scholar] [CrossRef]
- International Wheat Genome Sequencing Consortium (IWGSC); Appels, R.; Eversole, K.; Stein, N.; Feuillet, C.; Keller, B.; Rogers, J.; Pozniak, C.; Choulet, F.; Distelfeld, A.; et al. Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 361, eaar7191. [Google Scholar]
- Nilsen, K.T.; Walkowiak, S.; Xiang, D.Q.; Gao, P.; Quilichini, T.D.; Willick, L.R.; Byrns, B.; Diaye, A.N.; Ens, J.; Wiebe, K.; et al. Copy number variation of TdDof controls solid-stemmed architecture in wheat. Proc. Natl. Acad. Sci. USA 2020, 117, 28708–28718. [Google Scholar] [CrossRef]
- Liu, Q.; Zhao, Y.; Rahman, S.J.; She, M.; Zhang, J.J.; Yang, R.C.; Islam, S.; O’Hara, G.; Varshney, R.; Liu, H.; et al. The putative vacuolar processing enzyme gene TaVPE3cB is a candidate gene for wheat stem pith-thickness. Theor. Appl. Genet. 2023, 136, 138. [Google Scholar] [CrossRef]
- Damania, A.B.; Pecetti, L.; Qualset, C.O.; Humeid, B. Diversity and geographic distribution of stem solidness and environmental stress tolerance in a collection of durum wheat landraces from Turkey. Genet. Resour. Crop Evol. 1997, 44, 101–108. [Google Scholar] [CrossRef]
- Platt, A.; Farstad, C.W. Breeding spring wheats for resistance to wheat stem sawfly attack. In Proceedings of the 7th Pacific Science Congress, Christchurch, New Zealand, 2 February–4 March 1949; Volume 4, pp. 215–220. [Google Scholar]
- Clarke, F.R.; Clarke, J.M.; Knox, R.E. Inheritance of stem solidness in eight durum wheat crosses. Can. J. Plant Sci. 2002, 82, 661–664. [Google Scholar] [CrossRef]
- Singh, A.K.; Clarke, J.M.; Knox, R.E.; Depauw, R.M.; McCaig, T.N.; Cuthbert, R.D.; Clarke, F.R.; Fernandez, M.R. AAC Raymore durum wheat. Can. J. Plant Sci. 2014, 94, 1289–1296. [Google Scholar] [CrossRef]
- Larson, R.I. Inheritance of the type of solid stem in Golden Ball (Triticum durum): I. early generations of a hybrid with Rescue (T. aestivum). Can. J. Bot. 1959, 37, 889–896. [Google Scholar] [CrossRef]
- Larson, R.I. Inheritance of the type of solid stem in Golden Ball (Triticum durum): II. Cytogenetics of the relation between solid stem and other morphological characters in hexaploid F5 lines of a hybrid with Rescue (T. aestivum). Can. J. Bot. 1959, 37, 1207–1216. [Google Scholar] [CrossRef]
- Baker, E.P. Basic studies relating to the transference of genetic characters from Triticum monococcum L. to hexaploid wheat. Aust. J. Biol. Sci. 1975, 28, 189–200. [Google Scholar]
- Bai, D.; Knott, D.R. Suppression of rust resistance in bread wheat (Triticum aestivum L.) by D-genome chromosomes. Genome 1992, 35, 276–282. [Google Scholar] [CrossRef]
- Innes, R.L.; Kerber, E.R. Resistance to wheat leaf rust and stem rust in Triticum tauschii and inheritance in hexaploid wheat of resistance transferred from T. tauschii. Genome 1994, 37, 813–822. [Google Scholar] [CrossRef]
- Kema, G.H.J.; Lange, W.; Van Silfhout, C.H. Differential suppression of stripe rust resistance in synthetic wheat hexaploids derived from Triticum turgidum subsp. dicoccoides and Aegilops squarrosa. Phytopathology 1995, 85, 425–429. [Google Scholar]
- Hanušová, R.; Hsam, S.L.K.; Bartoš, P.; Zeller, F.J. Suppression of powdery mildew resistance gene Pm8 in Triticum aestivum L. (common wheat) cultivars carrying wheat-rye translocation T1BL·1RS. Heredity 1996, 77, 383–387. [Google Scholar] [CrossRef]
- Nelson, J.C.; Singh, R.P.; Autrique, J.E.; Sorrells, M.E. Mapping genes conferring and suppressing leaf rust resistance in wheat. Crop Sci. 1997, 37, 1928–1935. [Google Scholar] [CrossRef]
- Hiebert, C.W.; Moscou, M.J.; Hewitt, T.; Steuernagel, B.; Hernández-Pinzón, I.; Green, P.; Pujol, V.; Zhang, P.; Rouse, M.N.; Jin, Y.; et al. Stem rust resistance in wheat is suppressed by a subunit of the mediator complex. Nat. Commun. 2020, 11, 1123. [Google Scholar] [CrossRef]
- Assefa, S.; Fehrmann, H. Evaluation of Aegilops tauschii Coss. for resistance to wheat stem rust and inheritance of resistance genes in hexaploid wheat. Genet. Resour. Crop Evol. 2004, 51, 663–669. [Google Scholar] [CrossRef]
- Liu, W.; Danilova, T.V.; Rouse, M.N.; Bowden, B.L.; Friebe, B.; Gill, B.S.; Pumphrey, M.O. Development and characterization of a compensating wheat-Thinopyrum intermedium Robertsonian translocation with Sr44 resistance to stem rust (Ug99). Theor. Appl. Genet. 2013, 126, 1167–1177. [Google Scholar] [CrossRef]
- Clarke, F.R.; DePauw, R.M.; Aung, T. Registration of sawfy resistant hexaploid spring wheat germplasm lines derived from durum. Crop Sci. 2005, 45, 1665–1666. [Google Scholar] [CrossRef]
- Clarke, J.M.; DePauw, R.M.; McCaig, T.N.; Fernandez, M.R.; Knox, R.E.; McLeod, J.G. AC Elsa hard red spring wheat. Can. J. Plant Sci. 1997, 77, 661–663. [Google Scholar] [CrossRef]
- Liang, D.Y.; Zhang, M.H.; Liu, X.; Li, H.; Jia, Z.J.; Wang, D.H.; Peng, T.; Hao, M.; Liu, D.C.; Jiang, B.; et al. Development and identification of four new synthetic hexaploid wheat lines with solid stems. Sci. Rep. 2022, 12, 4898. [Google Scholar] [CrossRef]
- Pauw, R.M.D.; Read, D.W.L. The effect of nitrogen and phosphorus on the expression of stem solidness in Canuck wheat at four locations in southwestern Saskatchewan. Can. J. Plant Sci. 1982, 62, 593–598. [Google Scholar] [CrossRef]
- Oiestad, A.J.; Martin, J.M.; Cook, J.; Giroux, M.J. Identification of candidate genes responsible for stem pith production using expression analysis in solid-stemmed wheat. Plant Genome 2017, 10, plantgenome2017-02. [Google Scholar] [CrossRef] [PubMed]
- Rutjens, B.; Bao, D.; Van Eck-Stouten, E.V.; Brand, M.; Smeekens, S.; Proveniers, M. Shoot apical meristem function in Arabidopsis requires the combined activities of three BEL1-like homeodomain proteins. Plant J. 2009, 58, 641–654. [Google Scholar] [CrossRef] [PubMed]
- Tao, Y.; Chen, M.; Shu, Y.J.; Zhu, Y.J.; Wang, S.; Huang, L.Y.; Yu, X.W.; Wang, Z.K.; Qian, P.P.; Gu, W.H.; et al. Identification and functional characterization of a novel BEL1-LIKE homeobox transcription factor GmBLH4 in soybean. Plant Cell Tiss. Org. 2018, 134, 331–344. [Google Scholar] [CrossRef]
- Smith, H.M.S.; Ung, N.; Lal, S.; Courtier, J. Specification of reproductive meristems requires the combined function of SHOOT MERISTEMLESS and floral integrators FLOWERING LOCUS T and FD during Arabidopsis inflorescence development. J Exp. Bot. 2011, 62, 583–593. [Google Scholar] [CrossRef]
- Fujimoto, M.; Sazuka, T.; Oda, Y.; Kawahigashi, H.; Wu, J.Z.; Takanashi, H.; Ohnishi, T.; Yoneda, J.; Ishimori, M.; Kajiya-Kanegae, H.; et al. Transcriptional switch for programmed cell death in pith parenchyma of sorghum stems. Proc. Natl. Acad. Sci. USA 2018, 115, E8783–E8792. [Google Scholar] [CrossRef]
- Ma, Q.H. The expression of caffeic acid 3-O-methyltransferase in two wheat genotypes differing in lodging resistance. J. Exp. Bot. 2009, 60, 2763–2771. [Google Scholar] [CrossRef]
- Tu, Y.; Rochfort, S.; Liu, Z.Q.; Ran, Y.D.; Griffith, M.; Badenhorst, P.; Louie, G.V.; Bowman, M.E.; Smith, K.F.; Noel, J.P.; et al. Functional analyses of caffeic acid O-methyltransferase and cinnamoyl-CoA-reductase genes from perennial ryegrass (Lolium perenne). Plant Cell 2010, 22, 3357–3373. [Google Scholar] [CrossRef]
- Miller, C.N.; Harper, A.L.; Trick, M.; Werner, P.; Waldron, K.; Bancroft, I. Elucidation of the genetic basis of variation for stem strength characteristics in bread wheat by Associative Transcriptomics. BMC Genom. 2016, 17, 500. [Google Scholar] [CrossRef]
- Chen, H.H.; Li, J.; Wan, H.S.; Wang, L.L.; Peng, Z.S.; Yang, W.Y. Microsatellite markers for culm wall thickness and anatomical features of solid stem wheat 86-741. Acta Agron. Sin. 2008, 34, 1381–1385. [Google Scholar] [CrossRef]
- Ford, M.A.; Blackwell, R.D.; Parker, M.L.; Austin, R.B. Association between stem solidity, soluble carbohydrate accumulation and other characters in wheat. Ann. Bot. 1979, 44, 731–738. [Google Scholar] [CrossRef]
- Pollock, C.J. Fructans and the metabolism of sucrose in vascular plants. New Phytol. 1986, 104, 1–24. [Google Scholar] [CrossRef] [PubMed]
- Xue, G.P.; McIntyre, C.L.; Jenkins, C.L.D.; Glassop, D.; van Herwaarden, A.F.; Shorter, R. Molecular dissection of variation in carbohydrate metabolism related to water-soluble carbohydrate accumulation in stems of wheat. Plant Physiol. 2008, 146, 441–454. [Google Scholar] [CrossRef]
- Gebbing, T. The enclosed and exposed part of the peduncle of wheat (Triticum aestivum): Spatial separation of fructan storage. New Phytol. 2003, 159, 245–252. [Google Scholar] [CrossRef]
- Blum, A. Improving wheat grain filling under stress by stem reserve mobilisation. Euphytica 1998, 100, 77–83. [Google Scholar] [CrossRef]
- Wardlaw, I.F.; Willenbrink, J. Mobilization of fructan reserves and changes in enzyme activities in wheat stems correlate with water stress during kernel filling. New Phytol. 2000, 148, 413–422. [Google Scholar] [CrossRef] [PubMed]
- Weiss, M.; Morrill, W. Wheat stem sawfy (Hymenoptera: Cephidae) revisited. Am. Entomol. 1992, 38, 241–245. [Google Scholar] [CrossRef]
- McNeal, F.H.; Watson, C.A.; Berg, M.A.; Wallace, L.E. Relationship of stem solidness to yield and lignin content in wheat selections. Agron. J. 1965, 57, 20–21. [Google Scholar] [CrossRef]
- Cook, J.; Wichman, D.; Martin, J.; Bruckner, P.; Talbert, L. Identification of microsatellite markers associated with a stem solidness locus in wheat. Crop Sci. 2004, 44, 1397–1402. [Google Scholar]
- Bainsla, N.; Yadav, R.; Sharma, R.K.; Sharma, A.; Gaikwad, K.B.; Kumar, A.; Singh, V.; Vyas, P.; Sharma, A. Mechanistic understanding of lodging in spring wheat (Triticum aestivum): An Indian perspective. Indian J Agr. Sci. 2018, 88, 1483–1495. [Google Scholar] [CrossRef]
- Hayat, M.A.; Martin, J.M.; Lanning, S.P.; McGuire, C.F.; Talbert, L.E. Variation for stem solidness and its association with agronomic traits in spring wheat. Can. J. Plant Sci. 1995, 75, 775–780. [Google Scholar] [CrossRef]
- Bruckner, P.L.; Berg, J.E.; Kushnak, G.D.; Stougaard, R.N.; Eckhoff, J.L.; Carlson, G.R.; Wichman, D.M.; Kephart, K.D.; Riveland, N.; Nash, D.L. Registration of ‘Genou’ wheat. Crop Sci. 2006, 46, 982–984. [Google Scholar] [CrossRef]
- Carlson, G.R.; Berg, J.E.; Stougaard, R.N.; Kephart, K.D.; Riveland, N.; Kushnak, G.D.; Wichman, D.M.; Eckhoff, J.L.; Nash, D.L.; Davis, E.S.; et al. Registration of ‘Bynum’ Wheat. J. Plant Regist. 2007, 1, 16–17. [Google Scholar] [CrossRef]
- Lanning, S.P.; Carlson, G.R.; Lamb, P.F.; Nash, D.; Wichman, D.M.; Kephart, K.D.; Stougaard, R.N.; Miller, J.; Kushnak, G.D.; Eckhoff, J.L.; et al. Registration of ‘Duclair’ Hard Red Spring Wheat. J. Plant Regist. 2011, 5, 349. [Google Scholar] [CrossRef]
- Knott, D.R.; Ramanujam, S. Transfer of genes for rust resistance to wheat from related species. Therm Sci. 1978, 16, 513–525. [Google Scholar]
- Hurni, S.; Brunner, S.; Stirnweis, D.; Herren, G.; Peditto, D.; McIntosh, R.A.; Keller, B. The powdery mildew resistance gene Pm8 derived from rye is suppressed by its wheat ortholog Pm3. Plant J. 2014, 79, 904–913. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Xia, X.C.; Rosewarne, G.M.; Zhu, H.Z.; Li, S.Z.; Zhang, Z.Y.; He, Z.H. Stripe rust resistance gene Yr18 and its suppressor gene in Chinese wheat landraces. Plant Breed. 2015, 134, 634–640. [Google Scholar] [CrossRef]
- Athiyannan, N.; Long, Y.; Kang, H.; Chandramohan, S.; Bhatt, D.; Zhang, Q.J.; Klindworth, D.L.; Rouse, M.N.; Friesen, T.L.; McIntosh, R.; et al. Haplotype variants of Sr46 in Aegilops tauschii, the diploid D genome progenitor of wheat. Theor. Appl. Genet. 2022, 135, 2627–2639. [Google Scholar]
- Jin, H.L.; Zhang, H.P.; Zhao, X.Y.; Long, L.; Guan, F.N.; Wang, Y.P.; Huang, L.Y.; Zhang, X.Y.; Wang, Y.Q.; Li, H.; et al. Identification of a suppressor for the wheat stripe rust resistance gene Yr81 in Chinese wheat landrace Dahongpao. Theor. Appl. Genet. 2023, 136, 67. [Google Scholar] [CrossRef]
- Huang, L.; Brooks, S.A.; Li, W.L.; Feller, J.P.; Trick, H.N.; Gill, B.S. Map-based cloning of leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat. Genetics 2003, 164, 655–664. [Google Scholar] [CrossRef]
- Arora, S.; Steuernagel, B.; Gaurav, K.; Chandramohan, S.; Long, Y.M.; Matny, O.; Johnson, R.; Enk, J.; Periyannan, S.; Singh, N.; et al. Resistance gene cloning from a wild crop relative by sequence capture and association genetics. Nat. Biotechnol. 2019, 37, 139–143. [Google Scholar] [CrossRef]
- Kerber, E.R.; Green, G.J. Suppression of stem rust resistance in the hexaploid wheat cv. Canthatch by chromosome 7DL. Can. J. Bot. 1980, 58, 1347–1350. [Google Scholar] [CrossRef]
- Kerber, E.R. Stem-rust resistance in ‘Canthatch’ hexaploid wheat induced by a nonsuppressor mutation on chromosome 7DL. Genome 1991, 34, 935–939. [Google Scholar] [CrossRef]
- Williams, N.D.; Miller, J.D.; Klindworth, D.L. Induced mutations of a genetic suppressor of resistance to wheat stem rust. Crop Sci. 1992, 32, 612–616. [Google Scholar] [CrossRef]
- Talajoor, M.; Jin, Y.; Wan, A.; Chen, X.M.; Bhavani, S.; Tabe, L.; Lagudah, E.; Huang, L. Specificity of a rust resistance suppressor on 7DL in the spring wheat cultivar Canthatch. Phytopathology 2015, 105, 477–481. [Google Scholar] [CrossRef] [PubMed]
- Mclntosh, R.A. Genetics of resistance to pathogens and pests: Recent developments. In Proceedings of the 8th International Wheat Genetic Symposium, Beijing, China, 20–25 July 1993; Volume 2, pp. 889–896. [Google Scholar]
- Hao, M.; Zhang, L.Q.; Zhao, L.B.; Dai, S.F.; Li, A.L.; Yang, W.Y.; Xie, D.; Li, Q.C.; Ning, S.Z.; Yan, Z.H.; et al. A breeding strategy targeting the secondary gene pool of bread wheat: Introgression from a synthetic hexaploid wheat. Theor. Appl. Genet. 2019, 132, 2285–2294. [Google Scholar] [CrossRef]
- Li, Y.H.; Shi, X.H.; Hu, J.H.; Wu, P.P.; Qiu, D.; Qu, Y.F.; Xie, J.Z.; Wu, Q.H.; Zhang, H.J.; Yang, L.; et al. Identification of a recessive gene PmQ conferring resistance to powdery mildew in wheat landrace Qingxinmai using BSR-Seq analysis. Plant Dis. 2020, 104, 743–751. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-Seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabrielet, S.; Daly, M.; et al. The genome analysis toolkit: A mapreduce framework for analyzing next-generation DNA sequencing data. Genome Re. 2010, 20, 1297–1303. [Google Scholar] [CrossRef]
- Lander, E.S.; Green, P.; Abrahamson, J.; Barlow, A.; Daly, M.J.; Lincoln, S.E.; Newburg, L. MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1987, 1, 174–181. [Google Scholar] [CrossRef] [PubMed]
- Kosambi, D.D. The estimation of map distances from recombination values. In Selected Works in Mathematics and Statistics; Springer: New Delhi, India, 2016; pp. 125–130. [Google Scholar]
- Liu, R.H.; Meng, J.L. MapDraw: A microsoft excel macro for drawing genetic linkage maps based on given genetic linkage data. Hereditas 2003, 25, 317–321. [Google Scholar] [PubMed]
- Luo, M.C.; Gu, Y.Q.; Puiu, D.; Wang, H.; Twardziok, S.V.; Deal, K.R.; Huo, N.X.; Zhu, T.T.; Wang, L.; Wang, Y.; et al. Genome sequence of the progenitor of the wheat D genome Aegilops tauschii. Nature 2017, 551, 498–502. [Google Scholar] [CrossRef] [PubMed]
Parents and Cross | Generation a | No. of Plants/Families | Observed Ratio b | Actual Ratio | Expected Ratio | χ2 | p-Value | ||
---|---|---|---|---|---|---|---|---|---|
S | Seg | Ss | |||||||
Syn-SAU-117 | PSs | 20 | 20 | ||||||
Syn-SAU-119 | PS | 20 | 20 | ||||||
PSs × PS | F1 | 20 | 20 | ||||||
F2 | 156 | 36 | 120 | 0.9:3 | 1:3 | 0.308 | 0.579 | ||
F2:3 | 134 | 35 | 67 | 32 | 1.04:2:0.96 | 1:2:1 | 0.134 | 0.935 |
Marker | Physical Position (bp) | Allele 1 Primer a | Allele 2 Primer b | Common/Reverse Primer |
---|---|---|---|---|
KASP-533 | 5,336,907 | TCAGCTTCAATTTCGGCAGC | TCAGCTTCAATTTCGGCAGT | AGAAGCTGAACGTGCGGAAG |
KASP-669 | 6,695,986 | GTCGGATTCGGTTACTTTGAC | GTCGGATTCGGTTACTTTGAT | AGAGGTGCATGGTGTCGT |
KASP-1055 | 10,558,194 | TCTTTCTCCTTCAGCCTCTTA | TCTTTCTCCTTCAGCCTCTTG | GCCTGATTGTAGTACATTATG |
KASP-1166 | 11,664,145 | AACGAGGTCCCGCGCTCCTCCC | AACGAGGTCCCGCGCTCCTCCG | GTGTGAAGAGCGCTTCTGC |
Parents | Marker Genotype a | |||
---|---|---|---|---|
KASP-533 | KASP-669 | KASP-1055 | KASP-1166 | |
AS92 | CC | CC | AA | CC |
Syn-SAU-117 | CC | CC | AA | CC |
Syn-SAU-119 | TT | TT | GG | GG |
AS96 | TT | TT | GG | GG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Liu, X.; Zhang, J.; Chen, L.; Zhang, M.; Miao, Y.; Ma, P.; Hao, M.; Jiang, B.; Ning, S.; et al. Identification of the Solid Stem Suppressor Gene Su-TdDof in Synthetic Hexaploid Wheat Syn-SAU-117. Int. J. Mol. Sci. 2023, 24, 12845. https://doi.org/10.3390/ijms241612845
Li H, Liu X, Zhang J, Chen L, Zhang M, Miao Y, Ma P, Hao M, Jiang B, Ning S, et al. Identification of the Solid Stem Suppressor Gene Su-TdDof in Synthetic Hexaploid Wheat Syn-SAU-117. International Journal of Molecular Sciences. 2023; 24(16):12845. https://doi.org/10.3390/ijms241612845
Chicago/Turabian StyleLi, Hui, Xin Liu, Junqing Zhang, Longyu Chen, Minghu Zhang, Yongping Miao, Pan Ma, Ming Hao, Bo Jiang, Shunzong Ning, and et al. 2023. "Identification of the Solid Stem Suppressor Gene Su-TdDof in Synthetic Hexaploid Wheat Syn-SAU-117" International Journal of Molecular Sciences 24, no. 16: 12845. https://doi.org/10.3390/ijms241612845
APA StyleLi, H., Liu, X., Zhang, J., Chen, L., Zhang, M., Miao, Y., Ma, P., Hao, M., Jiang, B., Ning, S., Huang, L., Yuan, Z., Chen, X., Chen, X., Liu, D., Wan, H., & Zhang, L. (2023). Identification of the Solid Stem Suppressor Gene Su-TdDof in Synthetic Hexaploid Wheat Syn-SAU-117. International Journal of Molecular Sciences, 24(16), 12845. https://doi.org/10.3390/ijms241612845