The Lack of Synergy between Carvedilol and the Preventive Effect of Dexrazoxane in the Model of Chronic Anthracycline-Induced Cardiomyopathy
Abstract
:1. Introduction
2. Results
2.1. Echocardiography
2.2. Histological Staining
2.3. Biochemical Analyses
2.4. The Assessment of Gene Expression
2.5. Macroscopic Clinical Observations
3. Discussion
3.1. DOX Effects
3.2. Changes in the DOX + DEX + CVD vs. DOX + DEX Groups
4. Materials and Methods
4.1. Animals
4.2. Experimental Design
4.3. Echocardiography
4.4. Histological Staining
4.5. Biochemical Analysis
4.6. Molecular Studies (RT-PCR Analysis)
4.7. Macroscopic Clinical Observations
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AIDC | anthracycline-induced dilated cardiomyopathy |
| ANT | Anthracycline |
| BNP | brain natriuretic peptide |
| CHF | congestive heart failure |
| cTnI | cardiac troponin I |
| CTR | Control |
| CVD | Carvedilol |
| DEX | Dexrazoxane |
| DOX | Doxorubicin |
| ECHO | Echocardiogram |
| FA | fatty acid |
| FDA | Food and Drug Administration |
| ROS | reactive oxygen species |
| RQ | relative quantification |
| TOP2β | topoisomerase 2β |
References
- Minotti, G.; Menna, P.; Salvatorelli, E.; Cairo, G.; Gianni, L. Anthracyclines: Molecular Advances and Pharmacologic Developments in Antitumor Activity and Cardiotoxicity. Pharmacol. Rev. 2004, 56, 185–229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van Dalen, E.C.; Caron, H.N.; Dickinson, H.O.; Kremer, L.C. Cardioprotective Interventions for Cancer Patients Receiving Anthracyclines. Cochrane Database Syst. Rev. 2011, 2011, CD003917. [Google Scholar] [CrossRef] [PubMed]
- Deng, S.; Yan, T.; Jendrny, C.; Nemecek, A.; Vincetic, M.; Gödtel-Armbrust, U.; Wojnowski, L. Dexrazoxane May Prevent Doxorubicin-Induced DNA Damage via Depleting Both Topoisomerase II Isoforms. BMC Cancer 2014, 14, 842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jirkovský, E.; Jirkovská, A.; Bavlovič-Piskáčková, H.; Skalická, V.; Pokorná, Z.; Karabanovich, G.; Kollárová-Brázdová, P.; Kubeš, J.; Lenčová-Popelová, O.; Mazurová, Y.; et al. Clinically Translatable Prevention of Anthracycline Cardiotoxicity by Dexrazoxane Is Mediated by Topoisomerase II Beta and Not Metal Chelation. Circ. Heart Fail. 2021, 14, e008209. [Google Scholar] [CrossRef] [PubMed]
- Lebrecht, D.; Geist, A.; Ketelsen, U.-P.; Haberstroh, J.; Setzer, B.; Walker, U.A. Dexrazoxane Prevents Doxorubicin-Induced Long-Term Cardiotoxicity and Protects Myocardial Mitochondria from Genetic and Functional Lesions in Rats. Br. J. Pharmacol. 2007, 151, 771–778. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Shi, S.; Dai, Y. Research Progress of Therapeutic Drugs for Doxorubicin-Induced Cardiomyopathy. Biomed. Pharmacother. Biomed. Pharmacother. 2022, 156, 113903. [Google Scholar] [CrossRef]
- Curigliano, G.; Lenihan, D.; Fradley, M.; Ganatra, S.; Barac, A.; Blaes, A.; Herrmann, J.; Porter, C.; Lyon, A.R.; Lancellotti, P.; et al. Management of Cardiac Disease in Cancer Patients throughout Oncological Treatment: ESMO Consensus Recommendations. Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 2020, 31, 171–190. [Google Scholar] [CrossRef] [Green Version]
- Livi, L.; Barletta, G.; Martella, F.; Saieva, C.; Desideri, I.; Bacci, C.; Del Bene, M.R.; Airoldi, M.; Amoroso, D.; Coltelli, L.; et al. Cardioprotective Strategy for Patients With Nonmetastatic Breast Cancer Who Are Receiving an Anthracycline-Based Chemotherapy: A Randomized Clinical Trial. JAMA Oncol. 2021, 7, 1544–1549. [Google Scholar] [CrossRef]
- Ponikowski, P.; Voors, A.A.; Anker, S.D.; Bueno, H.; Cleland, J.G.F.; Coats, A.J.S.; Falk, V.; González-Juanatey, J.R.; Harjola, V.-P.; Jankowska, E.A.; et al. 2016 ESC Guidelines for the Diagnosis and Treatment of Acute and Chronic Heart Failure: The Task Force for the Diagnosis and Treatment of Acute and Chronic Heart Failure of the European Society of Cardiology (ESC)Developed with the Special Contribution of the Heart Failure Association (HFA) of the ESC. Eur. Heart J. 2016, 37, 2129–2200. [Google Scholar] [CrossRef] [Green Version]
- Štěrba, M.; Popelová, O.; Vávrová, A.; Jirkovský, E.; Kovaříková, P.; Geršl, V.; Šimůnek, T. Oxidative Stress, Redox Signaling, and Metal Chelation in Anthracycline Cardiotoxicity and Pharmacological Cardioprotection. Antioxid. Redox Signal. 2013, 18, 899–929. [Google Scholar] [CrossRef] [Green Version]
- Varga, Z.V.; Ferdinandy, P.; Liaudet, L.; Pacher, P. Drug-Induced Mitochondrial Dysfunction and Cardiotoxicity. Am. J. Physiol.–Heart Circ. Physiol. 2015, 309, H1453–H1467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carvalho, F.S.; Burgeiro, A.; Garcia, R.; Moreno, A.J.; Carvalho, R.A.; Oliveira, P.J. Doxorubicin-Induced Cardiotoxicity: From Bioenergetic Failure and Cell Death to Cardiomyopathy. Med. Res. Rev. 2014, 34, 106–135. [Google Scholar] [CrossRef] [PubMed]
- Wenningmann, N.; Knapp, M.; Ande, A.; Vaidya, T.R.; Ait-Oudhia, S. Insights into Doxorubicin-Induced Cardiotoxicity: Molecular Mechanisms, Preventive Strategies, and Early Monitoring. Mol. Pharmacol. 2019, 96, 219–232. [Google Scholar] [CrossRef]
- Gallegos-Castorena, S.; Martínez-Avalos, A.; Mohar-Betancourt, A.; Guerrero-Avendaño, G.; Zapata-Tarrés, M.; Medina-Sansón, A. Toxicity Prevention with Amifostine in Pediatric Osteosarcoma Patients Treated with Cisplatin and Doxorubicin. Pediatr. Hematol. Oncol. 2007, 24, 403–408. [Google Scholar] [CrossRef] [PubMed]
- Simůnek, T.; Stérba, M.; Popelová, O.; Adamcová, M.; Hrdina, R.; Gersl, V. Anthracycline-Induced Cardiotoxicity: Overview of Studies Examining the Roles of Oxidative Stress and Free Cellular Iron. Pharmacol. Rep. PR 2009, 61, 154–171. [Google Scholar] [CrossRef]
- Tokarska-Schlattner, M.; Wallimann, T.; Schlattner, U. Alterations in Myocardial Energy Metabolism Induced by the Anti-Cancer Drug Doxorubicin. C. R. Biol. 2006, 329, 657–668. [Google Scholar] [CrossRef]
- Tokarska-Schlattner, M.; Zaugg, M.; Zuppinger, C.; Wallimann, T.; Schlattner, U. New Insights into Doxorubicin-Induced Cardiotoxicity: The Critical Role of Cellular Energetics. J. Mol. Cell. Cardiol. 2006, 41, 389–405. [Google Scholar] [CrossRef]
- Rocca, C.; De Francesco, E.M.; Pasqua, T.; Granieri, M.C.; De Bartolo, A.; Gallo Cantafio, M.E.; Muoio, M.G.; Gentile, M.; Neri, A.; Angelone, T.; et al. Mitochondrial Determinants of Anti-Cancer Drug-Induced Cardiotoxicity. Biomedicines 2022, 10, 520. [Google Scholar] [CrossRef]
- Serrano, J.; Palmeira, C.M.; Kuehl, D.W.; Wallace, K.B. Cardioselective and Cumulative Oxidation of Mitochondrial DNA Following Subchronic Doxorubicin Administration. Biochim. Biophys. Acta 1999, 1411, 201–205. [Google Scholar] [CrossRef] [Green Version]
- Hasinoff, B.B.; Patel, D.; Wu, X. The Oral Iron Chelator ICL670A (Deferasirox) Does Not Protect Myocytes against Doxorubicin. Free Radic. Biol. Med. 2003, 35, 1469–1479. [Google Scholar] [CrossRef]
- Kalyanaraman, B. Teaching the Basics of the Mechanism of Doxorubicin-Induced Cardiotoxicity: Have We Been Barking up the Wrong Tree? Redox Biol. 2020, 29, 101394. [Google Scholar] [CrossRef]
- Vejpongsa, P.; Yeh, E.T.H. Prevention of Anthracycline-Induced Cardiotoxicity: Challenges and Opportunities. J. Am. Coll. Cardiol. 2014, 64, 938–945. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Liu, X.; Bawa-Khalfe, T.; Lu, L.-S.; Lyu, Y.L.; Liu, L.F.; Yeh, E.T.H. Identification of the Molecular Basis of Doxorubicin-Induced Cardiotoxicity. Nat. Med. 2012, 18, 1639–1642. [Google Scholar] [CrossRef]
- Nabati, M.; Janbabai, G.; Baghyari, S.; Esmaili, K.; Yazdani, J. Cardioprotective Effects of Carvedilol in Inhibiting Doxorubicin-Induced Cardiotoxicity. J. Cardiovasc. Pharmacol. 2017, 69, 279–285. [Google Scholar] [CrossRef]
- Tashakori Beheshti, A.; Mostafavi Toroghi, H.; Hosseini, G.; Zarifian, A.; Homaei Shandiz, F.; Fazlinezhad, A. Carvedilol Administration Can Prevent Doxorubicin-Induced Cardiotoxicity: A Double-Blind Randomized Trial. Cardiology 2016, 134, 47–53. [Google Scholar] [CrossRef]
- Avila, M.S.; Ayub-Ferreira, S.M.; de Barros Wanderley, M.R., Jr.; das Dores Cruz, F.; Gonçalves Brandão, S.M.; Rigaud, V.O.C.; Higuchi-Dos-Santos, M.H.; Hajjar, L.A.; Kalil, F.R.; Hoff, P.M.; et al. Carvedilol for Prevention of Chemotherapy-Related Cardiotoxicity. J. Am. Coll. Cardiol. 2018, 71, 2281–2290. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, P.J.; Gonçalves, L.; Monteiro, P.; Providencia, L.A.; Moreno, A.J. Are the Antioxidant Properties of Carvedilol Important for the Protection of Cardiac Mitochondria? Curr. Vasc. Pharmacol. 2005, 3, 147–158. [Google Scholar] [CrossRef] [PubMed]
- Aimo, A.; Castiglione, V.; Borrelli, C.; Saccaro, L.F.; Franzini, M.; Masi, S.; Emdin, M.; Giannoni, A. Oxidative Stress and Inflammation in the Evolution of Heart Failure: From Pathophysiology to Therapeutic Strategies. Eur. J. Prev. Cardiol. 2020, 27, 494–510. [Google Scholar] [CrossRef] [PubMed]
- Barteková, M.; Adameová, A.; Görbe, A.; Ferenczyová, K.; Pecháňová, O.; Lazou, A.; Dhalla, N.S.; Ferdinandy, P.; Giricz, Z. Natural and Synthetic Antioxidants Targeting Cardiac Oxidative Stress and Redox Signaling in Cardiometabolic Diseases. Free Radic. Biol. Med. 2021, 169, 446–477. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Kang, P.M. Oxidative Stress and Antioxidant Treatments in Cardiovascular Diseases. Antioxidants 2020, 9, 1292. [Google Scholar] [CrossRef] [PubMed]
- Mandziuk, S.; Gieroba, R.; Korga, A.; Matysiak, W.; Jodlowska-Jedrych, B.; Burdan, F.; Poleszak, E.; Kowalczyk, M.; Grzycka-Kowalczyk, L.; Korobowicz, E.; et al. The Differential Effects of Green Tea on Dose-Dependent Doxorubicin Toxicity. Food Nutr. Res. 2015, 59. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schwarz, E.R.; Pollick, C.; Dow, J.; Patterson, M.; Birnbaum, Y.; Kloner, R.A. A Small Animal Model of Non-Ischemic Cardiomyopathy and Its Evaluation by Transthoracic Echocardiography. Cardiovasc. Res. 1998, 39, 216–223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeong, S.W. Ascites. Korean J. Gastroenterol. Taehan Sohwagi Hakhoe Chi 2018, 72, 49–55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lopaschuk, G.D.; Ussher, J.R.; Folmes, C.D.L.; Jaswal, J.S.; Stanley, W.C. Myocardial Fatty Acid Metabolism in Health and Disease. Physiol. Rev. 2010, 90, 207–258. [Google Scholar] [CrossRef]
- Stanley, W.C.; Recchia, F.A.; Lopaschuk, G.D. Myocardial Substrate Metabolism in the Normal and Failing Heart. Physiol. Rev. 2005, 85, 1093–1129. [Google Scholar] [CrossRef] [Green Version]




| Morphological Feature | CTRI | CTRII | DOXI | DOXII | DOX + DEX + CVDI | DOX + DEX + CVDII | DOX + DEXI | DOX + DEXII | DOX + CVDI | DOX + CVDII |
|---|---|---|---|---|---|---|---|---|---|---|
| Mononuclear cell infiltration | − | − | + | ++ | + | ++ | − | − | + | ++ |
| Distribution of eosinophils | − | − | + | + | + | + | − | − | + | + |
| Collagen deposition | − | − | + | + | − | + | − | − | − | + |
| Parameter | Group | Mean Concentration ± SD (pg/mL) | p, vs. CTR | p, vs. DOX |
|---|---|---|---|---|
| cTnI | CTRI | 4.388 ± 1.034 | - | - |
| DOXI | 9.930 ± 3.517 | <0.0001 *** | - | |
| DOX + DEXI | 4.980 ± 1.223 | 0.9932 ns | <0.0001 ### | |
| DOX + CVDI | 8.356 ± 2.289 | 0.0005 *** | 0.5426 ns | |
| DOX + DEX + CVDI | 5.310 ± 1.298 | 0.9361 ns | <0.0001 ### | |
| CTRII | 4.530 ± 1.196 | - | - | |
| DOXII | 9.020 ± 1.749 | <0.0001 *** | - | |
| DOX + DEXII | 5.020 ± 1.440 | 0.9998 ns | <0.0001 ### | |
| DOX + CVDII | 8.133 ± 0.954 | 0.0025 ** | 0.9618 ns | |
| DOX + DEX + CVDII | 5.420 ± 1.767 | 0.9812; ns | 0.0009 ### | |
| BNP | CTRI | 144.229 ± 25.695 | - | - |
| DOXI | 279.011 ± 124.591 | 0.0487 * | - | |
| DOX + DEXI | 154.690 ± 43.376 | >0.9999 ns | 0.0272 # | |
| DOX + CVDI | 184.322 ± 53.796 | 0.9977 ns | 0.2209 ns | |
| DOX + DEX + CVDI | 151.240 ± 44.587 | <0.9999 ns | 0.0142 # | |
| CTRII | 165.133 ± 50.883 | - | - | |
| DOXII | 299.300 ± 63.607 | 0.0128 * | - | |
| DOX + DEXII | 224.413 ± 133.121 | 0.7707 ns | 0.6242 ns | |
| DOX + CVDII | 362.025 ± 283.230 | <0.0001 *** | 0.8196 ns | |
| DOX + DEX + CVDII | 283.230 ± 120.987 | 0.0443 * | >0.9999 ns |
| Group | CTR | DOX | DOX + DEX + CVD | DOX + DEX | DOX + CVD | |
|---|---|---|---|---|---|---|
| Gene | Time | Mean RQ ± SD | ||||
| Myc | I | 1.010 ± 0.145 | 0.620 ± 0.149 *** | 1.004 ± 0.172 ### | 0.878 ± 0.139 * ### | 0.918 ± 0.189 ### |
| II | 1.002 ± 0.077 | 1.012 ± 0.077 | 0.938 ± 0.100 # | 0.987 ± 0.112 | 0.992 ± 0.077 | |
| Slc2a1 | I | 1.006 ± 0.112 | 0.542 ± 0.106 *** | 0.659 ± 0.164 *** # | 0.462 ± 0.127 *** xxx | 0.612 ± 0.118 *** |
| II | 1.005 ± 0.155 | 0.577 ± 0.106 *** | 0.942 ± 0.147 ### | 0.972 ± 0.191 ### | 0.982 ± 0.191 ### | |
| Slc2a4 | I | 1.010 ± 0.147 | 1.016 ± 0.106 | 1.018 ± 0.122 | 1.937 ± 0.545 *** ### xxx | 1.545 ± 0.422 *** ### xxx |
| II | 1.006 ± 0.113 | 0.589 ± 0.203 *** | 0.689 ± 0.203 *** | 0.783 ± 0.203 *** ## | 1.056 ± 0.113 ### xxx | |
| G6pc1 | I | 1.016 ± 0.185 | 0.396 ± 0.149 *** | 0.724 ± 0.153 *** ### | 0.517 ± 0.171 *** xxx | 0.506 ± 0.126 *** xxx |
| II | 1.000 ± 0.180 | 0.356 ± 0.149 *** | 1.071 ± 0.221 ### | 0.657 ± 0.300 *** ### xxx | 0.900 ± 0.180 ### x | |
| Ldha | I | 1.012 ± 0.177 | 1.133 ± 0.156 | 1.085 ± 0.295 | 1.415 ± 0.265 *** ### xxx | 1.457 ± 0.207 *** ### xxx |
| II | 1.076 ± 0.123 | 0.976 ± 0.123 | 0.989 ± 0.106 | 1.095 ± 0.159 # | 1.149 ± 0.157 ### xxx | |
| Gls | I | 1.007 ± 0.130 | 0.560 ± 0.148 *** | 0.787 ± 0.195 *** ### | 0.978 ± 0.153 ### xxx | 1.034 ± 0.132 ### xxx |
| II | 1.001 ± 0.190 | 0.412 ± 0.148 *** | 1.680 ± 0.350 *** ### | 1.233 ± 0.322 * ### xxx | 1.034 ± 0.218 ### xxx | |
| Mpc1 | I | 1.012 ± 0.155 | 1.262 ± 0.183 | 1.353 ± 0.242 | 3.003 ± 1.232 *** ### xxx | 2.376 ± 0.753 *** ### xxx |
| II | 1.003 ± 0.144 | 1.402 ± 0.183 *** | 1.001 ± 0.113 ### | 1.019 ± 0.133 ### | 1.023 ± 0.144 ### | |
| Cpt2 | I | 1.021 ± 0.207 | 0.874 ± 0.175 | 1.101 ± 0.134 ### | 1.412 ± 0.202 *** ### xxx | 0.953 ± 0.211 |
| II | 1.000 ± 0.211 | 0.802 ± 0.207 * | 0.947 ± 0.329 | 0.963 ± 0.248 | 1.002 ± 0.207 # | |
| Got2 | I | 1.016 ± 0.184 | 1.344 ± 0.206 | 1.819 ± 0.587 * | 3.791 ± 1.821 *** ### xxx | 2.911 ± 0.981 *** ### xx |
| II | 1.001 ± 0.161 | 1.444 ± 0.206 *** | 0.991 ± 0.163 ### | 0.993 ± 0.119 ### | 1.013 ± 0.119 ### | |
| Cd36 | I | 1.011 ± 0.093 | 0.967 ± 0.124 | 0.947 ± 0.119 | 1.056 ± 0.135 x | 0.963 ± 0.112 |
| II | 1.005 ± 0.119 | 1.105 ± 0.119 | 0.974 ± 0.129 # | 1.101 ± 0.155 x | 1.201 ± 0.155 *** xxx | |
| Slc27a1 | I | 1.051 ± 0.347 | 1.795 ± 0.580 *** | 1.223 ± 0.167 ### | 1.563 ± 0.554 *** x | 0.786 ± 0.214 ### xx |
| II | 1.008 ± 0.088 | 1.559 ± 0.081 *** | 0.859 ± 0.081 *** ### | 0.845 ± 0.189 *** ### | 1.108 ± 0.088 * ### xxx | |
| Ppargc1a | I | 1.012 ± 0.161 | 1.277 ± 0.213 * | 1.120 ± 0.199 | 1.456 ± 0.246 *** xx | 1.022 ± 0.534 # |
| II | 1.000 ± 0.250 | 0.404 ± 0.161 *** | 0.869 ± 0.161 ### | 0.893 ± 0.236 ### | 0.843 ± 0.236 ### | |
| Prkaa2 | I | 1.011 ± 0.156 | 0.704 ± 0.177 ** | 1.401 ± 0.325 *** ### | 1.870 ± 0.428 *** ### xxx | 1.677 ± 0.365 *** ### x |
| II | 1.003 ± 0.095 | 1.053 ± 0.095 | 0.921 ± 0.091 ### | 1.031 ± 0.123 xx | 1.081 ± 0.123 xxx | |
| Acadm | I | 1.035 ± 0.184 | 4.833 ± 1.919 *** | 10.016 ± 3.854 *** ### | 42.179 ± 26.038 *** ### xxx | 29.549 ± 12.296 *** ### xxx |
| II | 1.004 ± 0.151 | 4.493 ± 1.919 *** | 0.673 ± 0.100 *** ### | 1.038 ± 0.123 ### | 1.104 ± 0.151 ### | |
| Group | Clinical Symptoms | ||
|---|---|---|---|
| Presence of Ascites | Enlarged Liver | Mortality | |
| CTRI | − | − | − |
| CTRII | − | − | − |
| DOXI | ++ | + | − |
| DOXII | +++ | − | ++ |
| DOX + DEX + CVDI | − | − | − |
| DOX + DEX + CVDII | − | − | − |
| DOX + DEXI | − | − | − |
| DOX + DEXII | − | − | − |
| DOX + CVDI | ++ | + | − |
| DOX + CVDII | +++ | − | ++ |
| Symbol of Group | Type of Group | Administration | Euthanasia |
|---|---|---|---|
| CTRI | Control (n = 10) | 0.01 mL 0.9% NaCl per g body weight i.p. administration once a week for 10 weeks | 11th week |
| DOXI | Experimental (n = 10) | 1.6 mg DOX per kg of body weight i.p. administration once a week for 10 weeks | 11th week |
| DOX + DEX + CVDI | Experimental (n = 10) | 1 mg CVD per kg of body weight i.p. administration 30 min prior DOX; 25 mg DEX per kg of body weight i.p. administration 30 min prior DOX; 1.6 mg DOX per kg of body weight i.p. administration once a week for 10 weeks | 11th week |
| DOX + DEXI | Experimental (n = 10) | 1.6 mg DOX per kg of body weight i.p. administration once a week for 10 weeks; 25 mg DEX per kg of body weight i.p. administration 30 min prior DOX | 11th week |
| DOX + CVDI | Experimental (n = 10) | 1.6 mg DOX per kg of body weight i.p. administration once a week for 10 weeks; 1 mg CVD per kg of body weight i.p. administration 30 min prior DOX | 11th week |
| CTRII | Control (n = 10) | 0.01 mL 0.9% NaCl per g body weight i.p. administration once a week for 10 weeks | 21st week |
| DOXII | Experimental (n = 10) | 1.6 mg DOX per kg of body weight i.p. administration once a week for 10 weeks | 21st week |
| DOX + DEX + CVDII | Experimental (n = 10) | 1 mg CVD per kg of body weight i.p. administration 30 min prior DOX; 25 mg DEX per kg of body weight i.p. administration 30 min prior DOX; 1.6 mg DOX per kg of body weight i.p. administration once a week for 10 weeks | 21st week |
| DOX + DEXII | Experimental (n = 10) | 1.6 mg DOX per kg of body weight i.p. administration once a week for 10 weeks; 25 mg DEX per kg of body weight i.p. administration 30 min prior DOX | 21st week |
| DOX + CVDII | Experimental (n = 10) | 1.6 mg DOX per kg of body weight i.p. administration once a week for 10 weeks; 1 mg CVD per kg of body weight i.p. administration 30 min prior DOX | 21st week |
| Gene Name | Gene Symbol | Primer Sequence (5′ → 3′) | Product Size (bp) | NCBI Reference Sequence | |
|---|---|---|---|---|---|
| Left | Right | ||||
| Solute Carrier Family 2 Member 1 | Slc2a1 | GCC TGA GAC CAG TTG AAA GC | GAG TGT CCG TGT CTT CAG CA | 154 | NM_138827.1 |
| Solute Carrier Family 2 Member 4 | Slc2a4 | GCTTCTGTTGCCCTTCTGTC | TGGACGCTCTCTTTCCAACT | 166 | NM_012751.1 |
| Glucose-6-Phosphatase Catalytic Subunit 1 | G6pc1 | ACCCTGGTAGCCCTGTCTTT | GGGCTTTCTCTTCTGTGTCG | 150 | NM_013098.2 |
| Lactate Dehydrogenase A | Ldha | GGT GGT TGA CAG TGC ATA CG | AGG ATA CAT GGG ACG CTG AG | 186 | NM_017025.1 |
| MYC Proto-Oncogene, BHLH Transcription Factor | Myc | CGA GCT GAA GCG TAG CTT TT | CTC GCC GTT TCC TCA GTA AG | 170 | NM_012603.2 |
| Glutaminase | Gls | CACACACACGGATTTCTTGG | GCCGAAGCTGACTTTGAAAC | 194 | NM_012569.2 |
| Mitochondrial Pyruvate Carrier 1 | Mpc1 | ACTTTCGCCCTCTGTTGCTA | GCACTGTCCCTTTCAAGAGC | 199 | NM_133561.1 |
| Carnitine Palmitoyltransferase 2 | Cpt2 | TCC TCG ATC AAG ATG GGA AC | GAT CCT TCA TCG GGA AGT CA | 237 | NM_012930.1 |
| Glutamic-Oxaloacetic Transaminase 2 | Got2 | ACC ATC CAC TGC CGT CTT AC | TCT TGA AGG CTT CGG TCA CT | 185 | NM_013177.2 |
| Peroxisome Proliferator Activated Receptor Alpha | Ppara | TCA CAC AAT GCA ATC CGT TT | GGC CTT GAC CTT GTT CAT GT | 177 | NM_013196.1 |
| CD36 Molecule | Cd36 | GCAACAACAAGGCCAGGTAT | AAGAGCTAGGCAGCATGGAA | 155 | NM_031561.2 |
| Solute Carrier Family 27 Member 1 | Slc27a1 | CCTCACATCACAGCAGGAGA | GCTCTGTCCACACCCTTCAT | 238 | NM_053580.2 |
| PPARG Coactivator 1 Alpha | Ppargc1a | ATGTGTCGCCTTCTTGCTCT | ATCTACTGCCTGGGGACCTT | 180 | NM_031347.1 |
| Protein Kinase AMP-Activated Catalytic Subunit Alpha 2 | Prkaa2 | AGCTCGCAGTGGCTTATCAT | GGGGCTGTCTGCTATGAGAG | 179 | NM_023991.1 |
| Acyl-CoA Dehydrogenase Medium Chain | Acadm | CAA GAG AGC CTG GGA ACT TG | CCC CAA AGA ATT TGC TTC AA | 154 | NM_016986.2 |
| Ribosomal Protein L32 | Rpl32 | AGA TTC AAG GGC CAG ATC CT | CGA TGG CTT TTC GGT TCT TA | 193 | NM_013226 |
| TATA Box Binding Protein | Tbp | CCT CTG AGA GCT CTG GGA TTG TA | GCC AAG ATT CAC GGT GGA TAC A | 62 | NM_001004198.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szponar, J.; Ciechanski, E.; Ostrowska-Lesko, M.; Gorska, A.; Tchorz, M.; Dabrowska, A.; Dudka, J.; Murias, M.; Kowalczyk, M.; Korga-Plewko, A.; et al. The Lack of Synergy between Carvedilol and the Preventive Effect of Dexrazoxane in the Model of Chronic Anthracycline-Induced Cardiomyopathy. Int. J. Mol. Sci. 2023, 24, 10202. https://doi.org/10.3390/ijms241210202
Szponar J, Ciechanski E, Ostrowska-Lesko M, Gorska A, Tchorz M, Dabrowska A, Dudka J, Murias M, Kowalczyk M, Korga-Plewko A, et al. The Lack of Synergy between Carvedilol and the Preventive Effect of Dexrazoxane in the Model of Chronic Anthracycline-Induced Cardiomyopathy. International Journal of Molecular Sciences. 2023; 24(12):10202. https://doi.org/10.3390/ijms241210202
Chicago/Turabian StyleSzponar, Jaroslaw, Erwin Ciechanski, Marta Ostrowska-Lesko, Agnieszka Gorska, Michal Tchorz, Anna Dabrowska, Jaroslaw Dudka, Marek Murias, Michał Kowalczyk, Agnieszka Korga-Plewko, and et al. 2023. "The Lack of Synergy between Carvedilol and the Preventive Effect of Dexrazoxane in the Model of Chronic Anthracycline-Induced Cardiomyopathy" International Journal of Molecular Sciences 24, no. 12: 10202. https://doi.org/10.3390/ijms241210202
APA StyleSzponar, J., Ciechanski, E., Ostrowska-Lesko, M., Gorska, A., Tchorz, M., Dabrowska, A., Dudka, J., Murias, M., Kowalczyk, M., Korga-Plewko, A., & Mandziuk, S. (2023). The Lack of Synergy between Carvedilol and the Preventive Effect of Dexrazoxane in the Model of Chronic Anthracycline-Induced Cardiomyopathy. International Journal of Molecular Sciences, 24(12), 10202. https://doi.org/10.3390/ijms241210202

