Macrophage Profiling in Head and Neck Cancer to Improve Patient Prognosis and Assessment of Cancer Cell–Macrophage Interactions Using Three-Dimensional Coculture Models
Abstract
:1. Introduction
2. Results
2.1. Macrophage Scores and Patient Survival (Training Analysis)
2.2. Validation of the Macroscore
2.3. Formation and Characterization of Spheroids
2.4. Impact of Macrophage Subpopulations on Cancer Cells Development
2.5. Influence of Distinct Spheroid Conditions on the Apoptotic Profile
2.6. Analysis of the Monocyte Differentiation during the Coculture with Cancer Cells
2.7. Gene Expression Variations across the Spheroid Conditions
2.8. Cytokine Profile Variations in Culture Medium of 3D Spheroid
3. Discussion
4. Materials and Methods
4.1. Patients and Clinical Characteristics
4.2. Immunohistochemistry and Macrophage Number Quantification
4.3. Cell Culture
4.4. PBMC Purification and Isolation
4.5. Tumor Spheroid Formation and Characterization
4.6. Immunofluorescence
4.7. RNA Extraction, cDNA Synthesis, and qPCR
4.8. Flow Cytometry
4.9. In Vitro Apoptosis Assay
4.10. Assessment of Cytokine Profiles
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA A Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Dong, H.; Li, M.; Yang, C.; Wei, W.; He, X.; Cheng, G.; Wang, S. Combination therapy with oncolytic viruses and immune checkpoint inhibitors in head and neck squamous cell carcinomas: An approach of complementary advantages. Cancer Cell Int. 2023, 23, 1. [Google Scholar] [CrossRef]
- Ding, Y.; Chu, L.; Cao, Q.; Lei, H.; Li, X.; Zhuang, Q. A meta-validated immune infiltration-related gene model predicts prognosis and immunotherapy sensitivity in HNSCC. BMC Cancer 2023, 23, 45. [Google Scholar] [CrossRef] [PubMed]
- Kim, L.; King, T.; Agulnik, M. Head and Neck Cancer: Changing Epidemiology and Public Health Implications. Oncology 2010, 24, 915. [Google Scholar]
- Wei, R.; Liu, S.; Zhang, S.; Min, L.; Zhu, S. Cellular and Extracellular Components in Tumor Microenvironment and Their Application in Early Diagnosis of Cancers. Anal. Cell. Pathol. 2020, 2020, 6283796. [Google Scholar] [CrossRef] [Green Version]
- Quail, D.F.; Joyce, J.A. Microenvironmental regulation of tumor progression and metastasis. Nat. Med. 2013, 19, 1423–1437. [Google Scholar] [CrossRef]
- He, K.-F.; Zhang, L.; Huang, C.-F.; Ma, S.-R.; Wang, Y.-F.; Wang, W.-M.; Zhao, Z.-L.; Liu, B.; Zhao, Y.-F.; Zhang, W.-F.; et al. CD163+ Tumor-Associated Macrophages Correlated with Poor Prognosis and Cancer Stem Cells in Oral Squamous Cell Carcinoma. BioMed Res. Int. 2014, 2014, 838632. [Google Scholar] [CrossRef] [Green Version]
- Bisheshar, S.K.; van der Kamp, M.F.; de Ruiter, E.J.; Ruiter, L.N.; van der Vegt, B.; Breimer, G.E.; Willems, S.M. The prognostic role of tumor associated macrophages in squamous cell carcinoma of the head and neck: A systematic review and meta-analysis. Oral. Oncol. 2022, 135, 106227. [Google Scholar] [CrossRef]
- Seminerio, I.; Kindt, N.; Descamps, G.; Bellier, J.; Lechien, J.R.; Mat, Q.; Pottier, C.; Journé, F.; Saussez, S. High infiltration of CD68+ macrophages is associated with poor prognoses of head and neck squamous cell carcinoma patients and is influenced by human papillomavirus. Oncotarget 2018, 9, 11046–11059. [Google Scholar] [CrossRef] [Green Version]
- Hu, Y.; He, M.-Y.; Zhu, L.-F.; Yang, C.-C.; Zhou, M.-L.; Wang, Q.; Zhang, W.; Zheng, Y.-Y.; Wang, D.-M.; Xu, Z.-Q.; et al. Tumor-associated macrophages correlate with the clinicopathological features and poor outcomes via inducing epithelial to mesenchymal transition in oral squamous cell carcinoma. J. Exp. Clin. Cancer Res. 2016, 35, 12. [Google Scholar] [CrossRef] [Green Version]
- Li, B.; Ren, M.; Zhou, X.; Han, Q.; Cheng, L. Targeting tumor-associated macrophages in head and neck squamous cell carcinoma. Oral Oncol. 2020, 106, 104723. [Google Scholar] [CrossRef] [PubMed]
- Lewis, C.E.; Pollard, J.W. Distinct Role of Macrophages in Different Tumor Microenvironments. Cancer Res. 2006, 66, 605–612. [Google Scholar] [CrossRef] [Green Version]
- Genard, G.; Lucas, S.; Michiels, C. Reprogramming of Tumor-Associated Macrophages with Anticancer Therapies: Radiotherapy versus Chemo- and Immunotherapies. Front. Immunol. 2017, 8, 828. [Google Scholar] [CrossRef] [Green Version]
- Petty, A.J.; Yang, Y. Tumor-associated macrophages: Implications in cancer immunotherapy. Immunotherapy 2017, 9, 289–302. [Google Scholar] [CrossRef] [Green Version]
- Mantovani, A.; Sica, A.; Sozzani, S.; Allavena, P.; Vecchi, A.; Locati, M. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 2004, 25, 677–686. [Google Scholar] [CrossRef]
- Jayasingam, S.D.; Citartan, M.; Thang, T.H.; Mat Zin, A.A.; Ang, K.C.; Ch’ng, E.S. Evaluating the Polarization of Tumor-Associated Macrophages Into M1 and M2 Phenotypes in Human Cancer Tissue: Technicalities and Challenges in Routine Clinical Practice. Front. Oncol. 2020, 9, 1512. [Google Scholar] [CrossRef] [Green Version]
- Nowak, M.; Klink, M. The Role of Tumor-Associated Macrophages in the Progression and Chemoresistance of Ovarian Cancer. Cells 2020, 9, 1299. [Google Scholar] [CrossRef] [PubMed]
- Lechien, J.R.; Descamps, G.; Seminerio, I.; Furgiuele, S.; Dequanter, D.; Mouawad, F.; Badoual, C.; Journe, F.; Saussez, S. HPV Involvement in the Tumor Microenvironment and Immune Treatment in Head and Neck Squamous Cell Carcinomas. Cancers 2020, 12, 1060. [Google Scholar] [CrossRef]
- Kubota, K.; Moriyama, M.; Furukawa, S.; Rafiul, H.A.S.M.; Maruse, Y.; Jinno, T.; Tanaka, A.; Ohta, M.; Ishiguro, N.; Yamauchi, M.; et al. CD163+CD204+ tumor-associated macrophages contribute to T cell regulation via interleukin-10 and PD-L1 production in oral squamous cell carcinoma. Sci. Rep. 2017, 7, 1755. [Google Scholar] [CrossRef] [Green Version]
- Baal, N.; Widmer-Teske, R.; McKinnon, T.; Preissner, K.T.; Zygmunt, M.T. In vitro spheroid model of placental vasculogenesis: Does it work? Lab. Investig. 2009, 89, 152–163. [Google Scholar] [CrossRef] [Green Version]
- Friedrich, J.; Seidel, C.; Ebner, R.; Kunz-Schughart, L.A. Spheroid-based drug screen: Considerations and practical approach. Nat. Protoc. 2009, 4, 309–324. [Google Scholar] [CrossRef]
- Ma, H.; Jiang, Q.; Han, S.; Wu, Y.; Tomshine, J.C.; Wang, D.; Gan, Y.; Zou, G.; Liang, X.-J. Multicellular Tumor Spheroids as an in Vivo–Like Tumor Model for Three-Dimensional Imaging of Chemotherapeutic and Nano Material Cellular Penetration. Mol. Imaging 2012, 11, 487–498. [Google Scholar] [CrossRef]
- LaBarbera, D.V.; Reid, B.G.; Yoo, B.H. The multicellular tumor spheroid model for high-throughput cancer drug discovery. Expert. Opin. Drug Discov. 2012, 7, 819–830. [Google Scholar] [CrossRef]
- Tung, Y.-C.; Hsiao, A.Y.; Allen, S.G.; Torisawa, Y.; Ho, M.; Takayama, S. High-throughput 3D spheroid culture and drug testing using a 384 hanging drop array. Analyst 2011, 136, 473–478. [Google Scholar] [CrossRef]
- Kunz-Schughart, L.A.; Freyer, J.P.; Hofstaedter, F.; Ebner, R. The Use of 3-D Cultures for High-Throughput Screening: The Multicellular Spheroid Model. SLAS Discov. 2004, 9, 273–285. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chan, H.F.; Zhang, Y.; Ho, Y.-P.; Chiu, Y.-L.; Jung, Y.; Leong, K.W. Rapid formation of multicellular spheroids in double-emulsion droplets with controllable microenvironment. Sci. Rep. 2013, 3, 3462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Asghar, W.; El Assal, R.; Shafiee, H.; Pitteri, S.; Paulmurugan, R.; Demirci, U. Engineering cancer microenvironments for in vitro 3-D tumor models. Mater. Today 2015, 18, 539–553. [Google Scholar] [CrossRef]
- Nath, S.; Devi, G.R. Three-dimensional culture systems in cancer research: Focus on tumor spheroid model. Pharmacol. Ther. 2016, 163, 94–108. [Google Scholar] [CrossRef] [Green Version]
- Linde, N.; Gutschalk, C.M.; Hoffmann, C.; Yilmaz, D.; Mueller, M.M. Integrating Macrophages into Organotypic Co-Cultures: A 3D In Vitro Model to Study Tumor-Associated Macrophages. PLoS ONE 2012, 7, e40058. [Google Scholar] [CrossRef]
- Madsen, N.H.; Nielsen, B.S.; Nhat, S.L.; Skov, S.; Gad, M.; Larsen, J. Monocyte Infiltration and Differentiation in 3D Multicellular Spheroid Cancer Models. Pathogens 2021, 10, 969. [Google Scholar] [CrossRef]
- Troiano, G.; Caponio, V.C.A.; Adipietro, I.; Tepedino, M.; Santoro, R.; Laino, L.; Lo Russo, L.; Cirillo, N.; Lo Muzio, L. Prognostic significance of CD68+ and CD163+ tumor associated macrophages in head and neck squamous cell carcinoma: A systematic review and meta-analysis. Oral. Oncol. 2019, 93, 66–75. [Google Scholar] [CrossRef] [PubMed]
- Ang, K.K.; Harris, J.; Wheeler, R.; Weber, R.; Rosenthal, D.I.; Nguyen-Tân, P.F.; Westra, W.H.; Chung, C.H.; Jordan, R.C.; Lu, C.; et al. Human Papillomavirus and Survival of Patients with Oropharyngeal Cancer. N. Engl. J. Med. 2010, 363, 24–35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Furgiuele, S.; Descamps, G.; Lechien, J.R.; Dequanter, D.; Journe, F.; Saussez, S. Immunoscore Combining CD8, FoxP3, and CD68-Positive Cells Density and Distribution Predicts the Prognosis of Head and Neck Cancer Patients. Cells 2022, 11, 2050. [Google Scholar] [CrossRef]
- Pagès, F.; Mlecnik, B.; Marliot, F.; Bindea, G.; Ou, F.-S.; Bifulco, C.; Lugli, A.; Zlobec, I.; Rau, T.T.; Berger, M.D.; et al. International validation of the consensus Immunoscore for the classification of colon cancer: A prognostic and accuracy study. Lancet 2018, 391, 2128–2139. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Ren, Y.; Guo, H.; Mao, R.; Xie, H.; Su, H.; She, Y.; Deng, J.; Yang, M.; Han, B.; et al. A new method for predicting survival in stage I non-small cell lung cancer patients: Nomogram based on macrophage immunoscore, TNM stage and lymphocyte-to-monocyte ratio. Ann. Transl. Med. 2020, 8, 470. [Google Scholar] [CrossRef] [PubMed]
- Petrillo, M.; Zannoni, G.F.; Martinelli, E.; Pedone Anchora, L.; Ferrandina, G.; Tropeano, G.; Fagotti, A.; Scambia, G. Polarisation of Tumor-Associated Macrophages toward M2 Phenotype Correlates with Poor Response to Chemoradiation and Reduced Survival in Patients with Locally Advanced Cervical Cancer. PLoS ONE 2015, 10, e0136654. [Google Scholar] [CrossRef]
- Macciò, A.; Gramignano, G.; Cherchi, M.C.; Tanca, L.; Melis, L.; Madeddu, C. Role of M1-polarized tumor-associated macrophages in the prognosis of advanced ovarian cancer patients. Sci. Rep. 2020, 10, 6096. [Google Scholar] [CrossRef] [Green Version]
- Pantano, F.; Berti, P.; Guida, F.M.; Perrone, G.; Vincenzi, B.; Amato, M.M.C.; Righi, D.; Dell’Aquila, E.; Graziano, F.; Catalano, V.; et al. The role of macrophages polarization in predicting prognosis of radically resected gastric cancer patients. J. Cell. Mol. Med. 2013, 17, 1415–1421. [Google Scholar] [CrossRef] [Green Version]
- Kuen, J.; Darowski, D.; Kluge, T.; Majety, M. Pancreatic cancer cell/fibroblast co-culture induces M2 like macrophages that influence therapeutic response in a 3D model. PLoS ONE 2017, 12, e0182039. [Google Scholar] [CrossRef] [Green Version]
- Raghavan, S.; Mehta, P.; Xie, Y.; Lei, Y.L.; Mehta, G. Ovarian cancer stem cells and macrophages reciprocally interact through the WNT pathway to promote pro-tumoral and malignant phenotypes in 3D engineered microenvironments. J. Immunother. Cancer 2019, 7, 190. [Google Scholar] [CrossRef] [Green Version]
- Evans, L.; Milward, K.; Attanoos, R.; Clayton, A.; Errington, R.; Tabi, Z. Macrophage Plasticity and Function in the Lung Tumour Microenvironment Revealed in 3D Heterotypic Spheroid and Explant Models. Biomedicines 2021, 9, 302. [Google Scholar] [CrossRef]
- Yuan, A.; Hsiao, Y.-J.; Chen, H.-Y.; Chen, H.-W.; Ho, C.-C.; Chen, Y.-Y.; Liu, Y.-C.; Hong, T.-H.; Yu, S.-L.; Chen, J.J.W.; et al. Opposite Effects of M1 and M2 Macrophage Subtypes on Lung Cancer Progression. Sci. Rep. 2015, 5, 14273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giri, J.; Das, R.; Nylen, E.; Chinnadurai, R.; Galipeau, J. CCL2 and CXCL12 Derived from Mesenchymal Stromal Cells Cooperatively Polarize IL-10+ Tissue Macrophages to Mitigate Gut Injury. Cell Rep. 2020, 30, 1923–1934.e4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, F.; Kitajima, S.; Kohno, S.; Yoshida, A.; Tange, S.; Sasaki, S.; Okada, N.; Nishimoto, Y.; Muranaka, H.; Nagatani, N.; et al. Retinoblastoma Inactivation Induces a Protumoral Microenvironment via Enhanced CCL2 Secretion. Cancer Res. 2019, 79, 3903–3915. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Denaro, N.; Solinas, C.; Garrone, O.; Cauchi, C.; Ruatta, F.; Wekking, D.; Abbona, A.; Paccagnella, M.; Merlano, M.C.; Lo Nigro, C. The Role of Cytokinome in the HNSCC Tumor Microenvironment: A Narrative Review and Our Experience. Diagnostics 2022, 12, 2880. [Google Scholar] [CrossRef]
- Kai, K.; Moriyama, M.; Haque, A.S.M.R.; Hattori, T.; Chinju, A.; Hu, C.; Kubota, K.; Miyahara, Y.; Kakizoe-Ishiguro, N.; Kawano, S.; et al. Oral Squamous Cell Carcinoma Contributes to Differentiation of Monocyte-Derived Tumor-Associated Macrophages via PAI-1 and IL-8 Production. IJMS 2021, 22, 9475. [Google Scholar] [CrossRef]
- Xu, Q.; Ma, H.; Chang, H.; Feng, Z.; Zhang, C.; Yang, X. The interaction of interleukin-8 and PTEN inactivation promotes the malignant progression of head and neck squamous cell carcinoma via the STAT3 pathway. Cell Death Dis. 2020, 11, 405. [Google Scholar] [CrossRef]
- Gao, L.; Zhang, W.; Zhong, W.; Liu, Z.; Li, H.; Yu, Z.; Zhao, Y. Tumor associated macrophages induce epithelial to mesenchymal transition via the EGFR/ERK1/2 pathway in head and neck squamous cell carcinoma. Oncol. Rep. 2018, 40, 2558–2572. [Google Scholar] [CrossRef]
- Zhang, Q.; Mao, Z.; Sun, J. NF-κB inhibitor, BAY11-7082, suppresses M2 tumor-associated macrophage induced EMT potential via miR-30a/NF-κB/Snail signaling in bladder cancer cells. Gene 2019, 710, 91–97. [Google Scholar] [CrossRef]
- Bayne, L.J.; Beatty, G.L.; Jhala, N.; Clark, C.E.; Rhim, A.D.; Stanger, B.Z.; Vonderheide, R.H. Tumor-Derived Granulocyte-Macrophage Colony-Stimulating Factor Regulates Myeloid Inflammation and T Cell Immunity in Pancreatic Cancer. Cancer Cell 2012, 21, 822–835. [Google Scholar] [CrossRef] [Green Version]
- Ebrahimi, B.; Tucker, S.L.; Li, D.; Abbruzzese, J.L.; Kurzrock, R. Cytokines in pancreatic carcinoma: Correlation with phenotypic characteristics and prognosis. Cancer 2004, 101, 2727–2736. [Google Scholar] [CrossRef] [PubMed]
- Furgiuele, S.; Descamps, G.; Cascarano, L.; Boucq, A.; Dubois, C.; Journe, F.; Saussez, S. Dealing with Macrophage Plasticity to Address Therapeutic Challenges in Head and Neck Cancers. IJMS 2022, 23, 6385. [Google Scholar] [CrossRef] [PubMed]
- Descamps, G.; Furgiuele, S.; Mhaidly, N.; Journe, F.; Saussez, S. Immune Cell Density Evaluation Improves the Prognostic Values of Staging and p16 in Oropharyngeal Cancer. Cancers 2022, 14, 5560. [Google Scholar] [CrossRef]
- Bankhead, P.; Loughrey, M.B.; Fernández, J.A.; Dombrowski, Y.; McArt, D.G.; Dunne, P.D.; McQuaid, S.; Gray, R.T.; Murray, L.J.; Coleman, H.G.; et al. QuPath: Open source software for digital pathology image analysis. Sci. Rep. 2017, 7, 16878. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Variables | Number of Cases |
---|---|
n = 54 | |
Age | |
Median (range, years) | 62 (42–89) |
Gender | |
Male | 41 |
Female | 13 |
Anatomic site | |
Oral cavity | 20 |
Oropharynx | 16 |
Larynx | 15 |
Hypopharynx | 2 |
Nasopharynx | 1 |
Tumor stage | |
I–II | 31 |
III–IV | 16 |
Unknown | 7 |
Risk factors | |
Tobacco | |
Smoker | 47 |
Non-smoker | 7 |
Alcohol | |
Drinker | 33 |
Non-drinker | 21 |
p16 status | |
Positive | 26 |
Negative | 28 |
Overall survival (OS) | |
Median (range, months) | 24 (1–106) |
Alive | 26 |
Dead | 28 |
Multivariate Analysis | Overall Survival | |
---|---|---|
p-Value | HR | |
M2Tot/M1Tot score | 0.005 | 4.19 |
M1Tot + M2Tot score | 0.005 | 3.47 |
Multivariate Analysis | Overall Survival | |
---|---|---|
p-Value | HR | |
M2Tot/M1Tot score | 0.004 | 4.31 |
M1Tot + M2Tot score | 0.014 | 3.14 |
p16 | 0.525 | 0.76 |
Multivariate Analysis | Overall Survival | |
---|---|---|
p-Value | HR | |
M2Tot/M1Tot score | 0.007 | 4.73 |
M1Tot + M2Tot score | 0.009 | 3.64 |
Stage | 0.728 | 0.84 |
Multivariate Analysis | Overall Survival | |
---|---|---|
p-Value | HR | |
Macroscore | 0.006 | 3.81 |
p16 | 0.886 | 1.07 |
Stage | 0.874 | 0.92 |
Variables | Number of Cases |
---|---|
n = 19 | |
Age | |
Median (range, years) | 59 (31–72) |
Gender | |
Male | 15 |
Female | 4 |
Anatomic site | |
Oral cavity | 11 |
Oropharynx | 2 |
Larynx | 5 |
Hypopharynx | 1 |
Tumor stage | |
I–II | 4 |
III–IV | 15 |
Risk factors | |
Tobacco | |
Smoker | 11 |
Non-smoker | 3 |
Former smoker | 4 |
Alcohol | |
Drinker | 5 |
Non-drinker | 12 |
Former drinker | 1 |
p16 status | |
Positive | 1 |
Negative | 18 |
Overall survival (OS) | |
Median (range, months) | 18 (1–34) |
Alive | 10 |
Dead | 9 |
Targets | Antibodies | Antibody Dilutions | Blocking Solutions | Secondary Antibodies |
---|---|---|---|---|
CD68 | Anti-CD68, Anti-human, Rabbit monoclonal, Cell signaling (Danvers, MA, USA) | 1/800 | PBS/NGS 5%/Triton 0.3% | Goat anti-Rabbit IgG (H + L) Highly Cross-Absorbed Secondary Antibody, Alexa Fluor Plus 488 |
CD86 | Anti-CD86, Anti-human, Rabbit monoclonal, Cell Signaling | 1/100 | PBS/NGS 5%/Triton 0.3% | Goat anti-Rabbit IgG (H + L) Highly Cross-Absorbed Secondary Antibody, Alexa Fluor Plus 488 |
CD206 | Anti-CD206, Anti-human, Mouse monoclonal, Cell signaling | 1/100 | PBS/BSA 2% | Chicken anti-Mouse IgG (H + L) Highly Cross-Absorbed Secondary Antibody, Alexa Fluor 594 |
Ki-67 | Anti-Ki-67, Anti-human, Mouse monoclonal, Cell signaling | 1/200 | PBS/NGS 5%/Triton 0.3% | Chicken anti-Mouse IgG (H + L) Highly Cross-Absorbed Secondary Antibody, Alexa Fluor 594 |
EpCAM | Anti-EpCAM, Anti-human, Goat monoclonal, Cell signaling | 1/50 | PBS/BSA 2% | Donkey anti-Goat IgG (H + L) Highly Cross-Absorbed Secondary Antibody, Alexa Fluor 647 |
Vimentin | Anti-Vimentin, Anti-human, Mouse monoclonal, Agilent (Santa Clara, CA, USA) | 1/50 | PBS/BSA 2% | Goat anti-Mouse IgG (H + L) Highly Cross-Absorbed Secondary Antibody, Alexa Fluor Plus 555 |
Genes | Forward Sequences | Reverse Sequences |
---|---|---|
18S | CATTTAGGTGACACTATAGAAGACGATCAGATACCGTCGTAGTTCC | GGATCCTAATACGACTCACTATAGGCCTTTAAGTTTCAGCTTTGCAACC |
IL10 | TCAAGGCGCATGTGAACTCC | GATGTCAAACTCACTCATGGCT |
CD206 | CTACAAGGGATCGGGTTTATGGA | TTGGCATTGCCTAGTAGCGTA |
E-cadherin | ATTTTTCCCTCGACACCCGAT | TCCCAGGCGTAGACCAAGA |
Vimentin | AGTCCACTGAGTACCGGAGAC | CATTTCACGCATCTGGCGTTC |
CD80 | GGGCACATACGAGTGTGTTGT | TCAGCTTTGACTGATAACGTC AC |
CD86 | CTGCTCATCTATACACGGTTACC | GG AAACGTCGTACAGTTCTGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mhaidly, N.; Journe, F.; Najem, A.; Stock, L.; Trelcat, A.; Dequanter, D.; Saussez, S.; Descamps, G. Macrophage Profiling in Head and Neck Cancer to Improve Patient Prognosis and Assessment of Cancer Cell–Macrophage Interactions Using Three-Dimensional Coculture Models. Int. J. Mol. Sci. 2023, 24, 12813. https://doi.org/10.3390/ijms241612813
Mhaidly N, Journe F, Najem A, Stock L, Trelcat A, Dequanter D, Saussez S, Descamps G. Macrophage Profiling in Head and Neck Cancer to Improve Patient Prognosis and Assessment of Cancer Cell–Macrophage Interactions Using Three-Dimensional Coculture Models. International Journal of Molecular Sciences. 2023; 24(16):12813. https://doi.org/10.3390/ijms241612813
Chicago/Turabian StyleMhaidly, Nour, Fabrice Journe, Ahmad Najem, Louis Stock, Anne Trelcat, Didier Dequanter, Sven Saussez, and Géraldine Descamps. 2023. "Macrophage Profiling in Head and Neck Cancer to Improve Patient Prognosis and Assessment of Cancer Cell–Macrophage Interactions Using Three-Dimensional Coculture Models" International Journal of Molecular Sciences 24, no. 16: 12813. https://doi.org/10.3390/ijms241612813