Plasma Exosomal microRNA Profile Reveals miRNA 148a-3p Downregulation in the Mucosal-Dominant Variant of Pemphigus Vulgaris
Abstract
1. Introduction
2. Results
2.1. Patient Selection
2.2. Dsg3-Positive Exosomes in Peripheral Blood
2.3. Exosomal miRNA Expression Profile and miR-148a-3p Study
2.4. MPV IgG Induced MMP7 via miR-148a-3p Downregulation in Primary Human Keratinocytes
3. Discussion
4. Materials and Methods
4.1. Patients, Study Design, and Approvals
4.2. Sample Collection
4.3. MPV-IgG Purification
4.4. In Vitro MPV Cell Model
4.5. P-EV Isolation and Purification
4.6. EV Characterization
4.6.1. Dynamic Light Scattering (DLS)
4.6.2. Nanoparticle Tracking Analysis
4.7. P-EV Enrichment Using Magnetic Beads
4.8. Exosomal Small RNA-Seq Analysis
4.9. MiRNA Target Predictions
4.10. Quantitative Real-Time PCR (qPCR)
4.11. Protein Extraction and Western Blot Analysis
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hudemann, C.; Exner, Y.; Pollmann, R.; Schneider, K.; Zakrzewicz, A.; Feldhoff, S.; Schmidt, T.; Spindler, V.; Rafei-Shamsabadi, D.; Vollner, F.; et al. IgG against the Membrane-Proximal Portion of the Desmoglein 3 Ectodomain Induces Loss of Keratinocyte Adhesion, a Hallmark in Pemphigus Vulgaris. J. Investig. Dermatol. 2023, 143, 254–263.e253. [Google Scholar] [CrossRef] [PubMed]
- Hammers, C.M.; Stanley, J.R. Mechanisms of Disease: Pemphigus and Bullous Pemphigoid. Annu. Rev. Pathol. 2016, 11, 175–197. [Google Scholar] [CrossRef]
- Schauer, F.; Ishii, N.; Mockenhaupt, M.; Bruckner-Tuderman, L.; Hashimoto, T.; Kiritsi, D. Radiation-Associated Pemphigus Vulgaris in a Patient with Preceding Malignancy: Treatment with Rituximab as a Valuable Option. Front. Immunol. 2019, 10, 3116. [Google Scholar] [CrossRef] [PubMed]
- Saha, M.; Bhogal, B.; Black, M.M.; Cooper, D.; Vaughan, R.W.; Groves, R.W. Prognostic factors in pemphigus vulgaris and pemphigus foliaceus. Br. J. Dermatol. 2014, 170, 116–122. [Google Scholar] [CrossRef] [PubMed]
- Hudson, M.B.; Woodworth-Hobbs, M.E.; Zheng, B.; Rahnert, J.A.; Blount, M.A.; Gooch, J.L.; Searles, C.D.; Price, S.R. miR-23a is decreased during muscle atrophy by a mechanism that includes calcineurin signaling and exosome-mediated export. Am. J. Physiol. Cell Physiol. 2014, 306, C551–C558. [Google Scholar] [CrossRef]
- Wang, M.; Liang, L.; Li, L.; Han, K.; Li, Q.; Peng, Y.; Peng, X.; Zeng, K. Increased miR-424-5p expression in peripheral blood mononuclear cells from patients with pemphigus. Mol. Med. Rep. 2017, 15, 3479–3484. [Google Scholar] [CrossRef]
- Liu, Q.; Cui, F.; Wang, M.; Xiong, H.; Peng, X.; Liang, L.; Li, L.; Zhang, J.; Peng, X.; Zeng, K. Increased expression of microRNA-338-3p contributes to production of Dsg3 antibody in pemphigus vulgaris patients. Mol. Med. Rep. 2018, 18, 550–556. [Google Scholar] [CrossRef]
- Manca, S.; Magrelli, A.; Cialfi, S.; Lefort, K.; Ambra, R.; Alimandi, M.; Biolcati, G.; Uccelletti, D.; Palleschi, C.; Screpanti, I.; et al. Oxidative stress activation of miR-125b is part of the molecular switch for Hailey-Hailey disease manifestation. Exp. Dermatol. 2011, 20, 932–937. [Google Scholar] [CrossRef]
- Malik, A.M.; Tupchong, S.; Huang, S.; Are, A.; Hsu, S.; Motaparthi, K. An Updated Review of Pemphigus Diseases. Medicina 2021, 57, 1080. [Google Scholar] [CrossRef]
- Lim, Y.L.; Bohelay, G.; Hanakawa, S.; Musette, P.; Janela, B. Autoimmune Pemphigus: Latest Advances and Emerging Therapies. Front. Mol. Biosci. 2021, 8, 808536. [Google Scholar] [CrossRef]
- Fidder, S.A.R.; Bolling, M.C.; Diercks, G.F.H.; Pas, H.H.; Hooimeijer, L.H.L.; Bungener, L.B.; Willemse, B.W.M.; Scheenstra, R.; Stapelbroek, J.M.; van der Doef, H.P.J. Paraneoplastic pemphigus associated with post-transplant lymphoproliferative disorder after small bowel transplantation. Pediatr. Transplant. 2021, 25, e14023. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Xing, Y.; Li, C.; Zhou, P.; Hu, X.; Hua, H.; Wei, P. Identification of Six microRNAs as Potential Biomarkers for Pemphigus Vulgaris: From Diagnosis to Pathogenesis. Diagnostics 2022, 12, 3058. [Google Scholar] [CrossRef] [PubMed]
- Xu, R.; Greening, D.W.; Zhu, H.J.; Takahashi, N.; Simpson, R.J. Extracellular vesicle isolation and characterization: Toward clinical application. J. Clin. Investig. 2016, 126, 1152–1162. [Google Scholar] [CrossRef]
- Culton, D.A.; McCray, S.K.; Park, M.; Roberts, J.C.; Li, N.; Zedek, D.C.; Anhalt, G.J.; Cowley, D.O.; Liu, Z.; Diaz, L.A. Mucosal pemphigus vulgaris anti-Dsg3 IgG is pathogenic to the oral mucosa of humanized Dsg3 mice. J. Investig. Dermatol. 2015, 135, 1590–1597. [Google Scholar] [CrossRef] [PubMed]
- Xu, E.; Zhao, J.; Ma, J.; Wang, C.; Zhang, C.; Jiang, H.; Cheng, J.; Gao, R.; Zhou, X. miR-146b-5p promotes invasion and metastasis contributing to chemoresistance in osteosarcoma by targeting zinc and ring finger 3. Oncol. Rep. 2016, 35, 275–283. [Google Scholar] [CrossRef]
- Xiao, J.; Lin, H.-Y.; Zhu, Y.-Y.; Zhu, Y.-P.; Chen, L.-W. MiR-126 Regulates Proliferation and Invasion in the Bladder Cancer BLS Cell Line by Targeting the PIK3R2-Mediated PI3K/Akt Signaling Pathway [Retraction]. OncoTargets Ther. 2021, 14, 1859–1860. [Google Scholar] [CrossRef]
- Lu, Q.; Qin, H.; Tan, H.; Wei, C.; Yang, X.; He, J.; Liang, W.; Li, J. Senescence Osteoblast-Derived Exosome-Mediated miR-139-5p Regulates Endothelial Cell Functions. BioMed Res. Int. 2021, 2021, 5576023. [Google Scholar] [CrossRef]
- Zhang, Q.; Liu, S.; Parajuli, K.R.; Zhang, W.; Zhang, K.; Mo, Z.; Liu, J.; Chen, Z.; Yang, S.; Wang, A.R.; et al. Interleukin-17 promotes prostate cancer via MMP7-induced epithelial-to-mesenchymal transition. Oncogene 2017, 36, 687–699. [Google Scholar] [CrossRef]
- Yang, Y.; Li, X.; Du, J.; Yin, Y.; Li, Y. Involvement of microRNAs-MMPs-E-cadherin in the migration and invasion of gastric cancer cells infected with Helicobacter pylori. Exp. Cell Res. 2018, 367, 196–204. [Google Scholar] [CrossRef]
- Patel, H.P.; Diaz, L.A.; Anhalt, G.J.; Labib, R.S.; Takahashi, Y. Demonstration of pemphigus antibodies on the cell surface of murine epidermal cell monolayers and their internalization. J. Investig. Dermatol. 1984, 83, 409–415. [Google Scholar] [CrossRef]
- Spindler, V.; Drenckhahn, D.; Zillikens, D.; Waschke, J. Pemphigus IgG causes skin splitting in the presence of both desmoglein 1 and desmoglein 3. Am. J. Pathol. 2007, 171, 906–916. [Google Scholar] [CrossRef] [PubMed]
- Lotti, R.; Atene, C.G.; Zanfi, E.D.; Bertesi, M.; Zanocco-Marani, T. In Vitro, Ex Vivo, and In Vivo Models for the Study of Pemphigus. Int. J. Mol. Sci. 2022, 23, 7044. [Google Scholar] [CrossRef] [PubMed]
- Schmitt, T.; Waschke, J. Autoantibody-Specific Signalling in Pemphigus. Front. Med. 2021, 8, 701809. [Google Scholar] [CrossRef] [PubMed]
- Srivatsav, A.T.; Kapoor, S. The Emerging World of Membrane Vesicles: Functional Relevance, Theranostic Avenues and Tools for Investigating Membrane Function. Front. Mol. Biosci. 2021, 8, 640355. [Google Scholar] [CrossRef]
- Rezaie, J.; Feghhi, M.; Etemadi, T. A review on exosomes application in clinical trials: Perspective, questions, and challenges. Cell Commun. Signal. CCS 2022, 20, 145. [Google Scholar] [CrossRef]
- Gurung, S.; Perocheau, D.; Touramanidou, L.; Baruteau, J. The exosome journey: From biogenesis to uptake and intracellular signalling. Cell Commun. Signal. CCS 2021, 19, 47. [Google Scholar] [CrossRef]
- Song, D.; Yang, D.; Powell, C.A.; Wang, X. Cell-cell communication: Old mystery and new opportunity. Cell Biol. Toxicol. 2019, 35, 89–93. [Google Scholar] [CrossRef]
- Mosquera-Heredia, M.I.; Morales, L.C.; Vidal, O.M.; Barcelo, E.; Silvera-Redondo, C.; Velez, J.I.; Garavito-Galofre, P. Exosomes: Potential Disease Biomarkers and New Therapeutic Targets. Biomedicines 2021, 9, 1061. [Google Scholar] [CrossRef]
- Valentino, A.; Reclusa, P.; Sirera, R.; Giallombardo, M.; Camps, C.; Pauwels, P.; Crispi, S.; Rolfo, C. Exosomal microRNAs in liquid biopsies: Future biomarkers for prostate cancer. Clin. Transl. Oncol. 2017, 19, 651–657. [Google Scholar] [CrossRef]
- Ogata-Kawata, H.; Izumiya, M.; Kurioka, D.; Honma, Y.; Yamada, Y.; Furuta, K.; Gunji, T.; Ohta, H.; Okamoto, H.; Sonoda, H.; et al. Circulating exosomal microRNAs as biomarkers of colon cancer. PLoS ONE 2014, 9, e92921. [Google Scholar] [CrossRef]
- Kim, D.K.; Lee, J.; Kim, S.R.; Choi, D.S.; Yoon, Y.J.; Kim, J.H.; Go, G.; Nhung, D.; Hong, K.; Jang, S.C.; et al. EVpedia: A community web portal for extracellular vesicles research. Bioinformatics 2015, 31, 933–939. [Google Scholar] [CrossRef] [PubMed]
- Zaborowski, M.P.; Balaj, L.; Breakefield, X.O.; Lai, C.P. Extracellular Vesicles: Composition, Biological Relevance, and Methods of Study. Bioscience 2015, 65, 783–797. [Google Scholar] [CrossRef] [PubMed]
- Belkacem Chebil, R.; Oueslati, Y.; Marzouk, M.; Ben Fredj, F.; Oualha, L.; Douki, N. Oral Lichen Planus and Lichenoid Lesions in Sjogren’s Syndrome Patients: A Prospective Study. Int. J. Dent. 2019, 2019, 1603657. [Google Scholar] [CrossRef] [PubMed]
- Peng, Q.; Yang, J.Y.; Zhou, G. Emerging functions and clinical applications of exosomes in human oral diseases. Cell Biosci. 2020, 10, 68. [Google Scholar] [CrossRef]
- Weiske, J.; Schoneberg, T.; Schroder, W.; Hatzfeld, M.; Tauber, R.; Huber, O. The fate of desmosomal proteins in apoptotic cells. J. Biol. Chem. 2001, 276, 41175–41181. [Google Scholar] [CrossRef]
- Cirillo, N.; Femiano, F.; Gombos, F.; Lanza, A. Metalloproteinase 9 is the outer executioner of desmoglein 3 in apoptotic keratinocytes. Oral Dis. 2007, 13, 341–345. [Google Scholar] [CrossRef]
- Ivars, M.; Espana, A.; Alzuguren, P.; Pelacho, B.; Lasarte, J.J.; Lopez-Zabalza, M.J. The involvement of ADAM10 in acantholysis in mucocutaneous pemphigus vulgaris depends on the autoantibody profile of each patient. Br. J. Dermatol. 2020, 182, 1194–1204. [Google Scholar] [CrossRef]
- Heupel, W.M.; Zillikens, D.; Drenckhahn, D.; Waschke, J. Pemphigus vulgaris IgG directly inhibit desmoglein 3-mediated transinteraction. J. Immunol. 2008, 181, 1825–1834. [Google Scholar] [CrossRef]
- Hudemann, C.; Maglie, R.; Llamazares-Prada, M.; Beckert, B.; Didona, D.; Tikkanen, R.; Schmitt, T.; Hashimoto, T.; Waschke, J.; Hertl, M.; et al. Human Desmocollin 3—Specific IgG Antibodies Are Pathogenic in a Humanized HLA Class II Transgenic Mouse Model of Pemphigus. J. Investig. Dermatol. 2022, 142, 915–923.e913. [Google Scholar] [CrossRef]
- Liu, M.; Zhang, G.; Naqvi, S.; Zhang, F.; Kang, T.; Duan, Q.; Wang, Z.; Xiao, S.; Zheng, Y. Cytotoxicity of Saikosaponin A targets HEKa cell through apoptosis induction by ROS accumulation and inflammation suppression via NF-kappaB pathway. Int. Immunopharmacol. 2020, 86, 106751. [Google Scholar] [CrossRef]
- Cho, A.; Caldara, A.L.; Ran, N.A.; Menne, Z.; Kauffman, R.C.; Affer, M.; Llovet, A.; Norwood, C.; Scanlan, A.; Mantus, G.; et al. Single-Cell Analysis Suggests that Ongoing Affinity Maturation Drives the Emergence of Pemphigus Vulgaris Autoimmune Disease. Cell Rep. 2019, 28, 909–922.e906. [Google Scholar] [CrossRef] [PubMed]
- Di Cristo, F.; Calarco, A.; Digilio, F.A.; Sinicropi, M.S.; Rosano, C.; Galderisi, U.; Melone, M.A.B.; Saturnino, C.; Peluso, G. The Discovery of Highly Potent THP Derivatives as OCTN2 Inhibitors: From Structure-Based Virtual Screening to In Vivo Biological Activity. Int. J. Mol. Sci. 2020, 21, 7431. [Google Scholar] [CrossRef] [PubMed]





| Samples | Age (Years) | Gender | aDsg3 (ELISA Score) a | Clinical Phenotype of MPV | |
|---|---|---|---|---|---|
| Control group (CTL) | 1 | 45 | F | / | |
| 2 | 53 | F | / | ||
| 3 | 59 | M | / | ||
| 4 | 59 | M | / | ||
| 5 | 61 | M | / | ||
| Study group (MPV) | 6 | 59 | F | + | Oral lesion |
| 7 | 50 | M | ++ | Oral lesion | |
| 8 | 36 | F | + | Oral lesion | |
| 9 | 51 | F | ++ | Oral lesion | |
| 10 | 67 | M | ++ | Oral lesion |
| Gene | Accession Number | Forward (5′–3′) | Reverse (5′-3′) |
|---|---|---|---|
| MMP7 | NM_002423.5 | GGAGGCATGAGTGAGCTACA | TGCATCTCCTTGAGTTTGGC |
| E-Cadherin | NM_001317184.2 | GAGCTGGACAGGGAGGATTT | AGTGTCCCTGTTCCAGTAGC |
| TGF-β | NM_000660.7 | AAGATGGAGAGAGGACTGCG | AGAGGGAGAGAGAGGGAGTG |
| ACTIN | NM_001101.5 | ACTCTTCCAGCCTTCCTTCC | CGTACAGGTCTTTGCGGATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Valentino, A.; Leuci, S.; Galderisi, U.; Spagnuolo, G.; Mignogna, M.D.; Peluso, G.; Calarco, A. Plasma Exosomal microRNA Profile Reveals miRNA 148a-3p Downregulation in the Mucosal-Dominant Variant of Pemphigus Vulgaris. Int. J. Mol. Sci. 2023, 24, 11493. https://doi.org/10.3390/ijms241411493
Valentino A, Leuci S, Galderisi U, Spagnuolo G, Mignogna MD, Peluso G, Calarco A. Plasma Exosomal microRNA Profile Reveals miRNA 148a-3p Downregulation in the Mucosal-Dominant Variant of Pemphigus Vulgaris. International Journal of Molecular Sciences. 2023; 24(14):11493. https://doi.org/10.3390/ijms241411493
Chicago/Turabian StyleValentino, Anna, Stefania Leuci, Umberto Galderisi, Gianrico Spagnuolo, Michele Davide Mignogna, Gianfranco Peluso, and Anna Calarco. 2023. "Plasma Exosomal microRNA Profile Reveals miRNA 148a-3p Downregulation in the Mucosal-Dominant Variant of Pemphigus Vulgaris" International Journal of Molecular Sciences 24, no. 14: 11493. https://doi.org/10.3390/ijms241411493
APA StyleValentino, A., Leuci, S., Galderisi, U., Spagnuolo, G., Mignogna, M. D., Peluso, G., & Calarco, A. (2023). Plasma Exosomal microRNA Profile Reveals miRNA 148a-3p Downregulation in the Mucosal-Dominant Variant of Pemphigus Vulgaris. International Journal of Molecular Sciences, 24(14), 11493. https://doi.org/10.3390/ijms241411493

