Determination of Common microRNA Biomarker Candidates in Stage IV Melanoma Patients and a Human Melanoma Cell Line: A Potential Anti-Melanoma Agent Screening Model
Abstract
1. Introduction
2. Results
2.1. Determine of microRNA Biomarker Candidates
2.2. Pilot Study Results
2.3. Potential Anti-Melanoma Agent Screening Model Based on Human Melanoma Cell Line
2.4. Cytotoxicity Assay in MTT Test
3. Discussion
4. Materials and Methods
4.1. Study Design
4.2. Content Analysis of the Scientific Literature
4.3. Patient Characteristics and Blood Collection
4.4. Blood Sample Preparation
4.5. Isolation of microRNA Samples and qRT-PCR Analysis
4.6. Cell Lines and Cell Culture
4.7. Obtaining Fractions of Humic Substances and Chitosan
4.8. Incubation with Candidate Preparations of Humic Substances and Chitosan
4.9. Cytotoxicity Assay in MTT Test
4.10. Calculation of Results and Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Erdei, E.; Torres, S.M. A new understanding in the epidemiology of melanoma. Expert Rev. Anticancer. Ther. 2010, 10, 1811–1823. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schadendorf, D.; van Akkooi, A.C.J.; Berking, C.; Griewank, K.G.; Gutzmer, R.; Hauschild, A.; Stang, A.; Roesch, A.; Ugurel, S. Melanoma. Lancet 2018, 392, 971–984. [Google Scholar] [CrossRef] [Scilit]
- Rigel, D.S.; Carucci, J.A. Malignant melanoma: Prevention, early detection, and treatment in the 21st century. CA A Cancer J. Clin. 2000, 50, 215–236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer Statistics, 2017. CA Cancer J. Clin. 2017, 67, 7–30. [Google Scholar] [CrossRef] [Scilit]
- Crocetti, E.; Mallone, S.; Robsahm, T.E.; Gavin, A.; Agius, D.; Ardanaz, E.; Lopez, M.-D.C.; Innos, K.; Minicozzi, P.; Borgognoni, L.; et al. Survival of patients with skin melanoma in Europe increases further: Results of the EUROCARE-5 study. Eur. J. Cancer 2015, 51, 2179–2190. [Google Scholar] [CrossRef] [Scilit]
- Houghton, A.N.; Polsky, D. Focus on melanoma. Cancer Cell 2002, 2, 275–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Sheikh, M.S. Melanoma: Molecular Pathogenesis and Therapeutic Management. Mol. Cell. Pharmacol. 2014, 6, 228. [Google Scholar] [PubMed]
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef] [Scilit]
- Gellrich, F.F.; Schmitz, M.; Beissert, S.; Meier, F. Anti-PD-1 and Novel Combinations in the Treatment of Melanoma—An Update. J. Clin. Med. 2020, 9, 223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calin, G.A.; Dumitru, C.D.; Shimizu, M.; Bichi, R.; Zupo, S.; Noch, E.; Aldler, H.; Rattan, S.; Keating, M.; Rai, K.; et al. Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. USA 2002, 99, 15524–15529. [Google Scholar] [CrossRef] [Scilit]
- Cheng, L.; Lopez-Beltran, A.; Massari, F.; MacLennan, G.T.; Montironi, R. Molecular testing for BRAF mutations to inform melanoma treatment decisions: A move toward precision medicine. Mod. Pathol. 2018, 31, 24–38. [Google Scholar] [CrossRef] [Scilit]
- Sidorova, E.A.; Zhernov, Y.V.; Antsupova, M.A.; Khadzhieva, K.R.; Izmailova, A.A.; Kraskevich, D.A.; Belova, E.V.; Simanovsky, A.A.; Shcherbakov, D.V.; Zabroda, N.N.; et al. The Role of Different Types of microRNA in the Pathogenesis of Breast and Prostate Cancer. Int. J. Mol. Sci. 2023, 24, 1980. [Google Scholar] [CrossRef] [Scilit]
- Mitchell, P.S.; Parkin, R.K.; Kroh, E.M.; Fritz, B.R.; Wyman, S.K.; Pogosova-Agadjanyan, E.L.; Peterson, A.; Noteboom, J.; O’Briant, K.C.; Allen, A.; et al. Circulating microRNAs as stable blood-based markers for cancer detection. Proc. Natl. Acad. Sci. USA 2008, 105, 10513–10518. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Ba, Y.; Ma, L.; Cai, X.; Yin, Y.; Wang, K.; Guo, J.; Zhang, Y.; Chen, J.; Guo, X.; et al. Characterization of microRNAs in serum: A novel class of biomarkers for diagnosis of cancer and other diseases. Cell. Res. 2008, 18, 997–1006. [Google Scholar] [CrossRef] [Scilit]
- Bradish, J.R.; Cheng, L. Molecular pathology of malignant melanoma: Changing the clinical practice paradigm toward a personalized approach. Hum. Pathol. 2014, 45, 1315–1326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Felicetti, F.; Errico, M.C.; Bottero, L.; Segnalini, P.; Stoppacciaro, A.; Biffoni, M.; Felli, N.; Mattia, G.; Petrini, M.; Colombo, M.P.; et al. The Promyelocytic Leukemia Zinc Finger–MicroRNA-221/-222 Pathway Controls Melanoma Progression through Multiple Oncogenic Mechanisms. Cancer Res. 2008, 68, 2745–2754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanemaru, H.; Fukushima, S.; Yamashita, J.; Honda, N.; Oyama, R.; Kakimoto, A.; Masuguchi, S.; Ishihara, T.; Inoue, Y.; Jinnin, M.; et al. The circulating microRNA-221 level in patients with malignant melanoma as a new tumor marker. J. Dermatol. Sci. 2011, 61, 187–193. [Google Scholar] [CrossRef] [Scilit]
- Qian, L.-Y.; Li, P.; He, Q.-Y.; Luo, C.-Q. Circulating miR-221 Expression Level and Prognosis of Cutaneous Malignant Melanoma. Experiment 2014, 20, 2472–2477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flaherty, K.T.; Infante, J.R.; Daud, A.; Gonzalez, R.; Kefford, R.F.; Sosman, J.; Hamid, O.; Schuchter, L.; Cebon, J.; Ibrahim, N.; et al. Combined BRAF and MEK Inhibition in Melanoma with BRAF V600 Mutations. N. Engl. J. Med. 2012, 367, 1694–1703. [Google Scholar] [CrossRef] [Scilit]
- Varrone, F.; Caputo, E. The miRNAs Role in Melanoma and in Its Resistance to Therapy. Int. J. Mol. Sci. 2020, 21, 878. [Google Scholar] [CrossRef] [Scilit]
- Li, L.N.; Zhang, H.D.; Zhi, R.; Uuan, S.J. Down-regulation of some miRNAs by degradaing their precorses contributes to anti-cancer effect of mistletoe lectin-I. Br. J. Pharmacok. 2011, 162, 349–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Váraljai, R.; Elouali, S.; Lueong, S.; Wistuba-Hamprecht, K.; Seremet, T.; Siveke, J.; Becker, J.; Sucker, A.; Paschen, A.; Horn, P.; et al. The predictive and prognostic significance of cell-free DNA concentration in melanoma. J. Eur. Acad. Dermatol. Venereol. 2021, 35, 387–395. [Google Scholar] [CrossRef] [Scilit]
- Margue, C.; Reinsbach, S.; Philippidou, D.; Beaume, N.; Walters, C.; Schneider, J.G.; Nashan, D.; Behrmann, I.; Kreis, S. Comparison of a healthy miRNome with melanoma patient miRNomes: Are microRNAs suitable serum biomarkers for cancer? Oncotarget 2015, 6, 12110–12127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mumford, S.L.; Towler, B.P.; Pashler, A.L.; Gilleard, O.; Martin, Y.; Newbury, S.F. Circulating MicroRNA Biomarkers in Melanoma: Tools and Challenges in Personalised Medicine. Biomolecules 2018, 8, 21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stark, M.S.; Klein, K.; Weide, B.; Haydu, L.E.; Pflugfelder, A.; Tang, Y.H.; Palmer, J.M.; Whiteman, D.C.; Scolyer, R.A.; Mann, G.J.; et al. The Prognostic and Predictive Value of Melanoma-related MicroRNAs Using Tissue and Serum: A MicroRNA Expression Analysis. Ebiomedicine 2015, 2, 671–680. [Google Scholar] [CrossRef] [Scilit]
- Achberger, S.; Aldrich, W.; Tubbs, R.; Crabb, J.W.; Singh, A.D.; Triozzi, P.L. Circulating immune cell and microRNA in patients with uveal melanoma developing metastatic disease. Mol. Immunol. 2014, 58, 182–186. [Google Scholar] [CrossRef] [Scilit]
- Friedman, E.B.; Shang, S.; de Miera, E.V.-S.; Fog, J.U.; Teilum, M.W.; Ma, M.W.; Berman, R.S.; Shapiro, R.L.; Pavlick, A.C.; Hernando, E.; et al. Serum microRNAs as biomarkers for recurrence in melanoma. J. Transl. Med. 2012, 10, 155. [Google Scholar] [CrossRef] [Scilit]
- Tian, R.; Liu, T.; Qiao, L.; Gao, M.; Li, J. Decreased serum microRNA-206 level predicts unfavorable prognosis in patients with melanoma. Int. J. Clin. Exp. Pathol. 2015, 8, 3097–3103. [Google Scholar]
- Greenberg, E.; Besser, M.J.; Ben-Ami, E.; Shapira-Frommer, R.; Itzhaki, O.; Zikich, D.; Levy, D.; Kubi, A.; Eyal, E.; Onn, A.; et al. A comparative analysis of total serum miRNA profiles identifies novel signature that is highly indicative of metastatic melanoma: A pilot study. Biomarkers 2013, 18, 502–508. [Google Scholar] [CrossRef] [Scilit]
- Aksenenko, M.; Palkina, N.; Komina, A.; Tashireva, L.; Ruksha, T. Differences in microRNA expression between melanoma and healthy adjacent skin. BMC Dermatol. 2019, 19, 1. [Google Scholar] [CrossRef] [Scilit]
- Leidinger, P.; Keller, A.; Borries, A.; Reichrath, J.; Rass, K.; Jager, S.U.; Lenhof, H.-P.; Meese, E. High-throughput miRNA profiling of human melanoma blood samples. BMC Cancer 2010, 10, 262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Torres, R.; Lang, U.E.; Hejna, M.; Shelton, S.J.; Joseph, N.M.; Shain, A.H.; Yeh, I.; Wei, M.L.; Oldham, M.C.; Bastian, B.C.; et al. MicroRNA Ratios Distinguish Melanomas from Nevi. J. Investig. Dermatol. 2020, 140, 164–173.e7. [Google Scholar] [CrossRef] [Scilit]
- Saldanha, G.; Potter, L.; Shendge, P.; Osborne, J.; Nicholson, S.; Yii, N.; Varma, S.; Aslam, M.I.; Elshaw, S.; Papadogeorgakis, E.; et al. Plasma MicroRNA-21 Is Associated with Tumor Burden in Cutaneous Melanoma. J. Investig. Dermatol. 2013, 133, 1381–1384. [Google Scholar] [CrossRef] [Scilit]
- Tan, G.W.; Khoo, A.S.B.; Tan, L.P. Evaluation of extraction kits and RT-qPCR systems adapted to high-throughput platform for circulating miRNAs. Sci. Rep. 2015, 5, 9430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Laar, R.; Lincoln, M.; Van Laar, B. Development and validation of a plasma-based melanoma biomarker suitable for clinical use. Br. J. Cancer 2018, 118, 857–866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fogli, S.; Polini, B.; Carpi, S.; Pardini, B.; Naccarati, A.; Dubbini, N.; Lanza, M.; Breschi, M.C.; Romanini, A.; Nieri, P. Identification of plasma microRNAs as new potential biomarkers with high diagnostic power in human cutaneous melanoma. Tumor Biol. 2017, 39, 1010428317701646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Zhao, R.; Fang, R.; Wang, J. miR-122-5p inhibits the proliferation of melanoma cells by targeting NOP14. Nan Fang Yi Ke Da Xue Xue Bao = J. South. Med. Univ. 2018, 38, 1360–1365. [Google Scholar]
- Alegre, E.; Sanmamed, M.F.; Rodriguez, C.; Carranza, O.; Martín-Algarra, S.; González, A. Study of Circulating MicroRNA-125b Levels in Serum Exosomes in Advanced Melanoma. Arch. Pathol. Lab. Med. 2014, 138, 828–832. [Google Scholar] [CrossRef] [Scilit]
- Fleming, N.H.; Zhong, J.; da Silva, I.P.; de Miera, E.V.-S.; Brady, B.; Han, S.W.; Hanniford, D.; Wang, J.; Shapiro, R.L.; Hernando, E.; et al. Serum-based miRNAs in the prediction and detection of recurrence in melanoma patients. Cancer 2015, 121, 51–59. [Google Scholar] [CrossRef] [Scilit]
- Farazi, T.A.; Hoell, J.I.; Morozov, P.; Tuschl, T. MicroRNAs in human cancer. Adv. Exp. Med. Biol. 2013, 774, 1–20. [Google Scholar] [CrossRef] [Scilit]
- Polini, B.; Carpi, S.; Doccini, S.; Citi, V.; Martelli, A.; Feola, S.; Santorelli, F.M.; Cerullo, V.; Romanini, A.; Nieri, P. Tumor Suppressor Role of hsa-miR-193a-3p and -5p in Cutaneous Melanoma. Int. J. Mol. Sci. 2020, 21, 6183. [Google Scholar] [CrossRef] [Scilit]
- Yong, F.L.; Law, C.W.; Wang, C.W. Potentiality of a triple microRNA classifier: miR-193a-3p, miR-23a and miR-338-5p for early detection of colorectal cancer. BMC Cancer 2013, 13, 280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, T.; Chong, Y.; Cai, B.; Liu, Y.; Lu, S.; Cowell, J.K. DNA methyltransferase 1–mediated CpG methylation of the miR-150-5p promoter contributes to fibroblast growth factor receptor 1–driven leukemogenesis. J. Biol. Chem. 2019, 294, 18122–18130. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.-C.; Kuo, M.-W.; Yu, J.; Kuo, H.-H.; Lin, R.-J.; Lo, W.-L.; Yu, A. c-Myb Is an Evolutionary Conserved miR-150 Target and miR-150/c-Myb Interaction Is Important for Embryonic Development. Mol. Biol. Evol. 2008, 25, 2189–2198. [Google Scholar] [CrossRef] [Scilit]
- Leone, E.; Morelli, E.; Di Martino, M.T.; Amodio, N.; Foresta, U.; Gullà, A.; Rossi, M.; Neri, A.; Giordano, A.; Munshi, N.C.; et al. Targeting miR-21 Inhibits In Vitro and In Vivo Multiple Myeloma Cell Growth. Clin. Cancer Res. 2013, 19, 2096–2106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bovell, L.C.; Shanmugam, C.; Putcha, B.-D.K.; Katkoori, V.R.; Zhang, B.; Bae, S.; Singh, K.P.; Grizzle, W.E.; Manne, U. The Prognostic Value of MicroRNAs Varies with Patient Race/Ethnicity and Stage of Colorectal Cancer. Clin. Cancer Res. 2013, 19, 3955–3965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- del Campo, S.E.M.; Latchana, N.; Levine, K.M.; Grignol, V.P.; Fairchild, E.T.; Jaime-Ramirez, A.C.; Dao, T.-V.; Karpa, V.I.; Carson, M.; Ganju, A.; et al. MiR-21 Enhances Melanoma Invasiveness via Inhibition of Tissue Inhibitor of Metalloproteinases 3 Expression: In Vivo Effects of MiR-21 Inhibitor. PLoS ONE 2015, 10, e0115919. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.-F.; Wu, Z.-P.; Chen, Y.; Zhu, Q.-S.; Hamidi, S.; Navab, R. MicroRNA-21 (miR-21) Regulates Cellular Proliferation, Invasion, Migration, and Apoptosis by Targeting PTEN, RECK and Bcl-2 in Lung Squamous Carcinoma, Gejiu City, China. PLoS ONE 2014, 9, e103698. [Google Scholar] [CrossRef] [Scilit]
- Babu, A.; Ramesh, R. Multifaceted Applications of Chitosan in Cancer Drug Delivery and Therapy. Mar Drugs 2017, 15, 96. [Google Scholar] [CrossRef] [Scilit]
- Vznuzdaeva, O.A.; Zverev, G.A.; Molodtsov, I.V. Effect of chitosan on IgM and IgG antibody-producing cells in mice. Immunologiya 1984, 1, 53–55. (In Russian) [Google Scholar]
- Azuma, K.; Osaki, T.; Minami, S.; Okamoto, Y. Anticancer and Anti-Inflammatory Properties of Chitin and Chitosan Oligosaccharides. J. Funct. Biomater. 2015, 6, 33–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, R.; Mendis, E.; Rajapakse, N.; Kim, S.-K. Strong electronic charge as an important factor for anticancer activity of chitooligosaccharides (COS). Life Sci. 2006, 78, 2399–2408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, W.; Jiang, C.; Kong, X.; Liang, Y.; Rong, M.; Liu, W. Chitooligosaccharides and N-acetyl-D-glucosamine stimulate peripheral blood mononuclear cell-mediated antitumor immune responses. Mol. Med. Rep. 2012, 6, 385–390. [Google Scholar] [CrossRef] [Scilit]
- Zou, P.; Yang, X.; Zhang, Y.; Du, P.; Yuan, S.; Yang, D.; Wang, J. Antitumor Effects of Orally and Intraperitoneally Administered Chitosan Oligosaccharides (COSs) on S180-Bearing/Residual Mouse. J. Food Sci. 2016, 81, H3035–H3042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Srinivasan, H.; Kanayairam, V.; Ravichandran, R. Chitin and chitosan preparation from shrimp shells Penaeus monodon and its human ovarian cancer cell line, PA-1. Int. J. Biol. Macromol. 2018, 107, 662–667. [Google Scholar] [CrossRef] [Scilit]
- Julious, S.A. Sample size of 12 per group rule of thumb for a pilot study. Pharm. Stat. 2005, 4, 287–291. [Google Scholar] [CrossRef] [Scilit]
- Mikhaĭlova, I.N.; Lukashina, M.I.; Baryshnikov AIu Morozova, L.F.; Burova, O.S.; Palkina, T.N.; Kozlov, A.M.; Golubeva, V.A.; Cheremushkin, E.A.; Doroshenko, M.B.; Georgiev, G.P.; et al. Melanoma cell lines as the basis for antitumor vaccine preparation. Vestn. Ross. Akad. Meditsinskikh Nauk. 2005, 7, 37–40. [Google Scholar]
- Dobosz, P.; Dzieciątkowski, T. The Intriguing History of Cancer Immunotherapy. Front. Immunol. 2019, 10, 2965. [Google Scholar] [CrossRef] [Scilit]
- Troy, E.; Tilbury, M.A.; Power, A.M.; Wall, J.G. Nature-Based Biomaterials and Their Application in Biomedicine. Polymers 2021, 13, 3321. [Google Scholar] [CrossRef] [Scilit]
- Habtemariam, S. Trametes versicolor (Synn. Coriolus versicolor) Polysaccharides in Cancer Therapy: Targets and Efficacy. Biomedicines 2020, 8, 135. [Google Scholar] [CrossRef] [Scilit]
- Harhaji, L.; Mijatović, S.; Maksimović-Ivanić, D.; Stojanović, I.; Momčilović, M.; Maksimović, V.; Tufegdžić, S.; Marjanović, Ž.; Mostarica-Stojković, M.; Vučinić, Ž.; et al. Anti-tumor effect of Coriolus versicolor methanol extract against mouse B16 melanoma cells: In vitro and in vivo study. Food Chem. Toxicol. 2008, 46, 1825–1833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stevenson, F.J. Humus Chemistry: Genesis, Composition, Reactions; John Wiley & Sons: Hoboken, NJ, USA, 1994. [Google Scholar]
- Directory of Medicines. Available online: http://www.rlsnet.ru/mnn_index_id_2851.htm (accessed on 21 March 2023).
- Zhernov, Y.V.; Kremb, S.; Helfer, M.; Schindler, M.; Harir, M.; Mueller, C.; Hertkorn, N.; Avvakumova, N.P.; Konstantinov, A.I.; Brack-Werner, R.; et al. Supramolecular combinations of humic polyanions as potent microbicides with polymodal anti-HIV-activities. New. J. Chem. 2016, 41, 212–224. [Google Scholar] [CrossRef] [Scilit]
- Badun, G.A.; Chernysheva, M.G.; Zhernov, Y.V.; Poroshina, A.S.; Smirnov, V.V.; Pigarev, S.E.; Mikhnevich, T.A.; Volkov, D.S.; Perminova, I.V.; Fedoros, E.I. A Use of Tritium-Labeled Peat Fulvic Acids and Polyphenolic Derivatives for Designing Pharmacokinetic Experiments on Mice. Biomedicines 2021, 9, 1787. [Google Scholar] [CrossRef] [Scilit]
- Fedoros, E.I.; Orlov, A.A.; Zherebker, A.; Gubareva, E.A.; Maydin, M.A.; Konstantinov, A.I.; Krasnov, K.A.; Karapetian, R.N.; Izotova, E.I.; Pigarev, S.E.; et al. Novel water-soluble lignin derivative BP-Cx-1: Identification of components and screening of potential targets in silico and in vitro. Oncotarget 2018, 9, 18578–18593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhernov, Y.V.; Konstantinov, A.I.; Zherebker, A.; Nikolaev, E.; Orlov, A.; Savinykh, M.I.; Kornilaeva, G.V.; Karamov, E.V.; Perminova, I.V. Antiviral activity of natural humic substances and shilajit materials against HIV-1: Relation to structure. Environ. Res. 2021, 193, 110312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Avvakumova, N.; Kamilov, F.; Zhdanova, A.; Men’shikova, I.; Zhernov, Y.; Krivopalova, M.; Glubokova, M.; Katunina, E. The influence of humus acids of peloids and its components on free radical processes. Biomeditsinskaya Khimiya 2018, 64, 429–432. [Google Scholar] [CrossRef] [Scilit]
- Orlov, A.A.; Zherebker, A.; Eletskaya, A.A.; Chernikov, V.S.; Kozlovskaya, L.I.; Zhernov, Y.V.; Kostyukevich, Y.; Palyulin, V.A.; Nikolaev, E.N.; Osolodkin, D.I.; et al. Examination of molecular space and feasible structures of bioactive components of humic substances by FTICR MS data mining in ChEMBL database. Sci. Rep. 2019, 9, 12066. [Google Scholar] [CrossRef] [Scilit]
- Botes, M.E.; Dekker, J.; van Rensburg, C.E.J. Phase I Trial with Oral Oxihumate in HIV-Infected Patients. Drug Dev. Res. 2002, 57, 34–39. [Google Scholar] [CrossRef] [Scilit]
- Jooné, G.K.; Dekker, J.; van Rensburg, C.E.J. Investigation of the Immunostimulatory Properties of Oxihumate. Z. Naturforsch. C 2003, 58, 263–267. [Google Scholar] [CrossRef] [Scilit]
- Sanmiguel, P.R.; Rondón, B.I. Supplementation with humic substances affects the innate immunity in layer hens in posfasting phase. Rev. MVZ Córdoba 2016, 21, 5198–5210. [Google Scholar] [CrossRef] [Scilit]
- Vasnev, V.A.; Tarasov, A.I.; Markova, G.D.; Vinogradova, S.V.; Garkusha, O.G. Synthesis and properties of acylated chitin and chitosan derivatives. Carbohydr. Polym. 2006, 64, 184–189. [Google Scholar] [CrossRef] [Scilit]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Overexpressing microRNA-Candidates | Down-Expressing microRNA-Candidates | Sample, Tissue | Source Link |
|---|---|---|---|
| miR-186, let-7d, miR-18a, miR-145, miR-99a | miR-17 | Blood cells | [23] |
| miR-301a-3p, miR-424-5p, miR-27a-3p | miR-205-5p | Plasma | [17,24] |
| miR-193b-3p, miR-720, miR-205-5p, miR-126-5p, miR-211-5p, miR-206, miR-550a-3p, miR-627-5p, miR-629-5p | miR-204-5p, miR-182-5p, miR-301a-3p, miR-200c-3p, miR-28-5p, miR-27a-3p, miR-197-3p, miR-374a-5p | Serum | [25] |
| miR-15b-5p, miR-149-3p, miR-150-5p, miR-155-5p | miR-193a-3p, miR-524-5p | Plasma | [17,26] |
| - | miR-29c-5p, miR-324-3p | Serum | [27] |
| - | miR-125b | Serum and exosomes | [17,28] |
| miR-20a, miR of the 17–92 complex, miR-125b, miR-146a, miR-155, miR-181a, miR-223 | - | Plasma | [29] |
| miR-18a-5p, miR-146a-5p, miR-363-3p | - | Melanoma tissue | [30] |
| miR-122-5p | - | Melanoma tissue and melanocytic nevi tissue | [31] |
| miR-31-5p, miR-21-5p | miR-211-5p, miR-125a-5p, miR-125b-5p, miR-100 5p | Melanoma tissue and melanocytic nevi tissue | [32] |
| Overexpressing microRNA-Candidates | Down-Expressing microRNA-Candidates | Sample, Tissue | Source Link |
|---|---|---|---|
| miR-193b-3p, miR-720 | - | Serum | [25] |
| miR-199a-5p, miR-150, miR-424 | miR-15b, miR-33a | Serum | [33] |
| - | miR-200c-3p | Plasma | [26] |
| - | miR-16 | Serum | [34] |
| - | miR-206 | Serum | [35] |
| miR-21 | - | Plasma | [36] |
| miR-221 | - | Serum | [37] |
| miR-210 | - | Plasma | [38] |
| miR-150, miR-30d, miR-15b, miR-425 | - | Serum | [39] |
| microRNAs | Sequence |
|---|---|
| hsa-miR-155-5p | UUAAUGCUAAUCGUGAUAGGGGUU |
| hsa-miR-149-3p | AGGGAGGGACGGGGCUGUGC |
| hsa-miR-150-5p | UCUCCCAACCCUUGUACCAGUG |
| hsa-miR-193a-3p | AACUGGCCUACAAAGUCCCAGU |
| hsa-miR-21-5p | AUGCUUAUCAGACUGAUGUUGA |
| № | Gender | Age | Diagnosis | Stage | Patient Groups |
|---|---|---|---|---|---|
| 1 | male | 69 | Cutaneous melanoma | IV | Melanoma patients’ group |
| 2 | female | 42 | Nodular melanoma with epithelioid cells | IV | |
| 3 | female | 37 | Cutaneous melanoma | IV | |
| 4 | female | 71 | Cutaneous melanoma | IV | |
| 5 | male | 68 | Melanoma of anterior abdominal wall | IV | |
| 6 | female | 45 | Malignant melanoma of left lower limb | IV | |
| 7 | female | 68 | Malignant melanoma of left lower limb | IV | |
| 8 | male | 67 | Cutaneous melanoma | IV | |
| 9 | male | 48 | Cutaneous melanoma | IV | |
| 10 | male | 41 | Melanoma of anterior abdominal wall | IV | |
| 11 | female | 52 | Cutaneous melanoma | IV | |
| 12 | female | 50 | Cutaneous melanoma | IV | |
| 13 | male | 69 | Healthy | - | Healthy donors’ group |
| 14 | male | 59 | Healthy | - | |
| 15 | female | 58 | Healthy | - | |
| 16 | female | 42 | Healthy | - | |
| 17 | male | 48 | Healthy | - | |
| 18 | female | 39 | Healthy | - | |
| 19 | female | 39 | Healthy | - | |
| 20 | male | 55 | Healthy | - | |
| 21 | female | 48 | Healthy | - | |
| 22 | female | 67 | Healthy | - | |
| 23 | male | 71 | Healthy | - | |
| 24 | female | 45 | Healthy | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Antonova, E.; Hambikova, A.; Shcherbakov, D.; Sukhov, V.; Vysochanskaya, S.; Fadeeva, I.; Gorshenin, D.; Sidorova, E.; Kashutina, M.; Zhdanova, A.; et al. Determination of Common microRNA Biomarker Candidates in Stage IV Melanoma Patients and a Human Melanoma Cell Line: A Potential Anti-Melanoma Agent Screening Model. Int. J. Mol. Sci. 2023, 24, 9160. https://doi.org/10.3390/ijms24119160
Antonova E, Hambikova A, Shcherbakov D, Sukhov V, Vysochanskaya S, Fadeeva I, Gorshenin D, Sidorova E, Kashutina M, Zhdanova A, et al. Determination of Common microRNA Biomarker Candidates in Stage IV Melanoma Patients and a Human Melanoma Cell Line: A Potential Anti-Melanoma Agent Screening Model. International Journal of Molecular Sciences. 2023; 24(11):9160. https://doi.org/10.3390/ijms24119160
Chicago/Turabian StyleAntonova, Elena, Anastasia Hambikova, Denis Shcherbakov, Vitaly Sukhov, Sonya Vysochanskaya, Inna Fadeeva, Denis Gorshenin, Ekaterina Sidorova, Maria Kashutina, Alina Zhdanova, and et al. 2023. "Determination of Common microRNA Biomarker Candidates in Stage IV Melanoma Patients and a Human Melanoma Cell Line: A Potential Anti-Melanoma Agent Screening Model" International Journal of Molecular Sciences 24, no. 11: 9160. https://doi.org/10.3390/ijms24119160
APA StyleAntonova, E., Hambikova, A., Shcherbakov, D., Sukhov, V., Vysochanskaya, S., Fadeeva, I., Gorshenin, D., Sidorova, E., Kashutina, M., Zhdanova, A., Mitrokhin, O., Avvakumova, N., & Zhernov, Y. (2023). Determination of Common microRNA Biomarker Candidates in Stage IV Melanoma Patients and a Human Melanoma Cell Line: A Potential Anti-Melanoma Agent Screening Model. International Journal of Molecular Sciences, 24(11), 9160. https://doi.org/10.3390/ijms24119160

