Transcription Factor ERF194 Modulates the Stress-Related Physiology to Enhance Drought Tolerance of Poplar
Abstract
1. Introduction
2. Results
2.1. ERF194 Enhanced Drought Tolerance through Regulating Aboveground Part
2.2. ERF194 Enhanced Drought Tolerance through Promoting Fine Roots Growth
2.3. ERF194 Improved Physiological Performance of Poplar under Drought Stress
2.4. ERF194 Induced the Expression of Stress-Related Genes
3. Discussion
4. Experimental Materials and Methods
4.1. Plant Materials and Drought Treatment
4.2. Characteristics of Leaf
4.3. Characteristics of Root
4.4. Gene Annotation and Expression Patterns
4.5. RNA Extraction and RT-qPCR
4.6. Analysis of cis-Acting Elements in the Promoter
4.7. Data Processing
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
WT | Non-transgenic poplar line |
OX | ERF194-overexpressing line |
RNAi | ERF194-suppressing line |
CK | Normal watering conditions |
DR | Drought stress conditions |
MDA | Malondialdehyde |
NSC | Non-structural carbohydrate |
SOD | Superoxide dismutase |
CAT | Catalase |
POD | Peroxidase |
References
- Duan, H.Y.; Zhu, Y.Q.; Li, J.Y.; Ding, W.K.; Wang, H.N.; Jiang, L.N.; Zhou, Y.Q. Effects of Drought Stress on Growth and Development of Wheat Seedlings. Int. J. Agric. Biol. 2017, 19, 1119–1124. [Google Scholar] [CrossRef]
- Shinozaki, K.; Yamaguchi-Shinozaki, K. Gene networks involved in drought stress response and tolerance. J. Exp. Bot. 2007, 58, 221–227. [Google Scholar] [CrossRef]
- Koleva, N.G.; Schneider, U. The impact of climate change on the external cost of pesticide applications in US agriculture. Int. J. Agric. Sustain. 2009, 7, 203–216. [Google Scholar] [CrossRef]
- Yordanov, I.; Velikova, V.; Tsonev, T. Plant Responses to Drought, Acclimation, and Stress Tolerance. Photosynthetica 2000, 38, 171–186. [Google Scholar] [CrossRef]
- Anjum, S.A.; Xie, X.Y.; Wang, L.C.; Saleem, M.F.; Man, C.; Lei, W. Morphological, physiological and biochemical responses of plants to drought stress. Afr. J. Agric. Res. 2011, 6, 2026–2032. [Google Scholar] [CrossRef]
- An, J.P.; Zhang, X.W.; Bi, S.Q.; You, C.X.; Wang, X.F.; Hao, Y.J. The ERF transcription factor MdERF38 promotes drought stress-induced anthocyanin biosynthesis in apple. Plant J. 2020, 101, 573–589. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhou, Y.Y.; Zhang, D.; Tang, X.L.; Li, Z.; Shen, C.; Han, X.; Deng, W.H.; Yin, W.L.; Xia, X.L. PtrWRKY75 overexpression reduces stomatal aperture and improves drought tolerance by salicylic acid-induced reactive oxygen species accumulation in poplar. Environ. Exp. Bot. 2020, 176, 104117. [Google Scholar] [CrossRef]
- Choat, B.; Brodribb, T.J.; Brodersen, C.R.; Duursma, R.A.; Lopez, R.; Medlyn, B.E. Triggers of tree mortality under drought. Nature 2018, 558, 531–539. [Google Scholar] [CrossRef]
- Asner, G.P.; Brodrick, P.G.; Anderson, C.B.; Vaughn, N.; Knapp, D.E.; Martin, R.E. Progressive forest canopy water loss during the 2012-2015 California drought. Proc. Natl. Acad. Sci. USA 2016, 113, E249–E255. [Google Scholar] [CrossRef]
- Yu, W.; Cai, J.; Liu, H.; Lu, Z.; Hu, J.; Lu, Y. Transcriptomic Analysis Reveals Regulatory Networks for Osmotic Water Stress and Rewatering Response in the Leaves of Ginkgo biloba. Forests 2021, 12, 1705. [Google Scholar] [CrossRef]
- Teng, Q. Changes of antioxidant enzyme activities in chloroplast of ‘717’ poplar under NaCl treatment. IOP Conf. Ser. Earth Environ. Sci. 2018, 170, 052004. [Google Scholar] [CrossRef]
- Rashid, M.; Guangyuan, H.; Guangxiao, Y.; Hussain, J.; Xu, Y. AP2/ERF Transcription Factor in Rice: Genome-Wide Canvas and Syntenic Relationships between Monocots and Eudicots. Evol. Bioinform. 2012, 8, 321–355. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Jin, J.; Tang, L.; Zhao, Y.; Gu, X.; Gao, G.; Luo, J. PlantTFDB 2.0: Update and improvement of the comprehensive plant transcription factor database. Nucleic Acids Res. 2011, 39, D1114–D1117. [Google Scholar] [CrossRef]
- Chen, K.; Tang, W.; Zhou, Y.; Chen, J.; Xu, Z.; Ma, R.; Dong, Y.; Ma, Y.; Chen, M. AP2/ERF transcription factor GmDREB1 confers drought tolerance in transgenic soybean by interacting with GmERFs. Plant Physiol. Biochem. 2022, 170, 287–295. [Google Scholar] [CrossRef] [PubMed]
- Sohn, K.H.; Lee, S.C.; Jung, H.W.; Hong, J.K.; Hwang, B.K. Expression and functional roles of the pepper pathogen-induced transcription factor RAV1 in bacterial disease resistance, and drought and salt stress tolerance. Plant Mol. Biol. 2006, 61, 897–915. [Google Scholar] [CrossRef]
- Thirugnanasambantham, K.; Durairaj, S.; Saravanan, S.; Karikalan, K.; Muralidaran, S.; Islam, V.I.H. Role of Ethylene Response Transcription Factor (ERF) and Its Regulation in Response to Stress Encountered by Plants. Plant Mol. Biol. Rep. 2014, 33, 347–357. [Google Scholar] [CrossRef]
- Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. AP2/ERF family transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta 2012, 1819, 86–96. [Google Scholar] [CrossRef]
- Dubois, M.; Van den Broeck, L.; Claeys, H.; Van Vlierberghe, K.; Matsui, M.; Inze, D. The Ethylene Response Factors ERF6 and ERF11 Antagonistically Regulate Mannitol-Induced Growth Inhibition in Arabidopsis. Plant Physiol. 2015, 169, 166–179. [Google Scholar] [CrossRef]
- Aukerman, M.J.; Sakai, H. Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes. Plant Cell 2003, 15, 2730–2741. [Google Scholar] [CrossRef]
- Yao, W.; Zhou, B.; Zhang, X.; Zhao, K.; Cheng, Z.; Jiang, T. Transcriptome analysis of transcription factor genes under multiple abiotic stresses in Populus simonii x P. nigra. Gene 2019, 707, 189–197. [Google Scholar] [CrossRef]
- Wang, S.; Huang, J.; Wang, X.; Fan, Y.; Liu, Q.; Han, Y. PagERF16 of Populus Promotes Lateral Root Proliferation and Sensitizes to Salt Stress. Front. Plant Sci. 2021, 12, 669143. [Google Scholar] [CrossRef] [PubMed]
- Hawku, M.D.; Goher, F.; Islam, M.A.; Guo, J.; He, F.; Bai, X.; Yuan, P.; Kang, Z.; Guo, J. TaAP2-15, An AP2/ERF Transcription Factor, Is Positively Involved in Wheat Resistance to Puccinia striiformis f. sp. tritici. Int. J. Mol. Sci. 2021, 22, 2080. [Google Scholar] [CrossRef] [PubMed]
- Imano, S.; Fushimi, M.; Camagna, M.; Tsuyama-Koike, A.; Mori, H.; Ashida, A.; Tanaka, A.; Sato, I.; Chiba, S.; Kawakita, K.; et al. AP2/ERF Transcription Factor NbERF-IX-33 Is Involved in the Regulation of Phytoalexin Production for the Resistance of Nicotiana benthamiana to Phytophthora infestans. Front. Plant Sci. 2021, 12, 821574. [Google Scholar] [CrossRef] [PubMed]
- Sakuma, Y.; Liu, Q.; Dubouzet, J.G.; Abe, H.; Shinozaki, K.; Yamaguchi-Shinozaki, K. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 2002, 290, 998–1009. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. A Novel cis-Acting Element in an Arabidopsis Gene Is Involved in Responsiveness to Drought, Low-Temperature, or High-Salt Stress. Plant Cell 1994, 6, 251–264. [Google Scholar] [CrossRef]
- Thomashow, M.F. Plant Cold Acclimation: Freezing Tolerance Genes and Regulatory Mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999, 50, 571–599. [Google Scholar] [CrossRef]
- Yao, W.; Zhang, X.; Zhou, B.; Zhao, K.; Li, R.; Jiang, T. Expression Pattern of ERF Gene Family under Multiple Abiotic Stresses in Populus simonii x P. nigra. Front. Plant Sci. 2017, 8, 181. [Google Scholar] [CrossRef]
- Huang, J.; Wang, S.; Wang, X.; Fan, Y.; Han, Y. Structure and expression analysis of seven salt-related ERF genes of Populus. PeerJ 2020, 8, e10206. [Google Scholar] [CrossRef]
- Wang, S.; Fan, Y.; Du, S.; Zhao, K.; Liu, Q.; Yao, W.; Zheng, T.; Han, Y. PtaERF194 inhibits plant growth and enhances drought tolerance in poplar. Tree Physiol. 2022, 42, 1678–1692. [Google Scholar] [CrossRef]
- Wang, S.; Jing, Y.; Zhao, C.; Huang, J.; Wang, X.; Dai, Y. Effects of saline-alkali soil conditioner on the recovery of growth and physiology of Chinese seabuckthorn. Plant Physiol. Rep. 2021, 26, 301–310. [Google Scholar] [CrossRef]
- Pregitzer, K.S.; DeForest, J.L.; Burton, A.J.; Allen, M.F.; Ruess, R.W.; Hendrick, R.L. Fine Root Architecture of Nine North American Trees. Ecol. Monogr. 2002, 72, 293–309. [Google Scholar] [CrossRef]
- Tsikas, D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. Anal. Biochem. 2017, 524, 13–30. [Google Scholar] [CrossRef] [PubMed]
- Ighodaro, O.M.; Akinloye, O.A. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alex. J. Med. 2019, 54, 287–293. [Google Scholar] [CrossRef]
- Zhang, J.; Kirkham, M.B. Drought-Stress-Induced Changes in Activities of Superoxide Dismutase, Catalase, and Peroxidase in Wheat Species. Plant Cell Physiol. 1994, 35, 785–791. [Google Scholar] [CrossRef]
- Huo, J.; Shi, Y.; Zhang, H.; Hu, R.; Huang, L.; Zhao, Y.; Zhang, Z. More sensitive to drought of young tissues with weak water potential adjustment capacity in two desert shrubs. Sci. Total Environ. 2021, 790, 148103. [Google Scholar] [CrossRef]
- Khajeddin, S.; Matinkhah, S.; Jafari, Z. A drought resistance index to select drought resistant plant species based on leaf water potential measurements. J. Arid Land 2019, 11, 623–635. [Google Scholar] [CrossRef]
- Dietze, M.C.; Sala, A.; Carbone, M.S.; Czimczik, C.I.; Mantooth, J.A.; Richardson, A.D.; Vargas, R. Nonstructural carbon in woody plants. Annu. Rev. Plant Biol. 2014, 65, 667–687. [Google Scholar] [CrossRef]
- Sala, A.; Woodruff, D.R.; Meinzer, F.C. Carbon dynamics in trees: Feast or famine? Tree Physiol. 2012, 32, 764–775. [Google Scholar] [CrossRef]
- Zrenner, R.; Stitt, M. Comparison of the effect of rapidly and gradually developing water-stress on carbohydrate metabolism in spinach leaves. Plant Cell Environ. 1991, 14, 939–946. [Google Scholar] [CrossRef]
- Zou, C.; Sun, K.; Mackaluso, J.D.; Seddon, A.E.; Jin, R.; Thomashow, M.F.; Shiu, S.H. Cis-regulatory code of stress-responsive transcription in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2011, 108, 14992–14997. [Google Scholar] [CrossRef]
- Shen, Q.; Ho, T.H. Functional dissection of an abscisic acid (ABA)-inducible gene reveals two independent ABA-responsive complexes each containing a G-box and a novel cis-acting element. Plant Cell 1995, 7, 295–307. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Lin, Y.J.; Wang, P.; Zhang, B.; Li, M.; Chen, S.; Shi, R.; Tunlaya-Anukit, S.; Liu, X.; Wang, Z.; et al. The AREB1 Transcription Factor Influences Histone Acetylation to Regulate Drought Responses and Tolerance in Populus trichocarpa. Plant Cell 2019, 31, 663–686. [Google Scholar] [CrossRef] [PubMed]
- Mediavilla, S.; Martin, I.; Escudero, A. Vein and stomatal traits in leaves of three co-occurring Quercus species differing in leaf life span. Eur. J. For. Res. 2020, 139, 829–840. [Google Scholar] [CrossRef]
- Picotte, J.J.; Rosenthal, D.M.; Rhode, J.M.; Cruzan, M.B. Plastic responses to temporal variation in moisture availability: Consequences for water use efficiency and plant performance. Oecologia 2007, 153, 821–832. [Google Scholar] [CrossRef] [PubMed]
- Ackerly, K. Evolution and Plasticity of Photosynthetic Thermal Tolerance, Specific Leaf Area and Leaf Size: Congeneric Species from Desert and Coastal Environments. New Phytol. 2003, 160, 337–347. [Google Scholar] [CrossRef]
- Field, C.; Merino, J.; Mooney, H.A. Compromises between water-use efficiency and nitrogen-use efficiency in five species of California evergreens. Oecologia 1983, 60, 384–389. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Li, F.; Li, D.; Zhang, H.; Huang, R. Expression of ethylene response factor JERF1 in rice improves tolerance to drought. Planta 2010, 232, 765–774. [Google Scholar] [CrossRef]
- Nie, J.; Wen, C.; Xi, L.; Lv, S.; Zhao, Q.; Kou, Y.; Ma, N.; Zhao, L.; Zhou, X. The AP2/ERF transcription factor CmERF053 of chrysanthemum positively regulates shoot branching, lateral root, and drought tolerance. Plant Cell Rep. 2018, 37, 1049–1060. [Google Scholar] [CrossRef]
- Gill, S.S.; Anjum, N.A.; Hasanuzzaman, M.; Gill, R.; Trivedi, D.K.; Ahmad, I.; Pereira, E.; Tuteja, N. Glutathione and glutathione reductase: A boon in disguise for plant abiotic stress defense operations. Plant Physiol. Biochem. 2013, 70, 204–212. [Google Scholar] [CrossRef]
- Singh Sarlach, R.; Kaur, A. Leaf Area, Relative Water Content and Stay-green Habit of Iranian Landraces (Triticum aestivum L.) under Water Stress in Field Conditions. Adv. Res. 2020, 21, 1–13. [Google Scholar] [CrossRef]
- Taur, D.J.; Patil, R.Y. Evaluation of antiasthmatic activity of Clitoria ternatea L. roots. J. Ethnopharmacol. 2011, 136, 374–376. [Google Scholar] [CrossRef]
- Gong, A.; Wu, W.; Qiu, Z.; Yong, H. Leaf Area Measurement Using Android OS Mobile Phone. Nongye Jixie Xuebao/Trans. Chin. Soc. Agric. Mach. 2013, 44, 203–208. [Google Scholar] [CrossRef]
- Ma, X.C.; Sanguinet, K.A.; Jacoby, P.W. Direct root-zone irrigation outperforms surface drip irrigation for grape yield and crop water use efficiency while restricting root growth. Agric. Water Manag. 2020, 231, 105993. [Google Scholar] [CrossRef]
- Silla, F.; Gonzalez-Gil, A.; Gonzalez-Molina, M.E.; Mediavilla, S.; Escudero, A. Estimation of chlorophyll in Quercus leaves using a portable chlorophyll meter: Effects of species and leaf age. Ann. For. Sci. 2010, 67, 92–113. [Google Scholar] [CrossRef]
- Wang, W.N.; Wang, S.Y.; Hoch, G.; Wang, Y.; Gao, G.Q.; Gu, J.C.; Xu, H.W. Whole-Tree Response of Non-Structural Carbohydrates, Carbon and Nitrogen Concentrations in Two Temperate Tree Species to 10-Year Nitrogen Fertilization. Forests 2022, 13, 302. [Google Scholar] [CrossRef]
- Mohammed, A.N.A.; Sankar, A.S. Root growth, malonyldialdehyde content and antioxidant enzyme activities in response to low phosphorus supply in rice (Oryza sativa L.) genotypes. Res. Crops 2014, 15, 746–753. [Google Scholar] [CrossRef]
Gene_ID | Forward and Reverse Primers (5′-3′) | Gene Function Annotation |
---|---|---|
Potri.001G070900 | TCTGAGGACAGTTCGGACACAG GTGAACCGCCACAGAATCGTCAC | Response to oxidative stress; peroxidase activity |
Potri.001G084000 | GGCTGAAACCAAGAACCAACAGG GGCAAGCCTGTAGACAACATTG | Cysteine and methionine metabolism; amino acid transport and metabolism |
Potri.002G013200 | CCAAGACCAGTGCTGGTGAAGAG CAGTCGGAGGAGGAACCTCTTCAG | Response to abscisic acid |
Potri.008G065600 | ATGGAGGGCAAAGAAGAAGATG CCATGAAGTCAGTTCGCCTGGCTC | Mediate rapid entry or exit of water in response to abrupt changes in osmolarity; carbohydrate transport and metabolism |
Potri.018G063300 | CTCTGCCTAACCACTCTCTACC CTTGAGGCCATAGAACTGTGACCG | Response to oxidative stress; peroxidase activity |
Potri.005G195600 | GGCCAGAGCTGCTATGTCCTTTAC CCATTCTCTATAGGGATGGTGCC | Response to oxidative stress; peroxidase activity |
POD2 (Potri.016G132700) | CAGGCTGCTTTCAGGACAGACTTTG GATCTGGCCATTTGTGCCAGTAAGTG | Response to oxidative stress; peroxidase activity; oxidation-reduction process |
POD3 (Potri.007G053400) | GACTCCAGAATAGCCATCAACATGG GGCTTGTTGAAAGGCCTGTGAGTC | Response to oxidative stress; peroxidase activity |
SOD2 (Potri.009G005100) | CTAATGTTGAAGGCGTCGTC ACGCATCCATTTGTTGTGTC | Response to oxidative stress; superoxide dismutase activity |
ERF194 | ATGGTGAGAGAAAGAAGGGAGC TCATTAAACTGTCCACACACCAGG | |
Actin | ACCCTCCAATCCAGACACTG TTGCTGACCGTATGAGCAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huan, X.; Wang, X.; Zou, S.; Zhao, K.; Han, Y.; Wang, S. Transcription Factor ERF194 Modulates the Stress-Related Physiology to Enhance Drought Tolerance of Poplar. Int. J. Mol. Sci. 2023, 24, 788. https://doi.org/10.3390/ijms24010788
Huan X, Wang X, Zou S, Zhao K, Han Y, Wang S. Transcription Factor ERF194 Modulates the Stress-Related Physiology to Enhance Drought Tolerance of Poplar. International Journal of Molecular Sciences. 2023; 24(1):788. https://doi.org/10.3390/ijms24010788
Chicago/Turabian StyleHuan, Xuhui, Xingqi Wang, Shengqiang Zou, Kai Zhao, Youzhi Han, and Shengji Wang. 2023. "Transcription Factor ERF194 Modulates the Stress-Related Physiology to Enhance Drought Tolerance of Poplar" International Journal of Molecular Sciences 24, no. 1: 788. https://doi.org/10.3390/ijms24010788
APA StyleHuan, X., Wang, X., Zou, S., Zhao, K., Han, Y., & Wang, S. (2023). Transcription Factor ERF194 Modulates the Stress-Related Physiology to Enhance Drought Tolerance of Poplar. International Journal of Molecular Sciences, 24(1), 788. https://doi.org/10.3390/ijms24010788