Abstract
Global food security has benefited from the development and promotion of the two-line hybrid rice system. Excellent eating quality determines the market competitiveness of hybrid rice varieties based on achieving the fundamental requirements of high yield and good adaptability. Developing sterile and restorer lines with improved quality for two-line hybrid breeding by editing quality genes with clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 is an efficient and practical alternative to the lengthy and laborious process of conventional breeding to improve rice quality. We edited Wx and OsBADH2 using CRISPR/Cas9 technology to produce both homozygous male sterile mutant lines and homozygous restorer mutant lines with Cas9-free. These mutants have a much lower amylose content while having a significantly higher 2-acetyl-1-pyrroline aroma content. Based on this, a fragrant glutinous hybrid rice was developed without too much effect on most agronomic traits. This study demonstrates the use of CRISPR/Cas9 in creating two-line fragrant glutinous hybrid rice by editing the components of the male sterile and the restorative lines.
1. Introduction
The most significant physical and chemical factor that impacts rice quality is the amylose content in rice grains [1,2,3]. Wx is important for the regulation of rice quality (including appearance quality and eating and cooking quality (ECQ)) and encodes granule-bound starch synthase I [4,5,6]. The abundant natural allelic variations confer the extensive variation of amylose content and rice quality among modern cultivated rice [6]. At least 10 distinct functional alleles of Wx have been identified, including Wxa, Wxb, wx, Wxin, Wxop, Wxmp, Wxmq, Wxhp, Wxlv, and Wxla/Wxmw [6,7,8,9,10,11,12,13]. Of these, Wxlv is an ancestral allele derived from wild rice. Wxla/Wxmw is a recently identified Wx allele derived from intragenic recombination, giving rice good eating qualities and grain transparency. The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 system appears to be a popular trend for editing various components of the Wx gene to enhance rice quality. Zhang et al. [14] and Xu et al. [15] edited the exon of the Wx gene, while Huang et al. [16] and Zeng et al. [17] edited the promoter and 5′UTR intron of the Wx gene, respectively. Thus, several mutants with different quality traits were produced. According to Liu et al. [18], the amylose content was significantly increased in rice seeds by editing the first intron of the Wx gene. These findings suggest that CRISPR/Cas9-mediated gene editing of suitable target sites can produce ideal amylose content and quality breeding materials.
The eating quality of rice is significantly influenced by several factors, including aroma, which is mainly controlled by the recessive gene fgr/OsBADH2 [19]. When the fgr/OsBADH2 gene underwent loss of function, it caused the BADH2 protein to lose its ability to catalyze the oxidation of 4-amino-butanal. This led to an accumulation of 4-amino-butanal, which promoted the synthesis of 2-acetyl-1-pyrroline (2-AP), and resulted in the production of fragrance in rice [20]. Shan et al. edited the fgr/OsBADH2 gene in Nipponbare using transcription activator-like effector nuclease (TALEN) technology, and the 2-AP content in the homozygous T1 line was significantly increased [21]. Ashokkumar et al. used the CRISPR/Cas9 method to produce novel alleles of fgr/OsBADH2 to induce aroma into the top non-aromatic rice variety ASD16. The phenotype was stably inherited in the T1 generation [22]. Any non-aromatic rice variety can be made aromatic by gene editing fgr/OsBADH2.
Heterosis refers to the superior performance of hybrids over their parents. A typical example of using heterosis is the creation of two-line hybrid rice systems. One of the fundamental components of two-line hybrid rice breeding is the light- and temperature-sensitive male sterile line. Although the adoption and use of two-line hybrid rice have significantly improved rice yield, the quality of hybrid rice is typically subpar. Three efficient gene editing techniques can be utilized to accurately and rapidly modify crop target traits: TALEN technology [23], zinc finger nuclease technology [24], and CRISPR technology [25]. In this study, we edited Wx and OsBADH2 using the CRISPR/Cas9 system to create homozygous mutants of the Zhinong 1S (ZN1S) sterile and the Zhinong 1307 (ZN1307) restorer lines, resulting in fragrant glutinous hybrid rice with better yield performance than its parents and providing new ideas and insights for quality improvement of hybrid rice.
2. Results
2.1. Creation of Fragrant Glutinous Mutants with Cas9-Free
We developed wx-fgr double mutants using CRISPR/Cas9 technology on the genetic background of the sterile line ZN1S and restorer line ZN1307 to produce fragrant and waxy hybrid rice (Figure 1A). PAGE combined with Sanger sequencing analysis revealed that ZN1S and ZN1307, respectively, had heterozygous mutations of 9 and 6 distinct mutation types in T0 transgenic plants (Supplementary Tables S2 and S3). We PCR-selected Cas9-free plants from transgenic (T1–T2) segregating families and identified 5 and 6 homozygous mutant T3-lines for ZN1S and ZN1307, respectively (Figure 1B). Unlike the translucent endosperm of wild type grains, the endosperm of all the mutants showed milky white similar to that of glutinous rice (Figure 1C). The amylose content of grains from these 11 mutant T3-lines was measured, and the results revealed that once the Wx gene was mutated, the amylose content in every mutant drastically dropped (Figure 1D). The lowest was the wx-fgr-S2 mutant line, whose amylose content was 2.2%, which was very close to that of wild glutinous rice. Among them, the amylose content in grains of ZN1S mutants ranged between 2–4%. Amylose content ranged between 2.5–3.5% in ZN1307 mutants, with wx-fgr-R2 having the lowest value at 2.6% (Figure 1D). Additionally, we used the potassium hydroxide method to conduct a sensory evaluation of these mutants’ aromas. The results revealed that the mutant brown rice from both materials could generate a light aroma of rice (Figure 1E). Next, we assessed the 11 homozygous mutant T4-lines for ZN1S and ZN1307′s quality traits. All mutants’ amylose content (for convenience, the abbreviation AC is used below for amylose content) was significantly lower than the corresponding wild type, consistent with the results of T3 generation, while their 2-AP and GC were significantly higher (Figure 1F–I). Rapid viscosity analysis (RVA) was used to evaluate the starch quality [26]. Compared to WT-S, the viscosity indexes of the remaining three mutants from ZN1S were lower than those of wx-fgr-S1 and wx-fgr-S4 (Figure 1J). Different from mutants from ZN1S, all mutants from ZN1307 showed similar viscosity indexes, but these were obviously less than for WT-R (Figure 1J).
Figure 1.
Improvement of rice grain quality by editing of the Wxla and OsBADH2 using CRISPR/Cas9. (A) Schematic diagram of the targeted sites in Wx and OsBADH2. The protospacer-adjacent motifs (PAMs) are shown in red. (B) Mutations in the edited T3 lines. Inserted bases are marked in red, and missing bases are indicated by short dashed lines. (C) Morphology of milled rice from ZN1S, ZN1307 and the F1 hybrid ZN1S mutants × ZN1307 mutants. WT-S represents the wild type of sterile line ZN1S and WT-R represents the wild type of restorer line ZN1307. Scale bars, 1000 µm. (D) The amylose contents determined by iodine colorimetry of ZN1S, ZN1307 and their T3 generation homozygous mutant lines. (E) Sensory evaluation of the aroma of ZN1S, ZN1307 and their mutants by potassium hydroxide method. (F) The grain amylose contents determined by iodine colorimetry of ZN1S, ZN1307 and their T4 generation homozygous mutant lines. (G) Total ion chromatograms (TIC) of 2-AP and TMP in the grains of ZN1S, ZN1307 and their T4 generation homozygous mutant lines. (H) 2-AP content in grains of ZN1S, ZN1307 and their T4 generation homozygous mutant lines. 2, 4, 6-trimethyl pyridine (TMP) was used as the internal standard. (I) Gel consistency. (J) Rapid visco analysis profiles of grain starches of ZN1S, ZN1307 and their T4 generation homozygous mutant lines. cP (centi Poise), viscosity unit. Error bars are means ± SD (n = 3). Samples without the same letter show significant difference by Duncan’s test (p < 0.05).
Furthermore, we looked at the agronomic traits of these homozygous mutant T4-lines for ZN1S and ZN1307 (Supplementary Table S4). Only specific agronomic traits of some mutants were altered, such as plant height in wx-fgr-S5, number of effective tillers in wx-fgr-S1 and wx-fgr-S3, number of primary branches in wx-fgr-S2, and grain number per panicle in wx-fgr-S1 and wx-fgr-S5, etc. Similar to those of ZN1S mutants, most agronomic traits did not change significantly in ZN1307 mutants; only certain mutants showed changes in specific agronomic traits, such as the number of primary branches in wx-fgr-R1 and wx-fgr-R2, the setting rate in wx-fgr-R3, the 1000-grain weight in wx-fgr-R1 and wx-fgr-R5. The only noteworthy thing is that all ZN1307 mutants had varying degrees of decreased yield per plant.
2.2. Creation of Fragrant Glutinous Hybrid Rice
wx-fgr-S2 with the lowest amylose content among the ZN1S sterile mutants and wx-fgr-S4 with similar agronomic traits to the wild-type were selected as recipients. In contrast, wx-fgr-R2 with the lowest amylose content among the ZS1307 restorer mutants and wx-fgr-R6 with the least impact on yield per plant were selected as donor parents to obtain four types of hybrid rice, namely wx-fgr-Z22 (wx-fgr-S2/wx-fgr-R2), wx-fgr-Z42 (wx-fgr-S4/wx-fgr-R2), wx-fgr-Z26 (wx-fgr-S2/wx-fgr-R6), and wx-fgr-Z46 (wx-fgr-S4/wx-fgr-R6). We identified the four transgenic hybrid rice’s primary quality features. Similar to ZN1S sterile mutants and ZS1307 restorer mutants, the grain endosperms produced by all hybrid combinations had low transparency and milky white appearance, obviously different from that of WT-S and WT-R (Figure 1C). Iodine staining results showed that refined rice grains from hybrid rice had lighter coloration in transverse sections than WT-S and WT-R (Figure 2A). Correspondingly, the four transgenic hybrid rice variants have much less amylose than their two parental strains (Figure 2B). In particular, wx-fgr-Z42 had an amylose content of 1.76%, which was on par with wild-type waxy rice. The four transgenic hybrid rice strains had an aroma substance 2-AP level that was significantly higher than that of the sterile line ZN1S while not comparable to that of the restorer line ZN1307 (Figure 2C,D). However, rice flour from the four transgenic hybrid rice variants had a worse RVA curve pattern than that from thetwo parents, WT-S and WT-R, while having a greater gel consistency than the wild type (Figure 2E,F). In addition, we also investigated the main agronomic traits of the transgenic hybrid rice (Supplementary Table S4). In general, hybrid rice showed obvious superparent advantage in plant height and panicle length, but no obvious changes in other traits, except for specific traits of several mutants, such as the grain weight per panicle in wx-fgr-Z46, the setting rate in wx-fgr-Z26 and wx-fgr-Z46 and the yield per plant in wx-fgr-Z26.
Figure 2.
Creation of two-line fragrant glutinous hybrid rice. (A) Microscopic observation of iodine-stained endosperm. WT-S represents the wild type of sterile line ZN1S and WT-R represents the wild type of restorer line ZN1307. Scale bars, 200 µm. (B) The amylose contents determined by iodine colorimetry of ZN1S, ZN1307 and the F1 hybrid ZN1S mutants × ZN1307 mutants. (C) Total ion chromatograms (TIC) of 2-AP and TMP in the grains of ZN1S, ZN1307 and the F1 hybrid ZN1S mutants × ZN1307 mutants. 2, 4, 6-trimethyl pyridine (TMP) was used as the internal standard. (D) 2-AP content. (E) Rapid visco analysis. cP (centi Poise), viscosity unit. (F) Gel consistency. Error bars are means ± SD (n = 3). Samples without the same letter show significant difference by Duncan’s test (p < 0.05).
3. Discussion
Although hybrid rice’s cooking and eating quality have somewhat improved recently, they still fall short of high-grade and high-quality conventional rice. Incorporating the wx mutation into varieties with low initial AAC levels led to further reductions in AAC; however, these effects had little to no impact on the desired gelatinization traits, amylopectin structure types, or the major agronomic traits [27]. Therefore, introducing the wx mutation into rice varieties with low baseline AAC levels is a feasible strategy for increasing the ECQ of rice. In this study, the wild-type sterile line ZN1S and the restorer line ZN1307 had initial amylose contents of about 10% (Figure 1D,F), which were not very high. All of the mutants’ amylose contents were reduced to 2–4% levels by Cas9-mediated gene editing, along with some modifications to their gelatinizing properties (Figure 1). Notably, sterile line mutants and restorer line mutants have gel consistency that is significantly higher than that of the corresponding wild type (Figure 1I). However, different from the great changes in ZN1S and ZN1307 mutants, only wx-fgr-Z26 had significantly higher gel consistency in hybrid rice, but only between the two parents (Figure 2F). The viscosity curve of the sterile line mutants varied in degree from the wild type, whereas all restorer line mutants and hybrid rice had softer pasting properties (Figure 1J). These results indicate that the heredity of quality traits in hybrid rice may not be determined by simple additive effect. In addition, it may not be enough to manipulate only Wx, the main quality gene. Combining with other quality genes, even some quality genes with minor effects, may be needed to finally improve rice quality.
Overall, our study shows how to directly alter high-quality genes of interest in elite sterile and restorer lines to produce enhanced hybrid rice with the potential for commercialization.
4. Materials and Methods
4.1. Plant Materials and Growing Conditions
ZN1S is a photoperiod-sensitive genic male sterile rice variety, whereas ZN1307 is an indica restorer rice variety with high quality and high yield, and both carry a Wxla allele. Plants were grown in the field throughout the regular rice growing season at Huazhong Agricultural University’s experimental station, Wuhan (Hubei), and Lingshui (Hainan). The seeds were sown on May 15 every year, and the seedlings (25 or 30 days old) were transplanted onto the field with a single plant spacing of 16.5 cm and 26.4 cm between rows. The field was managed using customary agricultural practices. At the end of the third stage of panicle differentiation, ZN1S male sterile lines—whose fertility transformation temperature was 24 °C—were generally transferred to a cold water pool (22.5 °C), then after 15 days of treatment from the cold water pool to the field.
4.2. Design of the Wx and OsBADH2 Target Sites and Construction of the CRISPR/Cas9 Double-Targeting Vector
We designed target sites at bases 14–33 of the third exon of the Wx gene and bases 122–141 of the fourth exon of the OsBADH2 gene, respectively, to produce waxy and fragrant transgenic lines. The online tool CRISPR GE was used to design the target sites [28]. The target sequences for the Wx gene were GGGTCATGGTGATCTCTCCTCGG and for the OsBADH2 gene ATCAACCCAACTACACCGATAGG. The U6-sgRNA expression cassette encoding the 20 nucleotides (nt) Wx target sequence was amplified by polymerase chain reaction (PCR) and ligated into the pCXUN vector, which Kpn I digested to create the pCXUN-U6-sgRNA intermediate vector. The 20 nt OsBADH2 target sequence from the U3-sgRNA expression cassette was then amplified by PCR and ligated into the pCXUN-U6-sgRNA intermediate vector, digested by Sac I to create the final vector pCXUN-U6-U3-sgRNA. The constructed CRISPR/Cas9 final vector was introduced into the ZN1S and the ZN1307 receptor using Agrobacterium tumfaciens-mediated genetic transformation [29]. The primer sequences used to construct the vector are listed in Supplementary Table S1.
4.3. Molecular Characterization of the Mutant Plants
Genomic DNA was extracted from seedling leaves using the sodium dodecyl sulfate method [30]. PCR amplification was performed using primer pairs that produce amplicons containing the target sites. The amplified products were then sequenced using the Sanger sequencing method and assembled using the software SeqMan from the Lasergene package. We compared the amplicon sequences generated from the corresponding wild-type and real transgenic templates to identify mutations. Polyacrylamide gel electrophoresis (PAGE) was used to determine the homozygosity/heterozygosity for a mutant individual. Indel primer pairs that produce an amplicon, including the target sites, were created. Agarose gel electrophoresis was used to identify Cas9 in each individual. The relevant PCR primers for these steps are listed in Supplementary Table S1.
4.4. Evaluation of Rice Quality
Amylose content and gel consistency were measured using the previously described method [31]. Ten full grains of brown rice were placed in a Petri dish for the sensory evaluation of rice fragrance. Following this, 10 mL of 1.7% potassium hydroxide solution was added, and the dish was covered and left at room temperature for 10 min. The Petri dishes were then opened one by one, and at least three subjects with a normal sense of smell were requested to assess and average each sample. Gas chromatography-mass spectrometry (GC-MS) was used to determine the content of flavor ingredient 2-AP. The extract was added after the brown rice was ground into a powder. The final sample was injected into the Agilent6890 GC connected to the HP5973 MS detector (Agilent Technologies, Palo Alto, CA, USA) for detection. MS database and retention time were used to identify the volatile compounds. Internal standard methylene chloride. 2, 4, 6-trimethyl pyridine was injected at a concentration of 0.4585 ng/µl, and the injection volume was 1 µl. A previous study has outlined the detailed steps [32].
4.5. Investigation of Agronomic Characters
In the paddy field, plant height, grains per panicle, panicle length, effective panicles, primary branches, and secondary branches were measured. Grain number per panicle, grain weight per panicle, setting rate, 1000-grain weight and yield per plant were investigated indoors. Seeds were collected for each plant and dried at 37 °C for two weeks to determine the yield per plant. Using the SC-A grain analysis system (Wseen company, Hangzhou, China), 1000-grain weight was measured. Three similar-sized panicles from each plant were selected, dried at 37 °C for two weeks, and the average value was then calculated to determine the number of grains and grain weight per panicle.
4.6. Performance of the F1 Hybrids Obtained from ZN1S × ZN1307
ZN1S mutant lines (wx-fgr-S2 and wx-fgr-S4) and ZN1307 restorer lines (wx-fgr-R2 and wx-fgr-R6) were crossed in pairs. To avoid unforeseen pollination, the panicles were covered with brown paper bags. The F1 seeds were harvested 30 days after the grains matured, and the F1 hybrids were sown in the field plots. The experiment used a replicative complete block design with 36 plants in each plot that was replicated twice.
4.7. Microscopy
In the iodine staining experiment, the mature seeds were first processed into milled rice, and the milled rice was cut with a sharp blade after being stained with iodine solution, and then observed and photographed with a stereo fluorescence microscope (SMZ25, Nikon, Tokyo, Japan). The appearance of milled rice was directly observed and photographed by a stereo fluorescence microscope (SMZ25, Nikon, Tokyo, Japan).
4.8. Statistical Analysis
The various diagrams in this study were drawn using GraphPad Prism 8. One-way analysis of variance and Duncan multiple comparisons were used to analyze differences between different groups using IBM Statistical Package for Social Sciences v16.0 software. Microsoft Excel 2016 was used to perform the preliminary processing and analysis of phenotypic data.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24010849/s1.
Author Contributions
G.L. wrote the manuscript. Y.T. and G.L. performed most of the experiments. Y.Z. constructed the CRISPR/Cas9 double-targeting vector and completed the preliminary genotype detection work. Y.L. provided guidance for determination of some quality traits. G.G. and Q.Z. participated in part of the field experiments. Y.H. designed experiments. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by grants from the Ministry of Science and Technology (2021YFF1000200), National Natural Science Foundation of China (U21A20211, 91935303), the Science and Technology Major Program of Hubei Province (2021ABA011), and China Agriculture Research System (CARS-01-03).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
For materials, please contact the corresponding author’s email address.
Conflicts of Interest
The authors declare that there are no conflict of interest.
References
- Tian, Z.; Qian, Q.; Liu, Q.; Yan, M.; Liu, X.; Yan, C.; Liu, G.; Gao, Z.; Tang, S.; Zeng, D.; et al. Allelic diversities in rice starch biosynthesis lead to a diverse array of rice eating and cooking qualities. Proc. Natl. Acad. Sci. USA 2009, 106, 21760–21765. [Google Scholar] [CrossRef] [PubMed]
- Fitzgerald, M.A.; McCouch, S.R.; Hall, R.D. Not just a grain of rice: The quest for quality. Trends Plant Sci. 2009, 14, 133–139. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Prakash, S.; Nicholson, T.M.; Fitzgerald, M.A.; Gilbert, R.G. The importance of amylose and amylopectin fine structure for textural properties of cooked rice grains. Food Chem. 2016, 196, 702–711. [Google Scholar] [CrossRef] [PubMed]
- Sano, Y. Differential regulation of waxy gene expression in rice endosperm. Theor. Appl. Genet. 1984, 68, 467–473. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.-y.; Wu, Z.-l.; Xing, Y.-y.; Zheng, F.-g.; Guo, X.-l.; Zhang, W.-g.; Hong, M.-m. Nucleotide sequence of rice waxy gene. Nucleic Acids Res. 1990, 18, 5898. [Google Scholar] [CrossRef]
- Zhang, C.; Zhu, J.; Chen, S.; Fan, X.; Li, Q.; Lu, Y.; Wang, M.; Yu, H.; Yi, C.; Tang, S.; et al. Wxlv, the Ancestral Allele of Rice Waxy Gene. Mol. Plant 2019, 12, 1157–1166. [Google Scholar] [CrossRef]
- Ayres, N.M.; McClung, A.M.; Larkin, P.D.; Bligh, H.F.J.; Jones, C.A.; Park, W.D. Microsatellites and a single-nucleotide polymorphism differentiate apparentamylose classes in an extended pedigree of US rice germ plasm. Theor. Appl. Genet. 1997, 94, 773–781. [Google Scholar] [CrossRef]
- Wanchana, S.; Toojinda, T.; Tragoonrung, S.; Vanavichit, A. Duplicated coding sequence in the waxy allele of tropical glutinous rice (Oryza sativa L.). Plant Sci. 2003, 165, 1193–1199. [Google Scholar] [CrossRef]
- Mikami, I.; Uwatoko, N.; Ikeda, Y.; Yamaguchi, J.; Hirano, H.Y.; Suzuki, Y.; Sano, Y. Allelic diversification at the wx locus in landraces of Asian rice. Theor. Appl. Genet. 2008, 116, 979–989. [Google Scholar] [CrossRef]
- Liu, L.; Ma, X.; Liu, S.; Zhu, C.; Jiang, L.; Wang, Y.; Shen, Y.; Ren, Y.; Dong, H.; Chen, L.; et al. Identification and characterization of a novel Waxy allele from a Yunnan rice landrace. Plant Mol. Biol. 2009, 71, 609–626. [Google Scholar] [CrossRef]
- Yang, J.; Wang, J.; Fan, F.-J.; Zhu, J.-Y.; Chen, T.; Wang, C.-L.; Zheng, T.-Q.; Zhang, J.; Zhong, W.-G.; Xu, J.-L. Development of AS-PCR marker based on a key mutation confirmed by resequencing of Wx-mp in Milky Princess and its application in japonica soft rice (Oryza sativa L.) breeding. Plant Breed. 2013, 132, 595–603. [Google Scholar] [CrossRef]
- Zhou, H.; Xia, D.; Zhao, D.; Li, Y.; Li, P.; Wu, B.; Gao, G.; Zhang, Q.; Wang, G.; Xiao, J.; et al. The origin of Wxla provides new insights into the improvement of grain quality in rice. J. Integr. Plant Biol. 2021, 63, 878–888. [Google Scholar] [CrossRef]
- Zhang, C.; Yang, Y.; Chen, S.; Liu, X.; Zhu, J.; Zhou, L.; Lu, Y.; Li, Q.; Fan, X.; Tang, S.; et al. A rare Waxy allele coordinately improves rice eating and cooking quality and grain transparency. J. Integr. Plant Biol. 2021, 63, 889–901. [Google Scholar] [CrossRef]
- Zhang, J.; Zhang, H.; Botella, J.R.; Zhu, J.-K. Generation of new glutinous rice by CRISPR/Cas9-targeted mutagenesis of the Waxy gene in elite rice varieties. J. Integr. Plant Biol. 2018, 60, 369–375. [Google Scholar] [CrossRef]
- Xu, Y.; Lin, Q.; Li, X.; Wang, F.; Chen, Z.; Wang, J.; Li, W.; Fan, F.; Tao, Y.; Jiang, Y.; et al. Fine-tuning the amylose content of rice by precise base editing of the Wx gene. Plant Biotechnol. J. 2021, 19, 11–13. [Google Scholar] [CrossRef]
- Huang, L.; Li, Q.; Zhang, C.; Chu, R.; Gu, Z.; Tan, H.; Zhao, D.; Fan, X.; Liu, Q. Creating novel Wx alleles with fine-tuned amylose levels and improved grain quality in rice by promoter editing using CRISPR/Cas9 system. Plant Biotechnol. J. 2020, 18, 2164–2166. [Google Scholar] [CrossRef]
- Zeng, D.; Liu, T.; Ma, X.; Wang, B.; Zheng, Z.; Zhang, Y.; Xie, X.; Yang, B.; Zhao, Z.; Zhu, Q.; et al. Quantitative regulation of Waxy expression by CRISPR/Cas9-based promoter and 5′UTR-intron editing improves grain quality in rice. Plant Biotechnol. J. 2020, 18, 2385–2387. [Google Scholar] [CrossRef]
- Liu, X.; Ding, Q.; Wang, W.; Pan, Y.; Tan, C.; Qiu, Y.; Chen, Y.; Li, H.; Li, Y.; Ye, N.; et al. Targeted Deletion of the First Intron of the Wxb Allele via CRISPR/Cas9 Significantly Increases Grain Amylose Content in Rice. Rice 2022, 15, 1. [Google Scholar] [CrossRef]
- Grimm, C.C.; Bergman, C.; Delgado, J.T.; Bryant, R. Screening for 2-Acetyl-1-pyrroline in the Headspace of Rice Using SPME/GC-MS. J. Agric. Food Chem. 2001, 49, 245–249. [Google Scholar] [CrossRef]
- Bradbury, L.M.T.; Fitzgerald, T.L.; Henry, R.J.; Jin, Q.; Waters, D.L.E. The gene for fragrance in rice. Plant Biotechnol. J. 2005, 3, 363–370. [Google Scholar] [CrossRef]
- Shan, Q.; Zhang, Y.; Chen, K.; Zhang, K.; Gao, C. Creation of fragrant rice by targeted knockout of the OsBADH2 gene using TALEN technology. Plant Biotechnol. J. 2015, 13, 791–800. [Google Scholar] [CrossRef] [PubMed]
- Ashokkumar, S.; Jaganathan, D.; Ramanathan, V.; Rahman, H.; Palaniswamy, R.; Kambale, R.; Muthurajan, R. Creation of novel alleles of fragrance gene OsBADH2 in rice through CRISPR/Cas9 mediated gene editing. PLoS ONE 2020, 15, e0237018. [Google Scholar] [CrossRef] [PubMed]
- Shan, Q.; Wang, Y.; Chen, K.; Liang, Z.; Li, J.; Zhang, Y.; Zhang, K.; Liu, J.; Voytas, D.F.; Zheng, X.; et al. Rapid and Efficient Gene Modification in Rice and Brachypodium Using TALENs. Mol. Plant 2013, 6, 1365–1368. [Google Scholar] [CrossRef] [PubMed]
- Cantos, C.; Francisco, P.; Trijatmiko, K.R.; Slamet-Loedin, I.; Chadha-Mohanty, P.K. Identification of “safe harbor” loci in indica rice genome by harnessing the property of zinc-finger nucleases to induce DNA damage and repair. Front. Plant Sci. 2014, 5, 302. [Google Scholar] [CrossRef] [PubMed]
- Liang, Z.; Zhang, K.; Chen, K.; Gao, C. Targeted Mutagenesis in Zea mays Using TALENs and the CRISPR/Cas System. J. Genet. Genom. 2014, 41, 63–68. [Google Scholar] [CrossRef]
- Fitzgerald, M.A.; Martin, M.; Ward, R.M.; Park, W.D.; Shead, H.J. Viscosity of Rice Flour: A Rheological and Biological Study. J. Agric. Food Chem. 2003, 51, 2295–2299. [Google Scholar] [CrossRef]
- Fu, Y.; Luo, T.; Hua, Y.; Yan, X.; Liu, X.; Liu, Y.; Liu, Y.; Zhang, B.; Liu, R.; Zhu, Z.; et al. Assessment of the Characteristics of Waxy Rice Mutants Generated by CRISPR/Cas9. Front. Plant Sci. 2022, 13, 881964. [Google Scholar] [CrossRef]
- Xie, X.; Ma, X.; Zhu, Q.; Zeng, D.; Li, G.; Liu, Y.-G. CRISPR-GE: A Convenient Software Toolkit for CRISPR-Based Genome Editing. Mol. Plant 2017, 10, 1246–1249. [Google Scholar] [CrossRef]
- Hiei, Y.; Komari, T.; Kubo, T. Transformation of rice mediated by Agrobacterium tumefaciens. Plant Mol. Biol. 1997, 35, 205–218. [Google Scholar] [CrossRef]
- Dellaporta, S.L.; Wood, J.; Hicks, J.B. A plant DNA minipreparation: Version II. Plant Mol. Biol. Rep. 1983, 1, 19–21. [Google Scholar] [CrossRef]
- Qiu, X.J.; Peng, B.; Yu, S.B. Rice Grain Quality Analysis. Bio-Protocol 2018, e1010163. [Google Scholar] [CrossRef]
- Huang, T.-C.; Teng, C.-S.; Chang, J.-L.; Chuang, H.-S.; Ho, C.-T.; Wu, M.-L. Biosynthetic Mechanism of 2-Acetyl-1-pyrroline and Its Relationship with Δ1-Pyrroline-5-carboxylic Acid and Methylglyoxal in Aromatic Rice (Oryza sativa L.) Callus. J. Agric. Food Chem. 2008, 56, 7399–7404. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).