Next Article in Journal
p53 Family in Resistance to Targeted Therapy of Melanoma
Next Article in Special Issue
Far-Red-Light-Induced Morphology Changes, Phytohormone, and Transcriptome Reprogramming of Chinese Kale (Brassica alboglabra Bailey)
Previous Article in Journal
A Review of Oil–Solid Separation and Oil–Water Separation in Unconventional Heavy Oil Production Process
Previous Article in Special Issue
Light Dependent Changes in Adenylate Methylation of the Promoter of the Mitochondrial Citrate Synthase Gene in Maize (Zea mays L.) Leaves
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Light-Dependent Nitrate Removal Capacity of Green Microalgae

1
Institute of Plant Biology, Biological Research Centre, 6726 Szeged, Hungary
2
Faculty of Science and Informatics, University of Szeged, 6720 Szeged, Hungary
3
Department of Water Sciences, University of Public Service, 6500 Baja, Hungary
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(1), 77; https://doi.org/10.3390/ijms24010077
Submission received: 29 November 2022 / Revised: 13 December 2022 / Accepted: 16 December 2022 / Published: 21 December 2022
(This article belongs to the Special Issue Light-Dependent Control of Metabolism in Plants)

Abstract

In the present study, Chlamydomonas sp. MACC-216 was used to investigate total nitrate removal in TAP medium with sodium nitrate as the sole nitrogen source under several light conditions made up of permuted combinations of three light colors (referred to as blue, red, and white light) and three light intensities (50 µmol m−2 s−1, 100 µmol m−2 s−1, and 250 µmol m−2 s−1). It was observed that nitrate removal efficiency is influenced by light color as well as light intensity. Additionally, Chlamydomonas sp. MACC-216 was cultivated in synthetic wastewater under four light conditions, namely, Blue 250, Blue 125 + Red 125, Red 250, and White 250, where it showed the highest nitrate removal efficiency and nitrate reductase activity under the Blue 125 + Red 125 light condition. To observe the impact of light color on the nitrate removal capacity of Chlamydomonas sp. MACC-216, the expression of five genes participating in nitrate transport and reduction (NRT1, NRT2.1, NRT2.2, NIA, and MCP) was also analyzed; these genes showed the highest expression under the Blue 125 + Red 125 light condition. Based on the above-mentioned findings, the blue + red light combination emerged as a promising light combination for nitrate removal. Hence, our study suggests the importance of the blue + red light combination together with high light intensity, as the optimal light condition for nitrate removal from synthetic wastewater in comparison to other monochromatic lights with high light intensity.

1. Introduction

With the increasing global population, there is a surge in industrialization which is responsible for releasing various gaseous, solid, and liquid wastes into the environment. Rising levels of nitrogen and phosphorus in water bodies have been associated with major environmental problems in multiple countries. Nitrate, nitrite, and ammonia represent the main forms of inorganic nitrogen. Nitrite and ammonia are unstable, while nitrate is highly stable making nitrate one of the most common chemical contaminants in water bodies [1]. Nitrate contamination through industrial and domestic wastewater causes harmful algal blooms and rapid eutrophication of natural water ecosystems. Biological methods for wastewater treatment are much more environment-friendly in comparison to physico-chemical decontamination methods [2,3]. Among biological methods, the application of microalgae has emerged as a promising approach for wastewater treatment over the years [4,5,6,7]. Microalgae are capable of utilizing inorganic nutrients such as nitrogen and phosphorus from wastewater as they need them for their photosynthetic/photoheterotrophic/fermentative growth.
The ability of microalgae to grow and propagate in wastewater can be influenced by multiple factors including nutrient concentration, light conditions, pH, temperature, salinity, etc. Light has an essential role in the life cycle of cyanobacteria, algae, and higher plants; the color or wavelength of the light strongly influences their growth [8,9]. Light is essential to microalgae as it helps in the synthesis of vital molecules for growth by the production of ATP and NADPH. Microalgae utilize light for photosynthesis, with photosynthetic light wavelengths ranging from 400 nm to 700 nm. Photosynthetic pigments chlorophyll-a and chlorophyll-b have two major absorption bands: blue or blue-green (450–475 nm) and red (630–675 nm) [10]. Carotenoids represent a group of biological chromophores that play an important role in photosynthesis and have an absorption range between 400 and 550 nm [10]. As absorption bands of photosynthetic pigments lie in the blue and red range of visible light, numerous studies have been carried out to characterize the effects of these two colors on microalgal growth. Several studies have reported the positive effect of red or blue light or both on the biomass yields of Nannochloropsis sp., Scenedesmus sp., and Chlamydomonas reinhardtii [11,12,13]. Biomass productivity of green microalgae has been shown to increase when they are exposed to blue light [11,14,15], whereas other studies have shown a higher growth rate under red light in comparison to blue light [16,17]. In one of the studies, a blue light: red light ratio of 7:3 showed a higher nitrogen removal rate in comparison to solely white, red or blue light in Scenedesmus sp. [12]. Most of the studies have focused solely on red or blue light but not their combination, which is why there is still data scarcity on the effect of this particular light combination on various parameters in algae.
Similar to light color, light intensity is another factor that has been shown to play a role in the life cycle of microalgae. Microalgae grown under various light intensities showed differences in growth rate and nutrient removal rate [18,19,20,21]. High light intensity can cause photoinhibition, whereas low light intensity might lead to slow growth; therefore, studies have investigated the optimal light intensity at which maximum growth of the specific microalgae can be achieved. Maltsev et al. indicated that light intensity values are optimal between 26–400 µmol m−2 s−1 as the maximum growth rate has been observed for different species of microalgae in this light intensity range [9]. Certain algal species such as Chlamydomonas reinhardtii cc124 and Chlorella ohadii can resist photoinhibition and were shown to grow at light intensities of 3000 µmol m−2 s−1 and 3500 µmol m−2 s−1, respectively [22,23]. In the case of nutrient removal, Chlorella vulgaris showed an increasing trend in total nitrogen and total phosphorus removal efficiency when the light intensity was increased from 400 µmol m−2 s−1 to 2000 µmol m−2 s−1 [24].
The aim behind the present study was to observe whether various light colors and intensities would affect the nitrate removal efficiency of Chlamydomonas sp. MACC-216. The specific goal was to determine optimal light color and intensity for efficient nitrate removal by Chlamydomonas sp. MACC-216 as this microalga proved in our previous study to be a promising candidate for nitrate removal [25]. The present study investigated the influence of combinations of various light colors and intensities on the nitrate removal efficiency of Chlamydomonas sp. MACC-216 grown in tris-acetate-phosphate medium with sodium nitrate as the sole nitrogen source (TAP-N) and synthetic wastewater (SWW). Various light conditions made up of combinations of three light colors (blue, red, and white) and three light intensities (50 µmol m−2 s−1, 100 µmol m−2 s−1, and 250 µmol m−2 s−1) were used to cultivate Chlamydomonas sp. MACC-216. Chlamydomonas sp. MACC-216 was first grown under each light condition to check for growth and nitrate removal efficiency in TAP-N and then the most efficient light conditions showing maximum growth and nitrate removal capacity were selected for further experiments in SWW. In SWW, Chlamydomonas sp. MACC-216 was grown under four different light conditions, namely, Blue 250, Blue 125 + Red 125, Red 250, and White 250, where the numbers 250 and 125 define light intensity in µmol m−2 s−1. Under the aforementioned four light conditions, various parameters such as growth, nitrate removal efficiency, nitrate reductase activity and expression of genes involved in nitrate transport and reduction were investigated in Chlamydomonas sp. MACC-216.

2. Results

2.1. Effect of Various Light Conditions on the Growth of Chlamydomonas sp. MACC-216

The growth of Chlamydomonas sp. MACC-216 was mainly influenced by the light intensity in TAP-N5 (TAP with 5 mM nitrate) and TAP-N10 media (TAP with 10 mM nitrate) (Figure 1). At 50 µmol m−2 s−1 light intensity, Chlamydomonas sp. MACC-216 grew slower in comparison to 100 µmol m−2 s−1 or 250 µmol m−2 s−1 light intensity. It was also observed that up to 250 µmol m−2 s−1, Chlamydomonas sp. MACC-216 growth is directly proportional to light intensity as an increase in the microalgal growth was observed when light intensity was increased from 50 µmol m−2 s−1 to 250 µmol m−2 s−1. However, no major difference was observed between the growth curves of Chlamydomonas sp. MACC-216 grown in TAP-N5 and in TAP-N10 media at any light condition.

2.2. Effect of Various Light Conditions on the Nitrate Removal Capacity of Chlamydomonas sp. MACC-216

Chlamydomonas sp. MACC-216 grown under TAP-N5 medium showed the highest nitrate removal efficiency under Blue 25 + Red 25 and Red 50 light conditions at 50 µmol m−2 s−1 light intensity (Figure 2). Least nitrate removal efficiency was observed in the case of the White 50 light condition. Furthermore, nitrate removal efficiency was increased when the light intensity was increased from 50 µmol m−2 s−1 to 100 µmol m−2 s−1. However, when light intensity was increased to either 100 µmol m−2 s−1 or 250 µmol m−2 s−1, no significant difference in nitrate removal efficiency was observed among various light conditions. When Chlamydomonas sp. MACC-216 was cultivated in TAP-N10 medium at 50 µmol m−2 s−1 light intensity, no significant difference in nitrate removal efficiency was observed among the various light conditions (Blue 50, Blue 25 + Red 25, Red 50, and White 50). An increase in the light intensity from 50 µmol m−2 s−1 to 250 µmol m−2 s−1 led to significantly higher nitrate removal efficiency. Thus, Chlamydomonas sp. MACC-216 grown under Blue 250 removed more nitrate than Chlamydomonas sp. MACC-216 grown under Blue 50 and so on. A clear role of light intensity was observed in total nitrate removal as higher nitrate removal efficiency was observed at higher light intensity. Moreover, Chlamydomonas sp. MACC-216 cultivated in TAP-N10 medium under Blue 125 + Red 125 showed the highest significant nitrate removal efficiency in comparison to any other light condition. Chlamydomonas sp. MACC-216 removed 9.64 mM nitrate when grown under Blue 125 + Red 125 light condition (Table S1). At 250 µmol m−2 s−1 light intensity, the least nitrate removal efficiency was observed under Blue 250 light condition.

2.3. Growth, Nitrate Removal Efficiency and Nitrate Reductase Activity in SWW

For experiments to be carried out in SWW, 250 µmol m−2 s−1 light intensity was chosen because Chlamydomonas sp. MACC-216 showed the highest growth and nitrate removal efficiency in TAP-N5 and TAP-N10 media at this light intensity. No significant difference was observed among the growth curves of Chlamydomonas sp. MACC-216 grown under Blue 250, Blue 125 + Red 125, Red 250, and White 250 light conditions (Figure 3a). However, Chlamydomonas sp. MACC-216 showed slower growth in SWW (Figure 3a) in comparison to TAP-N5 and TAP-N10 media (Figure 1) at 250 µmol m−2 s−1 light intensity. Even in SWW, Chlamydomonas sp. MACC-216 showed highest nitrate removal efficiency under Blue 125 + Red 125 light condition (Figure 3b). Chlamydomonas sp. MACC-216 grown under Blue 125 + Red 125 light condition removed 4.22 mM nitrate, whereas Chlamydomonas sp. MACC-216 grown under Red 250 and White 250 light conditions removed 3.67 mM and 3.60 mM, respectively (Table S2). Chlamydomonas sp. MACC-216 grown under the Blue 250 light condition removed the least nitrate (3.51 mM).
Nitrate reductase activity of Chlamydomonas sp. MACC-216 was quantified to investigate the influence of various light conditions on this enzyme activity. We observed that Chlamydomonas sp. MACC-216 grown under Blue 125 + Red 125 light had significantly the highest nitrate reductase activity in comparison to any other light conditions used in the study (Figure 3c). Nitrate reductase of Chlamydomonas sp. MACC-216 grown under Blue + Red 125 light condition produced 31.09 µmol g−1 of FW (fresh weight) min−1 NO2, whereas Chlamydomonas sp. MACC-216 grown under Blue 250, Red 250, and White 250 light conditions produced 18.47, 28.41 and 25.4 µmol g−1 of FW min−1 NO2, respectively (Table S2).

2.4. Expression of Genes Involved in Nitrate Transport and Reduction

The expression of genes participating in nitrate transport and reduction in Chlamydomonas sp. MACC-216 was investigated. Five genes were selected namely, NRT1, NRT2.1, NRT2.2, NIA, and MCP where NRT1, NRT2.1, NRT2.2 code for nitrate and/or nitrite transporters, NIA codes for nitrate reductase, and MCP codes for Moco (Molybdenum cofactor) carrier protein. Expression of NRT1, NRT2.1, NRT2.2, NIA, and MCP was significantly higher in Chlamydomonas MACC-216 grown under the Blue 125 + Red 125 light condition (Figure 4 and Table S3). After the Blue 125 + Red 125 light condition, NRT1, NRT2.1, NRT2.2, NIA, and MCP genes showed high expression under the Red 250 light condition.

2.5. Growth and Nitrate Removal Efficiency of Chlorella sp. MACC-38 and Chlorella sp. MACC-360 in SWW

Chlorella sp. MACC-38 and Chlorella sp. MACC-360 were grown in SWW under Blue 250, Blue 125 + Red 125, Red 250, and White 250 light conditions to check whether these two microalgae would also perform like Chlamydomonas sp. MACC-216 in SWW. No major difference was observed among the growth curves of Chlorella sp. MACC-38 grown under various light conditions (Figure 5a), whereas Chlorella sp. MACC-360 grew better under the Blue 125 + Red 125 light condition in comparison to other light conditions (Figure 5b). Significant high nitrate removal efficiency was observed under Blue 125 + Red 125 light condition in Chlorella sp. MACC-360 only (Figure 5c,d). Even under Blue 125 + Red 125 light condition, both microalgae removed less nitrate in comparison to Chlamydomonas sp. MACC-216. Chlorella sp. MACC-38 and Chlorella sp. MACC-360 removed 1.67 mM and 1.37 mM nitrate, respectively, whereas Chlamydomonas sp. MACC-216 removed 4.22 mM nitrate under the same light conditions (Tables S2 and S4). Both microalgae removed the least nitrate under Red 250 and White 250 light conditions.

3. Discussion

The present investigation was undertaken to elucidate the effects of combinations of various light colors (blue, red, and white) and intensities (50 µmol m−2 s−1, 100 µmol m−2 s−1, and 250 µmol m−2 s−1) on the nitrate removal capacity of Chlamydomonas sp. MACC-216. Since the light spectrum has been known to affect microalgae, we decided to check its effect on the total nitrate removal by microalgae. Additionally, we also wanted to study whether the combination of blue and red light will enhance the growth and nitrate removal efficiency of Chlamydomonas sp. MACC-216 as absorption bands of photosynthetic pigments lie in the blue and red range of visible light. So far, numerous studies have shown the effects of different light colors or wavelengths and intensities on the growth of various microalgae [11,12,19,21,26]; however, only a few studies have utilized a blue + red light color combination [12,27]. When cultivated in TAP-N5 and TAP-N10 media, the growth of Chlamydomonas sp. MACC-216 only seemed to be influenced by light intensity as it increased with increasing light intensity, where the maximum light intensity used was 250 µmol m−2 s−1 (Figure 1). Similarly, a continuous increase in the growth of Chlorella sp. 800 has been reported with increasing light intensity until 500 µmol m−2 s−1 [18]. Light intensity has been known to play a major role in the lifecycle of microalgae by affecting the photosynthesis of microalgae and consequently their growth. In general, the light intensity can increase the growth rate of microalgae if it is increased up to a certain point, which depends on specific microalgae species. Too high a light intensity can lead to photoinhibition whereas too low a light intensity can lead to a decrease in the growth of the microalgae. In the case of nitrate removal efficiency, we observed that this variable was affected by light color, light intensity, and concentration of nitrate. At 5 mM nitrate concentration, we did not see any major significance in nitrate removal under various light conditions (Figure 2). However, at 10 mM nitrate concentration, Chlamydomonas sp. MACC-216 removed the highest amount of nitrate under the Blue 125 + Red 125 light condition (Table S1). Our findings of high nitrate removal under blue + red light are consistent with the study of Kim et al., where Scenedesmus sp. has been shown to remove nitrate at a higher rate when grown under blue + red light combination in comparison to solely blue, red, and white light [12]. Moreover, Chlamydomonas sp. MACC-216 showed increased nitrate removal efficiency in TAP-N5 and TAP-N10 media with increasing light intensity (Figure 2). Chlamydomonas reinhardtii strain 21 gr demonstrated high nitrate removal when the light intensity was increased from 400 µmol m−2 s−1 to 1000 µmol m−2 s−1, which is consistent with our observations [28]. High nitrate removal at high light intensity may be due to the increased demand for nitrogen in algae to repair light-induced damage in photosystems caused by high light intensity. Furthermore, we decided to use continuous light for our study as previous studies have confirmed better growth and nitrate removal under continuous light [29,30]. In one study, Chlorella kessleri under continuous illumination and 12 h:12 h (Light:Dark) lighting showed nitrate removal efficiency of 19% and 9%, respectively [29]. The same study also showed higher cell concentrations under continuous illumination in comparison to 12 h:12 h (Light:Dark) lighting. Similarly, in another study, an increase in algal biomass of a mixed algae culture (Chlamydomonas reinhardtii, Scenedesmus rubescens, and Chlorella vulgaris) was observed under continuous illumination in contrast to 12 h:12 h (Light:Dark) lighting [30]. The decrease in cell biomass observed under the 12 h:12 h (Light:Dark) condition could be caused by biomass loss through respiration [29].
Chlamydomonas sp. MACC-216 grown in SWW under Blue 250, Blue 125 + Red 125, Red 250, and White 250 light conditions showed slower growth and lower nitrate removal efficiency in comparison to Chlamydomonas sp. MACC-216 grown in TAP-N5 and TAP-N10 media. Chlamydomonas sp. MACC-216 cultivated in SWW under Blue 125 + Red 125 showed the highest nitrate removal efficiency in comparison to any other light condition (Figure 3b). A similar observation was noticed for Chlorella sp. MACC-38 and Chlorella sp. MACC-360 (Figure 5c,d). The high nitrate reductase activity of the Chlamydomonas sp. MACC-216 grown under the Blue 125 + Red 125 light condition correlated with its high nitrate removal efficiency in SWW (Figure 3b,c). Likewise, low nitrate reductase activity of the Chlamydomonas sp. MACC-216 grown under the Blue 250 light condition correlated with its low nitrate removal efficiency under the Blue 250 light condition. In some higher plants such as etiolated pea and tissues of maize, light-stimulated de novo synthesis of nitrate reductase was shown to be caused by red light via the phytochrome system [31]. The pigment phytochrome is known to be photoconverted from inactive Pr (red light absorbing phytochrome) to physiologically active Pfr (far-red-light absorbing phytochrome) by red light [31,32]. Figueroa suggested the presence of two types of receptors in red algae Corallina elongate, namely phytochrome and b-light receptor for red and blue light colors, respectively [33]. Aparicio and Quiñones showed the importance of blue + red light through their study on Monoraphidium braunii [34]. They observed that when M. braunii cells were grown under only red light, the nitrate uptake was slower in comparison to when grown under red + blue light continuously and red + intermittent blue light. Moreover, it has been shown that blue light is necessary for in vivo activation of inactive nitrate reductase in Chlamydomonas reinhardtii [35]. To conclude, perhaps red light is required for the biosynthesis of nitrate reductase and blue light is probably needed for nitrate uptake and activation of the nitrate reductase enzyme. This might be the reason behind the high nitrate removal efficiency and nitrate reductase activity under the Blue 125 + Red 125 light condition in our study.
To investigate whether different light conditions are modulating the transcription of genes involved in nitrate uptake and reduction, the expression of five genes, namely NRT1, NRT2.1, NRT2.2, NIA, and MCP was investigated by quantitative reverse transcription polymerase chain reaction (RT-qPCR). NRT1, NRT2.1, and NRT2.2 code for nitrate and/or nitrite transporters, NIA codes for nitrate reductase, and MCP codes for Moco (Molybdenum cofactor) carrier protein. Three families of transporters namely, NRT1, NRT2, and NAR1 have been shown to play a role in the nitrate and/or nitrite transport in Chlamydomonas [36,37]. Transporters NRT1, NRT2, and NAR1 consist of one, six and six transporters, respectively [36]. The NRT1 transporter encoded by a single NRT1 gene in Chlamydomonas belongs to the nitrate peptide transporter family (NPF) [37,38]. NRT1 transporter is well studied in Arabidopsis as a dual affinity nitrate transporter, but there is a lack of information about this transporter in Chlamydomonas [34,35]. NRT2 transporters belong to the nitrate/nitrite porter (NNP) family which further belongs to the major facilitator superfamily (MFS) [37]. Six genes (NRT2.1-6) code for the transporters in the NRT2 transporters family in Chlamydomonas [36]. Both NRT2.1 and NRT2.2 transporters need NAR2 protein to be fully functional; thus, NRT2.1 together with NAR2 makes transporter system I bi-specific for nitrate and nitrite, while NRT2.2 together with NAR2 makes nitrate specific transporter system II [36,37]. Other transporters (NRT2.3-6) in the NRT2 family are low-affinity nitrate transporters [36,39]. NAR1 transporters only play a role in nitrite and bicarbonate transportation; hence, we decided to choose NRT1, NRT2.1 and NRT2.2 genes from nitrate/nitrite transporter families for expression study as these three seem to play the role of the main nitrate transporters. We observed the highest expression of all these three genes under the Blue 125 + Red 125 light condition in comparison to other light conditions (Figure 4). This high expression correlates with high nitrate reductase activity and high nitrate removal as observed from our above-mentioned results. Therefore, it is clear from our study that light color affects the transport of nitrate and thereby increases or decreases the expression of genes encoding nitrate transporters in the algae.
Nitrate reductase coded by the NIA gene plays a role in the reduction of nitrate to nitrite in the cytoplasm. Chlamydomonas algae have a single gene encoding nitrate reductase in their genome [36,37]. In eukaryotes, nitrate reductase is known to be a homodimeric protein consisting of 100–120 kDa subunits and each subunit contains five structurally distinct domains: molybdenum-molybdoprotein (Mo-MPT), dimer interface, cytochrome-b, FAD binding domain and NADPH binding domain [40]. Moco carrier protein (MCP) encoded by the MCP gene is known to play a role in the biosynthesis and transfer of the molybdenum cofactor to the nitrate reductase which is necessary for the enzyme to function [36,41]. Similar to the nitrate transporters, the expression of NIA and MCP was also found to be light color dependent as both genes were highly expressed under the Blue 125 + Red 125 light condition in comparison to other light conditions (Figure 4).
Although the growth curves of Chlamydomonas MACC-216 grown under various light conditions showed no major difference, Chlamydomonas MACC-216 grown under the Blue 125 + Red 125 light condition showed the highest nitrate removal efficiency and the highest expression of genes involved in nitrate transport and reduction. This non-correlation between the growth and expression of different genes under various light conditions could be due to the regulation of gene expression at the translational or post-translational level in Chlamydomonas MACC-216.
The present study confirmed the greater role of the Blue 125 + Red 125 light condition in nitrate removal at the gene expression level. Although in the present study, Chlamydomonas sp. MACC-216 was cultivated in SWW under the above-mentioned light condition, the next step could be to use this light condition to perform total nitrogen and phosphorus removal studies in real wastewater collected from various industrial plants. Furthermore, transcriptome studies could be performed for Chlamydomonas sp. MACC-216 grown under the Blue 125 + Red 125 light condition. This analysis would be useful to observe the detailed transcriptional reorganization taking place inside Chlamydomonas sp. MACC-216 under the Blue 125 + Red 125 light condition which can pave the way for a better understanding of this condition affecting microalgae.

4. Materials and Methods

4.1. Microalga Strain and Growth Media

Chlamydomonas sp. MACC-216 strain used for the current research study was provided by the Mosonmagyaróvár Algae Culture Collection (MACC) and was initially maintained in TAP medium consisting of 2.42 g L−1 Tris base, 0.374 g L−1 NH4Cl, 0.204 g L−1 MgSO4·7H2O, 0.066 g L−1 CaCl2·2H2O, 0.287 g L−1 K2HPO4, 0.142 g L−1 KH2PO4, 0.049 g L−1 Na2EDTA·2H2O, 0.039 g L−1 ZnSO4·7H2O, 0.011 g L−1 H3BO3, 0.007 g L−1 MnCl2·4H2O, 0.008 g L−1 FeSO4·7H2O, 0.002 g L−1 CoCl2·6H2O, 0.002 g L−1 CuSO4·5H2O, 0.001 g L−1 (NH4)6Mo7O24·4H2O, and 1 mL L−1 CH3COOH with pH maintained at 7. The final concentration of CH3COOH in TAP medium was 16.8 mM. The microalga was maintained at 25 °C under white light with a light intensity of 50 µmol m−2 s−1 with continuous shaking at 180 rpm in a regime of 16:8 light-dark periods.
For further experiments, a modified TAP medium (TAP-N) was prepared by substituting different concentrations of sodium nitrate as the nitrogen source instead of ammonium chloride. TAP-N5 and TAP-N10 media were prepared by adding 5 mM (424.97 mg L−1), and 10 mM (849.94 mg L−1), respectively, of sodium nitrate. In addition, 0.001 g L−1 (NH4)6Mo7O24·4H2O was replaced with 0.006 g L−1 of Na2MoO4·2H2O in TAP-N medium so that there is no other nitrogen source other than sodium nitrate.
Synthetic wastewater (SWW) used in the present study was prepared according to the procedure mentioned in “OECD guidelines for testing chemicals” after slight modifications [42]. To 1 L of distilled water, 1.6 g peptone, 1.1 g meat extract, 0.425 g NaNO3 (5 mM), 0.07 g NaCl, 0.04 g CaCl2·2H2O, 0.02 g MgSO4·7H2O, and 0.28 g K2HPO4 were added, and the pH was set at 7.5.

4.2. Growth Conditions and Measurement

Chlamydomonas sp. MACC-216 was grown in TAP-N5 and TAP-N10 media under various combinations of light colors (or wavelengths) and light intensities. In total, 12 light conditions made up of combinations of three light colors (blue, red, and white) and three light intensities (50 µmol m−2 s−1, 100 µmol m−2 s−1, and 250 µmol m−2 s−1) were selected to cultivate Chlamydomonas sp. MACC-216 (Table 1). Chlamydomonas sp. MACC-216 was grown under each light condition in Multi-Cultivator MC-1000-OD (Photon Systems Instruments) with a continuous light source for 70 h. The absorbance was automatically measured at 720 nm at a gap of 10 h each.
For SWW, only four light conditions were selected namely, Blue 250, Blue 125 + Red 125, Red 250, and White 250 (Table 1) and the absorbance was measured at 720 nm similarly as mentioned above. Furthermore, Chlorella sp. MACC-38 and Chlorella sp. MACC-360 were also grown under the above-mentioned conditions to examine their growth and nitrate removal capacity in SWW.

4.3. Nitrate Measurement

Nitrate estimation was performed at 0 h and 70 h using the salicylic acid method [43]. Briefly, to 10 µL of each sample, 40 µL of 5% (w/v) salicylic acid in concentrated H2SO4 was added. Samples were kept at room temperature for 30 min and then 950 µL of 8% (w/v) NaOH in water was added followed by cooling down of samples to room temperature. The absorbance was determined at 410 nm using a Hidex microplate reader.
The nitrate removal efficiency was calculated using the following equation:
R = ( 1 C f C i ) × 100
where R is the nitrate removal efficiency (%), Ci and Cf are the initial and final concentrations of nitrate (mM) in the growth medium.

4.4. Nitrate Reductase Activity

For nitrate reductase activity, Chlamydomonas sp. MACC-216 was grown for 48 h under Blue 250, Blue 125 + Red 125, Red, and White 250 light conditions in SWW. After 48 h, 10 mL of culture was collected from each light condition and centrifuged at 4000 rpm for 5 min at 4 °C. Afterwards, supernatants were discarded, and pellets were dissolved in ice-cold 0.1 M phosphate buffer (pH 7.0) followed by sonication at 0.8 cycle, 90% amplitude for 30 s on ice. After sonication, centrifugation was performed at 17,000 rpm for 10 min at 4 °C and supernatants were collected. In a fresh microcentrifuge, to 400 µL of supernatant, 500 µL of 10 mM KNO3, 40 µL of 5mM β-Nicotinamide adenine dinucleotide, reduced disodium salt hydrate (Sigma-Aldrich, St. Louis, MO, USA) and 60 µL of Milli-Q water were added followed by incubation at 25 °C for 30 min. Afterwards, 500 µL of 10 mM zinc acetate was added to stop the reaction followed by centrifugation at 10,000 rpm for 5 min. The supernatant was collected for nitrite estimation by Griess reagent assay as described by Giovannoni et al. [44]. For the Griess reagent, two solutions were prepared namely, 1% (w/v) sulphanilamide (Sigma-Aldrich, St. Louis, MO, USA) in 5% (v/v) phosphoric acid and 0.1% (w/v) N-(1-naphthyl)ethylenediamine dihydrochloride (NED) (Sigma-Aldrich, St. Louis, MO, USA) in water. Both solutions are stable for several months at 4 °C in darkness. To 100 µL of supernatant, first, 100 µL sulphanilamide solution was added followed by incubation at room temperature for 10 min. Then, 100 µL of NED solution was added followed by further incubation at room temperature for 10 min. After incubation, absorbance was measured at 540 nm in a Hidex microplate reader.

4.5. Quantification of Genes Expression

For RNA isolation, Chlamydomonas sp. MACC-216 was grown for 70 h under Blue 250, Blue 125 + Red 125, Red 250, and White 250 light conditions in SWW. 1 mL of microalgae sample was collected from each light condition for RNA isolation. RNA isolation was performed using TRIzolTM reagent (Thermo Fisher Scientific, Waltham, MA, USA) by following manual instructions. cDNA was prepared from isolated RNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA) by following manual instructions.
To perform quantitative reverse transcription polymerase chain reaction (RT-qPCR), first primers were designed for two reference genes (GAPDH and beta 1 tubulin) and five genes involved in nitrate transportation and reduction (Table 2). Accession numbers for these genes were obtained from Fernandez and Galvan and Sanz-Luque et al. [36,37] and sequences were obtained from the NCBI database (https://www.ncbi.nlm.nih.gov/). RT-qPCR was performed with 50 ng of cDNA, 500 nM each of forward and reverse primer, 5 µL of SYBR green PCR master mix (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) and nuclease-free water to a final concentration of 10 µL.
Analysis of the results obtained by RT-qPCR was undertaken using Pfaffl method [45]. For this, primer efficiency was calculated for all primer pairs. White 250 light condition was selected as a control for the analysis. The expression of each gene is provided in terms of the relative gene expression which is based on the expression ratio of a target gene versus the reference genes.

4.6. Statistical Analysis

Rstudio version 1.2.5019 was used to perform the statistical analyses. All statistical analyses in the current study were performed using one-way analysis of variance (ANOVA) followed by Tukey’s test which was used to detect significant differences among various light conditions, where p < 0.05 was considered a significant difference. All experiments were carried out in replicates of 4.

5. Conclusions

Chlamydomonas sp. MACC-216 was used to study the effects of various combinations of three light colors (blue, red, and white) and three light intensities (50 µmol m−2 s−1, 100 µmol m−2 s−1, and 250 µmol m−2 s−1) on its nitrate removal efficiency in TAP-N medium. A role of light intensity as well as light color was observed on the nitrate removal efficiency of the studied microalgae. Furthermore, Chlamydomonas sp. MACC-216 was cultivated under four light conditions namely, Blue 250, Blue 125 + Red 125, Red 250, and White 250 in SWW, where it showed the highest nitrate removal efficiency and nitrate reductase activity under the Blue 125 + Red 125 light condition in comparison to any other light conditions. Relative gene expression values of five genes involved in nitrate transport and reduction were also observed to be the highest under the Blue 125 + Red 125 light condition. Therefore, it is to be concluded that blue + red light combination together with high light intensity represents optimal conditions for the applied green microalgae to efficiently remove nitrate from wastewater.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24010077/s1.

Author Contributions

Conceptualization, V.R. and G.M.; methodology, V.R.; validation, V.R. and G.M.; formal analysis, V.R.; investigation, V.R.; resources, G.M.; data curation, V.R.; writing—original draft preparation, V.R.; writing—review and editing, G.M.; visualization, V.R.; supervision, G.M.; funding acquisition, G.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the following international and domestic funds: NKFI-2020-1.1.2-PIACI-KFI-2020-00020 and the Lendület-Programme (GM) of the Hungarian Academy of Sciences (LP2020-5/2020). Vaishali Rani was supported by the Stipendium Hungaricum Scholarship at the University of Szeged (Hungary).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

I would like to thank Prateek Shetty for helping me out with the proofreading of the manuscript.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Yu, G.; Wang, J.; Liu, L.; Li, Y.; Zhang, Y.; Wang, S. The analysis of groundwater nitrate pollution and health risk assessment in rural areas of Yantai, China. BMC Public Health 2020, 20, 437. [Google Scholar] [CrossRef] [PubMed]
  2. Shrimali, M.; Singh, K.P. New methods of nitrate removal from water. Environ. Pollut. 2001, 112, 351–359. [Google Scholar] [CrossRef] [PubMed]
  3. Taziki, M.; Ahmadzadeh, H.; Murry, M.A.; Lyon, S.R. Nitrate and nitrite removal from wastewater using algae. Curr. Biotechnol. 2015, 4, 426–440. [Google Scholar] [CrossRef]
  4. Cabanelas, I.T.; Ruiz, J.; Arbib, Z.; Chinalia, F.A.; Garrido-Pérez, C.; Rogalla, F.; Nascimento, I.A.; Perales, J.A. Comparing the use of different domestic wastewaters for coupling microalgal production and nutrient removal. Bioresour. Technol. 2013, 131, 429–436. [Google Scholar] [CrossRef]
  5. Jia, H.; Yuan, Q. Removal of nitrogen from wastewater using microalgae and microalgae-bacteria consortia. Cogent Environ. Sci. 2016, 2, 1275089. [Google Scholar] [CrossRef]
  6. Gupta, S.K.; Ansari, F.A.; Nasr, M.; Rawat, I.; Nayunigari, M.K.; Bux, F. Cultivation of Chlorella sorokiniana and Scenedesmus obliquus in wastewater: Fuzzy intelligence for evaluation of growth parameters and metabolites extraction. J. Clean. Prod. 2017, 147, 419–430. [Google Scholar] [CrossRef]
  7. Ansari, F.A.; Nasr, M.; Rawat, I.; Bux, F. Meeting sustainable development goals (SDGs) through progression of pilot-scale algal system to commercial raceway pond (300,000 L). Biomass Convers. Biorefin. 2021. [Google Scholar] [CrossRef]
  8. Sæbø, A.; Krekling, T.; Appelgren, M. Light quality affects photosynthesis and leaf anatomy of birch plantlets in vitro. Plant Cell Tissue Organ Cult. 1995, 41, 177–185. [Google Scholar] [CrossRef]
  9. Maltsev, Y.; Maltseva, K.; Kulikovskiy, M.; Maltseva, S. Influence of light conditions on microalgae growth and content of lipids, carotenoids, and fatty acid composition. Biology 2021, 10, 1060. [Google Scholar] [CrossRef]
  10. Masojídek, J.; Koblížek, M.; Torzillo, G. Photosynthesis in microalgae. In Handbook of Microalgal Culture: Biotechnology and Applied Phycology; Richmond, A., Ed.; Blackwell Publishing: Oxford, UK, 2003; pp. 20–39. [Google Scholar]
  11. Das, P.; Lei, W.; Aziz, S.S.; Obbard, J.P. Enhanced algae growth in both phototrophic and mixotrophic culture under blue light. Bioresour. Technol. 2011, 102, 3883–3887. [Google Scholar] [CrossRef]
  12. Kim, T.H.; Lee, Y.; Han, S.H.; Hwang, S.J. The effects of wavelength and wavelength mixing ratios on microalgae growth and nitrogen, phosphorus removal using Scenedesmus sp. for wastewater treatment. Bioresour. Technol. 2013, 130, 75–80. [Google Scholar] [CrossRef] [PubMed]
  13. Li, X.; Huff, J.; Crunkleton, D.W.; Johannes, T.W. LED alternating between blue and red-orange light improved the biomass and lipid productivity of Chlamydomonas reinhardtii. J. Biotechnol. 2021, 341, 96–102. [Google Scholar] [CrossRef] [PubMed]
  14. Teo, C.L.; Atta, M.; Bukhari, A.; Taisir, M.; Yusuf, A.M.; Idris, A. Enhancing growth and lipid production of marine microalgae for biodiesel production via the use of different LED wavelengths. Bioresour. Technol. 2014, 162, 38–44. [Google Scholar] [CrossRef]
  15. Wu, H. Effect of different light qualities on growth, pigment content, chlorophyll fluorescence, and antioxidant enzyme activity in the red alga Pyropia haitanensis (Bangiales, Rhodophyta). BioMed Res. Int. 2016, 2016, 7383918. [Google Scholar] [CrossRef] [PubMed]
  16. Figueroa, F.L.; Aguilera, J.; Niell, F.X. Red and blue light regulation of growth and photosynthetic metabolism in Porphyra umbilicalis (Bangiales, Rhodophyta). Eur. J. Phycol. 1995, 30, 11–18. [Google Scholar] [CrossRef]
  17. Koc, C.; Anderson, G.A.; Kommareddy, A. Use of red and blue light-emitting diodes (LED) and fluorescent lamps to grow microalgae in a photobioreactor. Isr. J. Aquac. 2013, 65, 1–8. [Google Scholar]
  18. Hempel, N.; Petrick, I.; Behrendt, F. Biomass productivity and productivity of fatty acids and amino acids of microalgae strains as key characteristics of suitability for biodiesel production. J. Appl. Phycol. 2012, 24, 1407–1418. [Google Scholar] [CrossRef]
  19. Atta, M.; Idris, A.; Bukhari, A.; Wahidin, S. Intensity of blue LED light: A potential stimulus for biomass and lipid content in freshwater microalgae Chlorella vulgaris. Bioresour. Technol. 2013, 148, 373–378. [Google Scholar] [CrossRef]
  20. He, Q.; Yang, H.; Wu, L.; Hu, C. Effect of light intensity on physiological changes, carbon allocation and neutral lipid accumulation in oleaginous microalgae. Bioresour. Technol. 2015, 191, 219–228. [Google Scholar] [CrossRef]
  21. Zhang, S.; Kim, T.H.; Han, T.H.; Hwang, S.J. Influence of light conditions of a mixture of red and blue light sources on nitrogen and phosphorus removal in advanced wastewater treatment using Scenedesmus dimorphus. Biotechnol. Bioprocess Eng. 2015, 20, 760–765. [Google Scholar] [CrossRef]
  22. Treves, H.; Raanan, H.; Finkel, O.M.; Berkowicz, S.M.; Keren, N.; Shotland, Y.; Kaplan, A. A newly isolated Chlorella sp. from desert sand crusts exhibits a unique resistance to excess light intensity. FEMS Microbiol. Ecol. 2013, 86, 373–380. [Google Scholar] [CrossRef] [PubMed]
  23. Virtanen, O.; Khorobrykh, S.; Tyystjärvi, E. Acclimation of Chlamydomonas reinhardtii to extremely strong light. Photosynth. Res. 2021, 147, 91–106. [Google Scholar] [CrossRef]
  24. Yan, C.; Zhao, Y.; Zheng, Z.; Luo, X. Effects of various LED light wavelengths and light intensity supply strategies on synthetic high-strength wastewater purification by Chlorella vulgaris. Biodegradation 2013, 24, 721–732. [Google Scholar] [CrossRef] [PubMed]
  25. Rani, V.; Maróti, G. Assessment of nitrate removal capacity of two selected eukaryotic green microalgae. Cells 2021, 10, 2490. [Google Scholar] [CrossRef] [PubMed]
  26. Gunawan, T.J.; Ikhwan, Y.; Restuhadi, F.; Pato, U. Effect of light Intensity and photoperiod on growth of Chlorella pyrenoidosa and CO2 biofixation. E3S Web Conf. 2018, 31, 03003. [Google Scholar]
  27. Yan, C.; Zheng, Z. Performance of mixed LED light wavelengths on biogas upgrade and biogas fluid removal by microalga Chlorella sp. Appl. Energy 2014, 113, 1008–1014. [Google Scholar] [CrossRef]
  28. Garbayo, I.; Vigara, A.J.; Conchon, V.; Dos Santos, V.A.P.M.; Vílchez, C. Nitrate consumption alterations induced by alginate-entrapment of Chlamydomonas reinhardtii cells. Process Biochem. 2000, 36, 459–466. [Google Scholar] [CrossRef]
  29. Lee, K.; Lee, C.G. Effect of light/dark cycles on wastewater treatments by microalgae. Biotechnol. Bioprocess Eng. 2001, 6, 194–199. [Google Scholar] [CrossRef]
  30. Su, Y.; Mennerich, A.; Urban, B. Coupled nutrient removal and biomass production with mixed algal culture: Impact of biotic and abiotic factors. Bioresour. Technol. 2012, 118, 469–476. [Google Scholar] [CrossRef]
  31. Hillman, W.S. The Physiology of Phytochrome. Annu. Rev. Plant Physiol. 1967, 18, 301–324. [Google Scholar] [CrossRef]
  32. Sharrock, R.A. The phytochrome red/far-red photoreceptor superfamily. Genome Biol. 2008, 9, 230. [Google Scholar] [CrossRef]
  33. Figueroa, F.L. Photoregulation of nitrogen metabolism and protein accumulation in the red alga Corallina elongata Ellis et Soland. Z. Naturforsch. 1993, 48, 788–794. [Google Scholar] [CrossRef]
  34. Aparicio, P.J.; Quiñiones, M.A. Blue light, a positive switch signal for nitrate and nitrite uptake by the green alga Monoraphidium braunii. Plant Physiol. 1991, 95, 374–378. [Google Scholar] [CrossRef]
  35. Azuara, M.P.; Aparicio, P.J. In vivo blue-light activation of Chlamydomonas reinhardtii. Plant Physiol. 1983, 71, 286–290. [Google Scholar] [CrossRef] [PubMed]
  36. Fernandez, E.; Galvan, A. Inorganic nitrogen assimilation in Chlamydomonas. J. Exp. Bot. 2007, 58, 2279–2287. [Google Scholar] [CrossRef] [PubMed]
  37. Sanz-Luque, E.; Chamizo-Ampudia, A.; Llamas, A.; Galvan, A.; Fernandez, E. Understanding nitrate assimilation and its regulation in microalgae. Front. Plant Sci. 2015, 6, 899. [Google Scholar] [CrossRef]
  38. Calatrava, V.; Chamizo-Ampudia, A.; Sanz-Luque, E.; Ocaña-Calahorro, F.; Llamas, A.; Fernandez, E.; Galvan, A. How Chlamydomonas handles nitrate and the nitric oxide cycle. J. Exp. Bot. 2017, 68, 2593–2602. [Google Scholar] [CrossRef]
  39. Higuera, J.J.; Calatrava, V.; González, Z.; Mariscal, V.; Siverio, J.M.; Fernández, E.; Galván, A. NRT2.4 and NRT2.5 are two half-size transporters from the Chlamydomonas NRT2 family. Agronomy 2016, 6, 20. [Google Scholar] [CrossRef]
  40. Campbell, W.H. Nitrate reductase structure, function and regulation: Bridging the gap between biochemistry and physiology. Annu. Rev. Plant Biol. 1999, 50, 277–303. [Google Scholar] [CrossRef]
  41. Fischer, K.; Llamas, A.; Tejada-Jimenez, M.; Schrader, N.; Kuper, J.; Ataya, F.S.; Galvan, A.; Mendel, R.R.; Fernandez, E.; Schwarz, G. Function and structure of the molybdenum cofactor carrier protein from Chlamydomonas reinhardtii. J. Biol. Chem. 2006, 281, 30186–30194. [Google Scholar] [CrossRef]
  42. OECD. Test No. 209: Activated Sludge, Respiration Inhibition Test (Carbon and Ammonium Oxidation). In OECD Guidelines for the Testing of Chemicals, Section 2; OECD Publishing: Paris, France, 2010. [Google Scholar]
  43. Cataldo, D.A.; Haroon, M.; Schrader, L.E.; Youngs, V.L. Rapid colorimetric determination of nitrate in plant tissue by nitration in salicylic acid. Commun. Soil. Sci. Plant Anal. 1975, 6, 71–80. [Google Scholar] [CrossRef]
  44. Giovannoni, G.; Land, J.M.; Keir, G.; Thompson, E.J.; Heales, S.J.R. Adaptation of the nitrate reductase and Griess reaction methods for the measurement of serum nitrate plus nitrite levels. Ann. Clin. Biochem. 1998, 34 Pt 2, 193–198. [Google Scholar] [CrossRef] [PubMed]
  45. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Growth of Chlamydomonas sp. MACC-216 under various light conditions in TAP-N5 and TAP-N10 media. Numbers 25, 50, 100, 125, and 250 mentioned in the figure represent light intensity. The unit of light intensity is µmol m−2 s−1.
Figure 1. Growth of Chlamydomonas sp. MACC-216 under various light conditions in TAP-N5 and TAP-N10 media. Numbers 25, 50, 100, 125, and 250 mentioned in the figure represent light intensity. The unit of light intensity is µmol m−2 s−1.
Ijms 24 00077 g001
Figure 2. Nitrate removal efficiency of Chlamydomonas sp. MACC-216 under various light conditions in TAP-N5 and TAP-N10 media. Numbers 25, 50, 100, 125, and 250 mentioned in the figure represent light intensity. The unit of light intensity is µmol m−2 s−1. Error bars represent standard deviations. Tukey’s-test was done for each nitrate concentration separately. Lowercase letters signify statistical differences (p < 0.05) as determined by Tukey’s-test.
Figure 2. Nitrate removal efficiency of Chlamydomonas sp. MACC-216 under various light conditions in TAP-N5 and TAP-N10 media. Numbers 25, 50, 100, 125, and 250 mentioned in the figure represent light intensity. The unit of light intensity is µmol m−2 s−1. Error bars represent standard deviations. Tukey’s-test was done for each nitrate concentration separately. Lowercase letters signify statistical differences (p < 0.05) as determined by Tukey’s-test.
Ijms 24 00077 g002
Figure 3. Chlamydomonas sp. MACC-216 under various light conditions in SWW: (a) Growth; (b) Nitrate removal efficiency; (c) Nitrate reductase activity. FW: Fresh weight. Error bars represent standard deviations. Lowercase letters signify statistical differences (p < 0.05) as determined by Tukey’s-test.
Figure 3. Chlamydomonas sp. MACC-216 under various light conditions in SWW: (a) Growth; (b) Nitrate removal efficiency; (c) Nitrate reductase activity. FW: Fresh weight. Error bars represent standard deviations. Lowercase letters signify statistical differences (p < 0.05) as determined by Tukey’s-test.
Ijms 24 00077 g003
Figure 4. Relative gene expression of NRT1, NRT2.1, NRT2.2, NIA, and MCP genes in Chlamydomonas sp. MACC-216 grown under various light conditions in SWW. Error bars represent standard deviations. Tukey’s-test was done for each gene separately. Lowercase letters signify statistical differences (p < 0.05) as determined by Tukey’s-test.
Figure 4. Relative gene expression of NRT1, NRT2.1, NRT2.2, NIA, and MCP genes in Chlamydomonas sp. MACC-216 grown under various light conditions in SWW. Error bars represent standard deviations. Tukey’s-test was done for each gene separately. Lowercase letters signify statistical differences (p < 0.05) as determined by Tukey’s-test.
Ijms 24 00077 g004
Figure 5. Growth of Chlorella sp. MACC-38 (a) and Chlorella sp. MACC-360 (b) under various light conditions in SWW. Nitrate removal efficiency of Chlorella sp. MACC-38 (c) and Chlorella sp. MACC-360 (d) under various light conditions in SWW. Error bars represent standard deviations. Lowercase letters in (c,d) signify statistical differences (p < 0.05) as determined by Tukey’s-test.
Figure 5. Growth of Chlorella sp. MACC-38 (a) and Chlorella sp. MACC-360 (b) under various light conditions in SWW. Nitrate removal efficiency of Chlorella sp. MACC-38 (c) and Chlorella sp. MACC-360 (d) under various light conditions in SWW. Error bars represent standard deviations. Lowercase letters in (c,d) signify statistical differences (p < 0.05) as determined by Tukey’s-test.
Ijms 24 00077 g005
Table 1. Light conditions for the cultivation of Chlamydomonas sp. MACC-216 in TAP-N and SWW.
Table 1. Light conditions for the cultivation of Chlamydomonas sp. MACC-216 in TAP-N and SWW.
Light ConditionGrowth MediumDescription
Blue 50TAP-N5 and TAP-N10Blue light with 50 µmol m−2 s−1 light intensity
Blue 25 + Red 25TAP-N5 and TAP-N10Blue light with 25 µmol m−2 s−1 light intensity + Red light with 25 µmol m−2 s−1 light intensity
Red 50TAP-N5 and TAP-N10Red light with 50 µmol m−2 s−1 light intensity
White 50TAP-N5 and TAP-N10White light with 50 µmol m−2 s−1 light intensity
Blue 100TAP-N5 and TAP-N10Blue light with 100 µmol m−2 s−1 light intensity
Blue 50 + Red 50TAP-N5 and TAP-N10Blue light with 50 µmol m−2 s−1 light intensity + Red light with 50 µmol m−2 s−1 light intensity
Red 100TAP-N5 and TAP-N10Red light with 100 µmol m−2 s−1 light intensity
White 100TAP-N5 and TAP-N10White light with 100 µmol m−2 s−1 light intensity
Blue 250TAP-N5, TAP-N10, and SWWBlue light with 250 µmol m−2 s−1 light intensity
Blue 125 + Red 125TAP-N5, TAP-N10, and SWWBlue light with 125 µmol m−2 s−1 light intensity + Red light with 125 µmol m−2 s−1 light intensity
Red 250TAP-N5, TAP-N10, and SWWRed light with 250 µmol m−2 s−1 light intensity
White 250TAP-N5, TAP-N10, and SWWWhite light with 250 µmol m−2 s−1 light intensity
Table 2. List of genes and their primers used for real-time PCR.
Table 2. List of genes and their primers used for real-time PCR.
Gene NameNCBI Accession NumberPrimer (5′→3′)
Nitrate Transporter (NRT1)XM_043061965F: AGGCTCTGCCCCTGATAGA
R: CCTCCCATCACATTGCAGA
Nitrate Transporter (NRT2.1)Z25438F: TGAGAAGCCAGCCACAGTAA
R: AAGCAAATCCAGGACAGGTG
Nitrate Transporter (NRT2.2)Z25439F: CCATCTTCGGCCTTATGAAC
R: CGTTAGCGAGTTGCTGACCT
Nitrate reductase (NIA)AF203033F: AGCCGTTGACTTTGACCATG
R: GCATGTTCTCCTCCTTGCG
Molybdenum cofactor (moco) carrier protein (MCP)AY039706F: CATGGCTGGATCTTGCTGAC
R: CAGGAAGGACACCGATCGT
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)L27669F: ATTGGCCGCCTGGTTATG
R: GGTCTTGTGGACCGAGTCAT
Beta 1 tubulinM10064F: CGCATGATGCTGACCTTCT
R: GTCCAGGACCATGCACTCAT
F and R denote forward and reverse primer, respectively.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Rani, V.; Maróti, G. Light-Dependent Nitrate Removal Capacity of Green Microalgae. Int. J. Mol. Sci. 2023, 24, 77. https://doi.org/10.3390/ijms24010077

AMA Style

Rani V, Maróti G. Light-Dependent Nitrate Removal Capacity of Green Microalgae. International Journal of Molecular Sciences. 2023; 24(1):77. https://doi.org/10.3390/ijms24010077

Chicago/Turabian Style

Rani, Vaishali, and Gergely Maróti. 2023. "Light-Dependent Nitrate Removal Capacity of Green Microalgae" International Journal of Molecular Sciences 24, no. 1: 77. https://doi.org/10.3390/ijms24010077

APA Style

Rani, V., & Maróti, G. (2023). Light-Dependent Nitrate Removal Capacity of Green Microalgae. International Journal of Molecular Sciences, 24(1), 77. https://doi.org/10.3390/ijms24010077

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop