High Prevalence of Plasmid-Mediated Quinolone Resistance among ESBL/AmpC-Producing Enterobacterales from Free-Living Birds in Poland
Abstract
:1. Introduction
2. Results
2.1. Complete Nucleotide Sequence of pAM1
2.2. Characterization of the Genetic Environment of qnrB19
2.3. Resistance Pattern of E. coli SN25556
2.4. Detection of Genes Coding for ESBL Resistance and AmpC Lactamase
2.5. Detection of the qnrB19 Gene
3. Discussion
4. Materials and Methods
4.1. Fecal Samples and Bacterial Isolates
4.2. Antimicrobial Susceptibility Testing
4.3. Sequencing Strategy
4.4. PCR Amplification and DNA Sequencing
4.5. Restriction Analysis of PCR Products
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ruiz, J. Transferable mechanisms of quinolone resistance from 1998 onward. Clin. Microbiol. Rev. 2019, 32, e00007-19. [Google Scholar] [CrossRef]
- Tran, J.H.; Jacoby, G.A. Mechanism of plasmid-mediated quinolone resistance. Proc. Natl. Acad. Sci. USA 2002, 99, 5638–5642. [Google Scholar] [CrossRef]
- Martinez-Martinez, L.; Cano, M.E.; Rodriguez-Martinez, J.M.; Calvo, J.; Pascual, A. Plasmid-mediated quinolone resistance. Expert Rev. Anti. Infect. Ther. 2008, 6, 685–711. [Google Scholar] [CrossRef]
- Jacoby, G.A.; Strahilevitz, J.; Hooper, D.C. Plasmid-mediated quinolone resistance. Microbiol. Spectr. 2014, 2, 475–503. [Google Scholar] [CrossRef] [Green Version]
- Martinez-Martinez, L.; Pascual, A.; Jacoby, G.A. Quinolone resistance from a transferable plasmid. Lancet 1998, 351, 797–799. [Google Scholar] [CrossRef]
- Jacoby, G.A.; Griffin, C.M.; Hooper, D.C. Citrobacter spp. as a source of qnrB alleles. Antimicrob. Agents Chemother. 2011, 55, 4979–4984. [Google Scholar] [CrossRef] [Green Version]
- Strahilevitz, J.; Jacoby, G.A.; Hooper, D.C.; Robicsek, A. Plasmid-mediated quinolone resistance: A multifaceted threat. Clin. Microbiol. Rev. 2009, 22, 664–689. [Google Scholar] [CrossRef] [Green Version]
- Veldman, K.; Cavaco, L.M.; Mevius, D.; Battisti, A.; Franco, A.; Botteldoorn, N.; Bruneau, M.; Perrin-Guyomard, A.; Cerny, T.; de Frutos Escobar, C.; et al. International collaborative study on the occurrence of plasmid-mediated quinolone resistance in Salmonella enterica and Escherichia coli isolated from animals, humans, food and the environment in 13 European countries. J. Antimicrob. Chemother. 2011, 66, 1278–1286. [Google Scholar] [CrossRef] [Green Version]
- Miranda, C.D.; Concha, C.; Godoy, F.A.; Lee, M.R. Aquatic environments as hotspots of transferable low-level quinolone resistance and their potential contribution to high-level quinolone resistance. Antibiotics 2022, 11, 1487. [Google Scholar] [CrossRef]
- Dionisi, A.M.; Lucarelli, C.; Owczarek, S.; Luzi, I.; Villa, L. Characterization of the plasmid-borne quinolone resistance gene qnrB19 in Salmonella enterica serovar Typhimurium. Antimicrob. Agents Chemother. 2009, 53, 4019–4021. [Google Scholar] [CrossRef] [Green Version]
- Hammerl, J.A.; Beutlich, J.; Hertwig, S.; Mevius, D.; Threlfall, E.J.; Helmuth, R.; Guerra, B. pSGI15, a small ColE-like qnrB19 plasmid of a Salmonella enterica serovar Typhimurium strain carrying Salmonella genomic island 1 (SGI1). J. Antimicrob. Chemother. 2010, 65, 173–175. [Google Scholar] [CrossRef] [Green Version]
- Andres, P.; Lucero, C.; Soler-Bistue, A.; Guerriero, L.; Albornoz, E.; Tran, T.; Zorreguieta, A.; Galas, M.; Corso, A.; Tolmasky, M.E.; et al. Differential distribution of plasmid-mediated quinolone resistance genes in clinical Enterobacteria with unusual phenotypes of quinolone susceptibility from Argentina. Antimicrob. Agents Chemother. 2013, 57, 2467–2475. [Google Scholar] [CrossRef] [Green Version]
- Tyson, G.H.; Li, C.; Hsu, C.-H.; Bodeis-Jones, S.; McDermott, P.F. Diverse fluoroquinolone resistance plasmids from retail meat E. coli in United States. Front. Microbiol. 2019, 10, 2826. [Google Scholar] [CrossRef] [Green Version]
- Juraschek, K.; Malekzadah, J.; Malorny, B.; Kasbohrer, A.; Schwarz, S.; Meemken, D.; Hammerl, J.A. Characterization of qnrB-carrying plasmids from ESBL- and non-ESBL-producing Escherichia coli. BMC Genom. 2022, 23, 365. [Google Scholar] [CrossRef]
- Cattoir, V.; Nordmann, P.; Silva-Sanchez, J.; Espinal, P.; Poirel, L. ISEcp1-mediated transposition of qnrB-like gene in Escherichia coli. Antimicrob. Agents Chemother. 2008, 52, 2929–2932. [Google Scholar] [CrossRef] [Green Version]
- Hordijk, J.; Bosman, A.B.; van Essen-Zandbergen, A.; Veldman, K.; Dierikx, C.; Wagenaar, J.A.; Mevius, D. qnrB19 gene bracketed by IS26 on a 40-kilobase IncR plasmid from an Escherichia coli isolate from a veal calf. Antimicrob. Agents Chemother. 2011, 55, 453–454. [Google Scholar] [CrossRef] [Green Version]
- Richter, S.N.; Frasson, I.; Bergo, C.; Manganelli, R.; Cavallaro, A.; Palu, G. Characterisation of qnr plasmid-mediated quinolone resistance in Enterobacteriaceae from Italy: Association of the qnrB19 allele with the integron element ISCR1 in Escherichia coli. Int. J. Antimicrob. Agents 2010, 35, 578–583. [Google Scholar] [CrossRef] [Green Version]
- Schink, A.-K.; Kadlec, K.; Schwarz, S. Detection of qnr genes among Escherichia coli isolates of animal origin and complete sequence of the conjugative qnrB19-carrying plasmid pQNR2078. J. Antimicrob. Chemother. 2012, 67, 1099–1102. [Google Scholar] [CrossRef]
- Tran, T.; Andres, P.; Petroni, A.; Soler-Bistue, A.; Albornoz, E.; Zorreguieta, A.; Reyes-Lamothe, R.; Sherratt, D.J.; Corso, A.; Tolmasky, M.E. Small plasmids harboring qnrB19: A model for plasmid evolution mediated by site-specific recombination at oriT and Xer sites. Antimicrob. Agents Chemother. 2012, 56, 1821–1827. [Google Scholar] [CrossRef] [Green Version]
- Ares-Arroyo, M.; Rocha, E.P.C.; Gonzalez Zorn, B. Evolution of ColE1-like plasmids across γ-Proteobacteria: From bacteriocin production to antimicrobial resistance. PLoS Genet. 2021, 17, e1009919. [Google Scholar] [CrossRef]
- Rybak, B.; Krawczyk, B.; Furmanek-Blaszk, B.; Wysocka, M.; Fordon, M.; Ziolkowski, P.; Meissner, W.; Stepniewska, K.; Sikorska, K. Antibiotic resistance, virulence and phylogenetic analysis of Escherichia coli strains isolated from free-living birds in human habitats. PLoS ONE 2022, 17, e0262236. [Google Scholar] [CrossRef] [PubMed]
- Amin, M.B.; Saha, S.R.; Islam, M.R.; Haider, S.M.A.; Hossain, M.I.; Chowdhury, A.S.M.H.K.; Rousham, C.K.; Islam, M.A. High prevalence of plasmid-mediated quinolone resistance (PMQR) among E. coli from aquatic environments in Bangladesh. PLoS ONE 2021, 16, e0261970. [Google Scholar] [CrossRef] [PubMed]
- Mann, S.; Chen, Y.-P.P. Bacterial genomic G+C composition-eliciting environmental adaptation. Genomics 2010, 95, 7–15. [Google Scholar] [CrossRef] [Green Version]
- Karczmarczyk, M.; Martins, M.; McCusker, M.; Mattar, S.; Amaral, L.; Leonard, N.; Aarestrup, F.M.; Fanning, S. Characterization of antimicrobial resistance in Salmonella enterica food and animal isolates from Colombia: Identification of a qnrB19-mediated quinolone resistance marker in two novel serovars. FEMS Microbiol. Lett. 2010, 313, 10–19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dery, K.J.; Chavideh, R.; Waters, V.; Chamorro, R.; Tolmasky, L.S.; Tolmasky, M.E. Characterization of the replication and mobilization regions of the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid 1997, 38, 97–105. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.-H.; Fu, J.-F.; Liu, S.-T. A repeat sequence causes competition of ColE1-type plasmids. PLoS ONE 2013, 8, e61668. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rice, L.B.; Carias, L.L.; Hutton, R.A.; Rudin, S.D.; Endimiani, A.; Bonomo, R.A. The KQ element, a complex genetic region conferring transferable resistance to carbapenems, aminoglycosides, and fluoroquinolones in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2008, 52, 3427–3429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Poirel, L.; Lartigue, M.-F.; Decousser, J.-W.; Nordmann, P. ISEcp1B-mediated transposition of blaCTX-M in Escherichia coli. Antimicrob. Agents Chemother. 2005, 49, 447–450. [Google Scholar] [CrossRef] [Green Version]
- Poirel, L.; Decousser, J.-W.; Nordmann, P. Insertion sequence ISEcp1B is involved in expression and mobilization of a blaCTX-M β-lactamase gene. Antimicrob. Agents Chemother. 2003, 47, 2938–2945. [Google Scholar] [CrossRef] [Green Version]
- Partridge, S.R.; Kwong, S.M.; Firth, N.; Jensen, S.O. Mobile genetic elements associated with antimicrobial resistance. Clin. Microbiol. Rev. 2018, 31, e00088-17. [Google Scholar] [CrossRef] [Green Version]
- Bonnedahl, J.; Jarhult, J.D. Antibiotic resistance in wild birds. Upsala J. Med. Sci. 2014, 19, 113–116. [Google Scholar] [CrossRef] [Green Version]
- Rozwandowicz, M.; Brouwer, M.S.M.; Fischer, J.; Wagenaar, J.A.; Gonzalez-Zorn, B.; Guerra, B.; Mevius, D.J.; Hordijk, J. Plasmids carrying antimicrobial resistance in Enterobacteriaceae. J. Antimicrob. Chemother. 2018, 73, 1121–1137. [Google Scholar] [CrossRef] [Green Version]
- Fiegen, U.; Klein, G.; de Jong, A.; Kehrenberg, K. Detection of a novel qnrB19-carrying plasmid variant mediating decreased fluoroquinolone susceptibility in Salmonella eneterica serovar Hadar. Mircob. Drug Resist. 2017, 23, 280–284. [Google Scholar] [CrossRef]
- Pallecchi, L.; Riccobono, E.; Mantella, A.; Bartalesi, F.; Sennati, S.; Gamboa, H.; Gotuzzo, E.; Bartoloni, A.; Rossolini, G.-M. High prevalence of qnr genes in commensal enterobacteria from healthy children in Peru and Bolivia. Antimicrob. Agents Chemother. 2009, 53, 2632–2635. [Google Scholar] [CrossRef] [Green Version]
- Pallecchi, L.; Riccobono, E.; Sennati, S.; Mantella, A.; Bartalesi, F.; Trigoso, C.; Gotuzzo, E.; Bartoloni, A.; Rossolini, G.-M. Characterization of small ColE-like plasmids mediating widespread dissemination of the qnrB19 gene in commensal enterobacteria. Antimicrob. Agents Chemother. 2010, 54, 678–682. [Google Scholar] [CrossRef] [Green Version]
- Pallecchi, L.; Riccobono, E.; Mantella, A.; Fernandez, C.; Bartalesi, F.; Rodriguez, H.; Gotuzzo, E.; Bartoloni, A.; Rossolini, G.M. Small qnrB-harbouring ColE-like plasmids widespread in commensal enterobacteria from a remote Amazonas population not exposed to antibiotics. J. Antimcrob. Chemother. 2011, 66, 1176–1178. [Google Scholar] [CrossRef] [Green Version]
- Jamborova, I.; Dolejska, M.; Vojtech, J.; Guenther, S.; Uricariu, R.; Drozdowska, J.; Papousek, I.; Pasekova, K.; Meissner, W.; Hordowski, J.; et al. Plasmid –mediated resistance to cephalosporins and fluoroquinolones in various Escherichia coli sequence types isolated from rooks wintering in Europe. Appl. Environ. Microbiol. 2015, 81, 648–657. [Google Scholar] [CrossRef] [Green Version]
- Zurfluh, K.; Albini, S.; Mattmann, P.; Kindle, P.; Nüesch-Inderbinen, M.; Stephan, R.; Vogler, B. Antimicrobial resistant and extended-spectrum β-lactamase producing Escherichia coli in common wild bird species in Switzerland. MicrobiologyOpen 2019, 8, e845. [Google Scholar] [CrossRef] [Green Version]
- Ben Yahia, H.; Chairat, S.; Gharsa, H.; Alonso, C.A.; Ben Sallem, R.; Porres-Osante, N.; Hamdi, N.; Torres, C.; Slama, K.B. First report of KPC-2 and KPC-3-producing Enterobacteriaceae in wild birds in Africa. Microb. Ecol. 2020, 79, 30–37. [Google Scholar] [CrossRef] [PubMed]
- Bonnedahl, J.; Drobni, M.; Gauthier-Clerc, M.; Hernandez, J.; Granholm, S.; Kayser, Y.; Melhus, A.; Kahlmeter, G.; Waldenstrom, J.; Johansson, A. Dissemination of Escherichia coli with CTX-M type ESBL between humans and yellow-legged gulls in the South of France. PLoS ONE 2009, 4, e5958. [Google Scholar] [CrossRef]
- Guenther, S.; Grobbel, M.; Beutlich, J.; Bethe, A.; Friedrich, N.D.; Goedecke, A.; Lubke-Becker, A.; Guerra, B.; Wieler, L.H.; Ewers, C. CTX-M-15-type extended-spectrum beta-lactamases-producing Escherichia coli from wild birds in Germany. Environ. Microbiol. Rep. 2010, 2, 641–645. [Google Scholar] [CrossRef] [PubMed]
- Alcala, L.; Alonso, C.A.; Simon, C.; Gonzalez-Esteban, C.; Oros, J.; Rezusta, A.; Ortega, C.; Torres, C. Wild birds, frequent carriers of extended-spectrum β-lactamase (ESBL) producing Escherichia coli of CTX-M and SHV-12 types. Microb. Ecol. 2016, 72, 861–869. [Google Scholar] [CrossRef] [PubMed]
- Oteo, J.; Mencia, A.; Bautista, V.; Pastor, N.; Lara, N.; Gonzalez-Gonzalez, F.; Garcia-Pena, F.J.; Campos, J. Colonization with Enterobacteriaceae-producing ESBLs, AmpCs, and OXA-48 in wild avian species, Spain 2015–2016. Microb. Drug Resist. 2018, 24, 932–938. [Google Scholar] [CrossRef] [PubMed]
- Stedt, J.; Bonnedahl, J.; Hernandez, J.; Waldenstrom, J.; McMahon, B.J.; Tolf, C.; Olsen, B.; Drobni, M. Carriage of CTX-M type extended spectrum β-lactamases (ESBL) in gulls across Europe. Acta Vet. Scand. 2015, 57, 74. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brolund, A. Overview of ESBL-producing Enterobacteriaceae from a Nordic perspective. Infect. Ecol. Epidemiol. 2014, 4, 10. [Google Scholar] [CrossRef] [Green Version]
- Fischer, J.; Schmoger, S.; Jahn, S.; Helmuth, R.; Guerra, B. NDM-1 carbapenemase-producing Salmonella enterica subsp. enterica serovar Corvallis isolated from a wild bird in Germany. J. Antimicrob. Chemother. 2013, 68, 2954–2956. [Google Scholar] [CrossRef] [Green Version]
- Vittecoq, M.; Laurens, C.; Brazier, L.; Durand, P.; Elguero, E.; Arnal, A.; Thomas, F.; Aberkane, S.; Renaud, N.; Prugnolle, F.; et al. VIM-1 carbapenemase producing Escherichia coli in gulls from southern France. Ecol. Evol. 2017, 7, 1224–1232. [Google Scholar] [CrossRef]
- Poirel, L.; Villa, L.; Bertini, A.; Pitout, J.D.; Nordmann, P.; Carattoli, A. Expanded-spectrum β-lactamase and plasmid-mediated quinolone resistance. Emerg. Infect. Dis. 2007, 13, 803–805. [Google Scholar] [CrossRef]
- Athanasakopoulou, Z.; Reinicke, M.; Diezel, C.; Sofia, M.; Chatzopoulos, D.C.; Braun, S.D.; Reissig, A.; Spyrou, V.; Monecke, V.; Ehricht, R.; et al. Antimicrobial resistance genes in ESBL-producing Escherichia coli isolates from animals in Greece. Antibiotics 2021, 10, 389. [Google Scholar] [CrossRef]
- Silva-Sanchez, J.; Cruz-Trujillo, E.; Barrios, H.; Reyna-Flores, F.; Sanchez-Perez, A.; Garza-Ramos, U.; Bacterial Resistance Consortium. Characterization of plasmid-mediated quinolone resistance (PMQR) genes in extended-spectrum β-lactamase–producing Enterobacteriaceae pediatric clinical isolates in Mexico. PLoS ONE 2013, 8, e77968. [Google Scholar] [CrossRef]
- Piekarska, K.; Wolkowicz, T.; Zacharczuk, K.; Rzeczkowska, M.; Chrost, A.; Bareja, E.; Olak, M.; Gierczynski, R. Co-existence of plasmid-mediated quinolone resistance determinants and mutation in gyrA and parC among fluoroquinolone-resistant clinical Enterobacteriaceae isolated in tertiary hospital in Warsaw, Poland. Int. J. Antimicrob. Agents 2015, 45, 238–243. [Google Scholar] [CrossRef] [PubMed]
- Piekarska, K.; Zacharczuk, K.; Wolkowicz, T.; Wolaniuk, N.; Rzeczkowska, M.; Gierczynski, R. Emergence of Enterobacteriaceae co-producing CTX-M-15, ArmA and PMQR in Poland. Adv. Clin. Exp. Med. 2019, 28, 249–254. [Google Scholar] [CrossRef] [PubMed]
- Osinska, A.; Harnisz, M.; Korzeniewska, E. Prevalence of plasmid-mediated multidrug resistance determinants in fluoroquinolone-resistant bacteria isolated from sewage and surface water. Environ. Sci. Pollut. Res. 2016, 23, 10818–10831. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Osinska, M.; Nowakiewicz, A.; Zieba, P.; Gnat, S.; Lagowski, D.; Troscianczyk, A. A rich mosaic of resistance in extended-spectrum β-lactamase-producing Escherichia coli isolated from red foxes (Vulpes vulpes) in Poland as a potential effect of increasing synanthropization. Sci. Total Environ. 2022, 818, 151834. [Google Scholar] [CrossRef]
- Skarzynska, M.; Zajac, M.; Bomba, A.; Bocian, L.; Kozdrun, W.; Polak, M.; Wiacek, J.; Wasyl, D. Antimicrobial resistance glides in the sky-free living birds as a reservoir of resistant Escherichia coli with zoonotic potential. Front. Microbiol. 2021, 12, 656223. [Google Scholar] [CrossRef] [PubMed]
- Clinical Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
- Cattoir, V.; Poirel, L.; Rotimi, V.; Soussy, C.; Nordmann, P. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother. 2007, 60, 394–397. [Google Scholar] [CrossRef] [Green Version]
Description of Sequence | Nucleotide Sequence of IRL and IRRs (14 bp) a | No of Base Pairs Identical to Perfect IRR |
---|---|---|
IRL of ISEcp1 Deduced perfect IRR IRR1 IRR2 IRR3 | 5′-CCTAGATTCTACGT-3′ 5′-ACGTAGAATCTAGG-3′ 5′-ACGCAGATCCAGCG-3′ 5′-ACCCAGTAATTCAG-3′ 5′-AAGTTGAGATTATA-3′ | 8 7 7 |
Antibiotic | Escherichia coli SN25556 Zone Diam (mm) | Escherichia coli ATCC 25922 Zone Diam (mm) |
---|---|---|
Ampicillin | 24 | 21 |
Amoxicillin/clavulanic acid | 18 | 18 |
Piperacillin/tazobactam | 23 | 29 |
Cefuroxime | 10 | 30 |
Cefotaxime | 20 | 30 |
Ceftazidime | 17 | 25 |
Cefepime | 28 | 33 |
Meropenem | 28 | 32 |
Imipenem | 28 | 29 |
Nalidixic acid | 15 | 25 |
Ciprofloxacin | 23 | 32 |
Levofloxacin | 19 | 31 |
Norfloxacin | 22 | 31 |
Amikacin | 21 | 22 |
Netilmicin | 20 | 22 |
Gentamycin | 20 | 28 |
Tetracycline | 22 | 30 |
Tigecycline | 20 | 24 |
Trimethoprim/sulfamethoxazole | 25 | 38 |
Nitrofurantoine | 21 | 25 |
Primers | Nucleotide Sequences 5′ to 3′ | Reference |
---|---|---|
pBRforEco pBRrevEco pAM1 pAM2 pAMfor pAMrev | AATAGGCGTATCACGAGGC TAAAGCTTATCGATGATAA CCGCATCAACGACATGCC CTCCTTCCTGGTATCTCCC CGTGAATTCAGCAGCAGCAAG CTGGAATTCACGCAGATCCAGCGT | This study This study This study This study This study This study |
Primers | Nucleotide Sequences 5′ to 3′ | Size | Reference |
---|---|---|---|
qnrB19-F qnrB19-R | GGMATHGAAATTCGCCACTG a TTTGCYGYYCGCCAGTCGAA a | 263 bp | [57] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Furmanek-Blaszk, B.; Sektas, M.; Rybak, B. High Prevalence of Plasmid-Mediated Quinolone Resistance among ESBL/AmpC-Producing Enterobacterales from Free-Living Birds in Poland. Int. J. Mol. Sci. 2023, 24, 12804. https://doi.org/10.3390/ijms241612804
Furmanek-Blaszk B, Sektas M, Rybak B. High Prevalence of Plasmid-Mediated Quinolone Resistance among ESBL/AmpC-Producing Enterobacterales from Free-Living Birds in Poland. International Journal of Molecular Sciences. 2023; 24(16):12804. https://doi.org/10.3390/ijms241612804
Chicago/Turabian StyleFurmanek-Blaszk, Beata, Marian Sektas, and Bartosz Rybak. 2023. "High Prevalence of Plasmid-Mediated Quinolone Resistance among ESBL/AmpC-Producing Enterobacterales from Free-Living Birds in Poland" International Journal of Molecular Sciences 24, no. 16: 12804. https://doi.org/10.3390/ijms241612804
APA StyleFurmanek-Blaszk, B., Sektas, M., & Rybak, B. (2023). High Prevalence of Plasmid-Mediated Quinolone Resistance among ESBL/AmpC-Producing Enterobacterales from Free-Living Birds in Poland. International Journal of Molecular Sciences, 24(16), 12804. https://doi.org/10.3390/ijms241612804