Next Article in Journal
Consistent DNA Hypomethylations in Prostate Cancer
Previous Article in Journal
Comorbidity of Post-Traumatic Stress Disorder and Alcohol Use Disorder: Animal Models and Associated Neurocircuitry
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization and Expression Patterns of Two Pheromone-Binding Proteins from the Diurnal Moth Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae)

1
Guangxi Key Laboratory of Agric-Environment and Agric-Products Safety, National Demonstration Center for Experimental Plant Science Education, College of Agriculture, Guangxi University, Nanning 530004, China
2
Xianning Academy of Agricultural Sciences, Xianning 437000, China
3
Hubei Key Laboratory of Insect Resources Utilization and Sustainable Pest Management, College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(1), 385; https://doi.org/10.3390/ijms24010385
Submission received: 4 November 2022 / Revised: 21 December 2022 / Accepted: 23 December 2022 / Published: 26 December 2022
(This article belongs to the Section Biochemistry)

Abstract

Sex pheromone-binding proteins (PBPs) play an important role in sex pheromone recognition in Lepidoptera. However, the mechanisms of chemical communication mediating the response to sex pheromones remain unclear in the diurnal moths of the superfamily Zygaenoidea. In this study, Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae) was used as a model insect to explore the molecular mechanism of sex pheromone perception in the superfamily Zygaenoidea. Two novel pheromone-binding proteins (PflaPBP1 and PflaPBP2) from P. flammans were identified. The two pheromone-binding proteins were predominantly expressed in the antennae of P. flammans male and female moths, in which PflaPBP1 had stronger binding affinity to the female sex pheromones Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal, PflaPBP2 had stronger binding affinity only for (Z, Z, Z)-9, 12, 15-octadecatrienal, and no apparent binding affinity to Z-9-hexadecenal. The molecular docking results indicated that Ile 170 and Leu 169 are predicted to be important in the binding of the sex pheromone to PflaPBP1 and PflaPBP2. We concluded that PflaPBP1 and PflaPBP2 may be responsible for the recognition of two sex pheromone components and may function differently in female and male P. flammans. These results provide a foundation for the development of pest control by exploring sex pheromone blocking agents and the application of sex pheromones and their analogs for insect pests in the superfamily Zygaenoidea.

1. Introduction

Moths detect pheromones with specialized chemosensilla localized on the antennae or, more rarely, on other parts of the body [1]. Normally, moth antennae can accurately identify and distinguish sex pheromones and their analogs by pheromone-binding proteins (PBPs) [2]. PBPs are either specific to or highly enriched in the antennae of males and act as pheromone carriers by binding and transporting odorant molecules across the antennal hemolymph to odorant receptor proteins [3,4]. Some studies have shown that the sexually dimorphic antennal flagellum of the male is enlarged so that the flagella can house extra arrays of pheromone-specific long trichoid sensilla, where PBPs have high binding affinities to sex pheromones released by female moths [5,6]. Further studies indicated that the female moth antennae can also detect their conspecific sex pheromones [7], and the expression of PBPs has been observed in antennae of female moths such as Bombyx mori (Linnaeus) (Lepidoptera: Bombycidae), Antheraea polyphemus (Cramer) (Lepidoptera: Saturniidae), and Manduca sexta (Linnaeus) (Lepidoptera: Sphingidae) [8,9,10]. Previous studies have suggested that female expression of PBPs was associated with a small number of specific olfactory sensilla on the antennae [11,12].
The earliest studies on PBPs were conducted in moths. In 1981, the first PBP (ApolPBP) was isolated from the antennae of male A. polyphemus [13]. Since then, many lepidopteran PBPs have been identified from M. sexta [14], Lymantria dispar (Linnaeus) (Lepidoptera: Erebidae) [15], Spodoptera exigua (Hübner) (Lepidoptera: Noctuidae) [16], Agrotis ipsilon (Hufnagel) (Lepidoptera: Noctuidae) [6], Chilo suppressalis (Walker) (Lepidoptera: Crambidae) [17], Tryporyza intacta (Snellen) (Lepidoptera: Pyralidae) [4], and Carposina sasakii Matsumura (Lepidoptera: Carposinidae) [18]. Many studies have indicated that PBPs from the antennae of male moths, such as Plutella xylostella (Linnaeus) (Lepidoptera: Plutellidae) [19], C. suppressalis [17], and Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) [20], not only robustly bound the sex pheromone components but also significantly bound pheromone analogs. In contrast, extensive evidence has indicated that PBPs in female antennae facilitate the detection of sex pheromone components released by themselves or by conspecifics [21,22]. Interestingly, PBPs in females not only have a high binding affinity for sex pheromones but can also bind host-related semiochemicals, e.g., Maruca vitrata (Fabricius) (Lepidoptera: Crambidae) [23] and L. dispar [24].
Many studies have revealed the olfactory molecular mechanism of diurnal moths for discriminating sex pheromone components, for example, those in L. dispar [24], H. armigera [25], and B. mori [9,26]. A notable exception is represented however by castniid moths, which did not produce any pheromone to attract males, and mate location was achieved only visually by patrolling males [27]. Most species in the superfamily Zygaenoidea are diurnal moths that use double strategies (e.g., olfactory and visual signals) to identify male and female sexes [28,29]. Numerous studies on sex pheromones in the superfamily Zygaenoidea have focused mainly on the identification and field testing of the families Limacodidae [30,31], Phaudidae [32], and Zygaenidae [33,34,35,36,37,38,39] since the 1980s. However, the mechanism of chemical communication involved in the response to sex pheromones is still not well-known in diurnal moths of the superfamily Zygaenoidea.
Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae) is a notorious leaf-eating pest on Ficus spp. in many countries in Southeast Asia and southern China [40,41,42,43,44,45]. P. flammans produces 2–3 generations per year in southern China [43]. This species is a monandrous moth, and its adults live for 4–5 days [29]. P. flammans adults are active during the photophase that lasts from 6:00 to 16:00 h and mate from 9:00 to 19:00 h [32,43]. Although different management strategies have been explored to control P. flammans [46,47], chemical control is still one of the main management techniques. However, the overuse of insecticides could result in insect resistance to the most commonly used products as well as environmental contamination [48]. Sex pheromone-based strategies (e.g., mass trapping and mating disruption) have been identified as effective methods of biological control for managing insecticide resistance and environmental pollution [7,49]. Our earlier study showed that the primary components of P. flammans female-produced sex pheromones were Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal, and the capture of only males in field tests using the two synthetic pheromone components at a ratio of 1:1 confirmed the activity of the identified sex pheromone candidates [32]. Furthermore, sexual dimorphism in the antennal sensilla of P. flammans was observed, with the male antennae having more sensilla trichodea than the female antennae [50]. Unfortunately, the inherent relationship between the number or distribution of sensilla trichodea and sensitivity to female sex pheromones in P. flammans is still unclear, although the responses of sensilla trichodea to female sex pheromones in Lepidoptera are well-known [51,52,53,54]. Thus far, limited information is available about the molecular mechanism of sex pheromone perception in P. flammans.
In this study, P. flammans was used as a model insect to explore the molecular mechanism of sex pheromone perception of diurnal moths in the superfamily Zygaenoidea. Our objectives were to characterize the nucleotide and amino acid features, tissue-specific expression, binding affinity for sex pheromones, and candidate binding site via three-dimensional structure construction and molecular docking of P. flammans PBPs. These results will help elucidate the role of P. flammans PBPs in sex pheromone perception and may also suggest focused strategies to disrupt semiochemical detection and recognition for this moth in the field.

2. Results

2.1. Cloning and Sequence Analysis of PflaPBPs

Two PBP genes were successfully cloned using the cDNA of P. flammans and named PflaPBP1 and PflaPBP2, which were submitted to the National Center for Biotechnology Information (NCBI) database and assigned accession numbers MK948015 and MK948014, respectively (Figure A1). The complete open reading frames (ORFs) of PflaPBP1 and PflaPBP2 are 495 bp and 492 bp, respectively. PflaPBP1 encodes 164 amino acids, while the signal peptide contains 22 amino acids. After removal of the signal peptide, the protein size was 15.84 kDa, and the isoelectric point was 4.89. PflaPBP2 encodes 163 amino acids, while the signal peptide contains 21 amino acids. After removal of the signal peptide, the protein size was 16.08 kDa, and the isoelectric point was 5.60.
The derived amino acid sequence was used to construct a phylogenetic tree with the other published insect PBPs (Figure 1). The PBPs of Lepidoptera were found to be very conservative. PfalPBP1 clustered in a group with other lepidopteran PBP1s, while PflaPBP2 clustered in a group with PBP2. PfalPBP1 and PflaPBP2 showed the highest homology with the moths of Pyralidae (e.g., DabiPBP of Dioryctria abietella, OnubPBP1 of Ostrinia nubilalis (Hübner) and LstiPBP of Loxostege sticticalis Linnaeus) and butterflies (e.g., BanyPBP of Bicyclus anynana and PrapPBP2 of Pieris rapae (Linnaeus)), respectively. Similar to other lepidopteran PBPs, both PflaPBP1 and PflaPBP2 have six typical cysteine residues (Figure A2).

2.2. Tissue Expression of PflaPBPs

The expression levels of PflaPBP1 and PflaPBP2 varied significantly among adult tissues (Figure 2, Table 1 and Table 2). Specifically, expression levels of PflaPBP1 and PflaPBP2 in the antennae were 241.17 times and 267.38 times the sum of other tissues, respectively. Differences in PflaPBP1 expression were also found between sexes (Table 1). There were significant interactions between sex and tissues, showing that PflaPBP1 and PflaPBP2 are expressed at different levels in the same tissue in different sexes (Table 1 and Table 2). In particular, the expression of PflaPBP1 was 1.56 times higher in the antennae of males than in those of females, and the expression of PflaPBP2 was 1.57 times higher in the antennae of females than in those of males (Figure 2).

2.3. Prokaryotic Expression and Purification of PflaPBPs

Recombinant proteins were induced and expressed in E. coli prokaryotic cells in vitro. After induction by isopropyl-β-D-1-thiogalactopyranoside (IPTG), there were obvious protein bands between 25 and 35 kDa in the experimental group compared with the control group, indicating that the protein was successfully induced. Then, the histidine (His) tag was removed and purified to obtain the target soluble protein from the supernatant (Figure 3). The yield of purified protein was 0.21 mg/mL for PflaPBP1 and 0.07 mg/mL for PflaPBP2.

2.4. Test of Fluorescent Probe

To detect the binding affinity of proteins to small molecules by fluorescence competitive binding, N-phenyl-1-naphthylamine (1-NPN) was used as the probe to test the suitability of PflaPBP1 and PflaPBP2 at pH = 7.4. The maximum fluorescence value of the complex of the two proteins and 1-NPN increased gradually with the increase in the concentration of 1-NPN until it reached saturation. Scatchard plots show that 1-NPN binds the two proteins one-to-one under neutral conditions (Figure 4). Thus, 1-NPN can be used as a probe for fluorescence competitive binding experiments of PflaPBP1 and PflaPBP2.

2.5. Fluorescence Binding Affinities

The binding characteristics of PflaPBP1 and PflaPBP2 with two sex pheromones were analyzed by fluorescence competitive binding experiments (Figure 5). These results showed that the binding affinity of PflaPBP1 to ligands was bound with a higher affinity than the binding affinity of PflaPBP2 to ligands. PflaPBP1 had a moderate binding affinity for the female sex pheromones Z-9-hexadecenal (Ki = 21.26 μM) and (Z, Z, Z)-9, 12, 15-octadecatrienal (Ki = 38.48 μM), and PflaPBP2 had a moderate binding affinity for (Z, Z, Z)-9, 12, 15-octadecatrienal (Ki = 33.95 μM) but no detectable binding affinity for Z-9-hexadecenal (Ki = 108.68 μM) (Table 3).

2.6. Three-Dimensional Structure and Molecular Docking of PflaPBPs

The protein structure of BmorPBP1 was used as a template to construct the protein structures of PflaPBP1 and PflaPBP2. The consistency between PflaPBP1 and PflaPBP2 with the best template was different, with 67.38% (the evaluation of Ramachandran plots was 92.67%, Figure A3) and 47.89% (the evaluation of Ramachandran plots was 95.86%, Figure A4) sequence consistency, respectively. The three-dimensional structure consists of six α-helixes and one additional α-helix (α7-helix) (Figure 6A,B). In addition, three disulfide bonds are formed by the six conserved cysteine (Cys) residues to connect, which are α1-α3 (Cys45-Cys84), α3-α7 (Cys78-Cys142), and α6-α7 (Cys97-Cys117) in PflaPBP1 and α1-α3 (Cys50-Cys87), α3-α7 (Cys83-Cys143), and α6-α7 (Cys87-Cys152) in PflaPBP2 (Figure 6C). The Cys sites of PflaPBP1 and PflaPBP2 are very similar to the disulfide bond.
To explore the binding site of PflaPBP1 and PflaPBP2 with sex pheromones, we selected sex pheromones [Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal] that possibly bind to PflaPBP1 and PflaPBP2 for three-dimensional structural docking. The results of molecular docking indicated that hydrogen bonding was the main interaction mode between PflaPBP1/PflaPBP2 and the tested sex pheromone molecules. Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal showed hydrogen bonding to PflaPBP1. The hydrogen bonding sites of Z-9-hexadecenal are Leu 169 and Ile 170 (Figure 7A–C), while (Z, Z, Z)-9, 12, 15-octadecatrienal only bound to Ile 170 (Figure 7D–F); (Z, Z, Z)-9, 12, 15-octadecaenal showed hydrogen bonding to PflaPBP2, and the binding site was Lys 69 (Figure 7G–I). This hydrogen bond acts as a fixator to bind ligands at the binding site. Z-9-hexadecenal was bound to PflaPBP1 through two hydrogen bonds, indicating strong binding.

3. Discussion

Many species of Zygaenoidea release sex pheromones which can be used in the monitoring and forecasting of these diurnal moths in the field [31,34,35,36,37,38,39]. P. flammans sex pheromones have been used as biological control agents in the field, and a mixture of the two synthetic pheromones of P. flammans, Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal, at a ratio of 1:1 could effectively attract male moths [32]. Since field trials are normally more convincing to identify sex pheromones in insects, Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal were proven to be female-produced sex pheromones that could attract males [32]. Based on our findings, we deduced that PflaPBP1, but not PflaPBP2, was the dominant binding protein in P. flammans as a passive carrier delivering sex pheromones to neuronal membranes. First, a mixture of Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal at a ratio of 1:1 was effective in attracting male moths [32], which indicated that the recognition of both chemicals was needed. Second, PflaPBP1 was in accordance with the male-biased expression in antennae (Figure 2A). In addition, PflaPBP1 has binding affinity to both sex pheromones, while PflaPBP2 could only bind Z-9-hexadecenal (Figure 5).
Our results also indicated that PflaPBP1 and PflaPBP2 may function differently in females and males. Quantitative real-time PCR analysis of the PflaPBP1 and PflaPBP2 genes showed that they were predominantly expressed in the antennae of both sexes in P. flammans, similar to the findings in several diurnal moths, e.g., M. sexta [8], A. polyphemus [10], and B. mori [26]. Interestingly, the transcript levels of the PflaPBP genes in the antennae of both sexes were different. For example, the expression level of PflaPBP1 in male antennae was significantly higher than the expression level of PflaPBP1 in female antennae and vice versa for PflaPBP2 (Figure 2). Further analysis of the binding characteristics of PflaPBP1 with the two sex pheromones indicated an important role in female sex pheromone perception. Therefore, the male-biased expression level of PflaPBP1 suggested that the gene may be involved in sexual communication involving pheromones. For the PflaPBP2 gene, the expression level in female antennae was significantly higher than the expression level in male antennae, and the protein could bind (Z, Z, Z)-9, 12, 15-octadecatrienal. In this context, the presence of the PflaPBP2 gene in the olfactory sensilla of female antennae suggests that P. flammans females may detect either their own sex pheromone or at least certain components of their sex pheromone. There are two hypotheses to explain these results. First, females detecting sex pheromones reproduced by themselves are believed to allow the detection of competing plumes for avoidance [17,55]. Especially for the monandrous moth P. flammans, conspecific signals are used as cues for rapid relocation to valuable sites to avoid competition in their short lifespan because delayed mating significantly reduces their reproductive outputs [56]. Thus, conspecific communication with pheromones may improve the chances of mating success [57,58]. Second, female expression of PflaPBP2 may help females recognize the Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal released by other females, which is used to avoid the identification bias of males among similar species, such as P. triadum Walker (Lepidoptera: Phaudidae), leading to cross-mating of different species [7]. Indeed, female autodetection of their sex pheromones has been demonstrated for several diurnal moths, including Panaxia quadripunctaria Poda (Lepidoptera: Arctiidae) [59] and Utetheisa ornatrix (Linnaeus) (Lepidoptera: Erebidae) [60]. Our results suggest that PflaPBP1 and PflaPBP2 may play different roles in female sex pheromone perception and that these genes may undergo functional differentiation.
In this study, sex pheromone components of P. flammans, Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal, were bound with PflaPBP1 and PflaPBP2 with different degrees of sensitivity. The three-dimensional structure consists of six α-helixes and one additional α-helix (α7-helix) (Figure 6A,B), which may be involved in the binding and release of pheromones under different conditions. For example, PflaPBP1 showed binding to the female sex pheromones Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal, while PflaPBP2 showed binding only to (Z, Z, Z)-9, 12, 15-octadecatrienal (Figure 5). Both sex pheromone ligands showed the same chain length based on the three-dimensional structure models. One end of each molecule had hydroxyl groups, which tended to form hydrogen bonds with PBP residues. These hydrogen bonds were considered to be the main interaction mode between PflaPBPs proteins and sex pheromone ligands, which has been confirmed in several insect PBPs [61,62]. Furthermore, the docking results showed that both the binding sites of PflaPBP1 and the two sex pheromone ligands involved Ile 170. We speculated that Ile 170 might be the key site for the recognition of PflaPBP1.
The preceding studies found that the binding affinity of PBPs for pheromones could be significantly decreased or totally discontinued even with the mutation of one or two amino acids [63,64]. A study also conjectured that some hydrophobic residues and their hydrophobic interactions were essential for binding to their sex pheromone components [65]. Moreover, further functional verification of PflaPBPs by RNAi survey rather than point mutation should provide direct biological evidence that was fully considered. Unfortunately, PflaPBP1 and PflaPBP2 could not be effectively depressed by RNA interference after many attempts (unpublished data). We deduced that low stability and intracellular transport of dsRNA might lead to a poor RNAi response in P. flammans, which was consistent with other lepidopterans such as Spodoptera littoralis (Boisduval) and Chrysodeixis includens (Walker) [66,67,68,69,70,71,72]. Furthermore, the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 technique as a substitutive method for RNAi would be certain to facilitate functional research of PflaPBP1 and PflaPBP2, combined with electrophysiological and behavioral assays to verify their functions [65], which cannot be implemented at present because we were unable to collect P. flammans eggs successfully due to the lower mate success in the laboratory. For this reason, we have taken transgenerational breeding in P. flammans as a priority for the prospective study of gene function via the CRISPR/Cas9 technique, which is currently achieving limited progress.
There is a possibility that other sex pheromone components participate in sex pheromone recognition in P. flammans, which must be considered. First, we note that the identification of sex pheromone components and their proportion is a process of constant and precise adjustment in many species of lepidoptera, such as Spodoptera frugiperda (J. E. Smith) [73]. Meanwhile, there is also the possibility of a novel sex pheromone component in P. flammans that might be identified in the future with new technology development. Thus far, Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal have been proved as two vital components by a series of laboratory and field studies [32]. In this context, we focus on the known sex pheromone components and their interactions with PflaPBP1 and PflaPBP2.
Only two PflaPBPs were involved in this study, while 3~4 PBPs have been identified in some lepidopteran species [74,75]. These two PflaPBPs were originally identified from an antenna Illumina high-throughput transcriptome (unpublished data) in P. flammans, and their binding affinity for Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal was also confirmed. However, we noticed that there might be more than two PflaPBPs in P. flammans just like B. mori [76]. First, a more advanced antenna transcriptome via PacBio full-length sequencing was established to find a third PflaPBP with no success [77]. Second, local basic local alignment search tool (BLAST) was also conducted, and no additional PflaPBP was found. These attempts convince us that it is very likely to have only two PflaPBPs in P. flammans. Moreover, the number of PBPs may be caused by species specificity because only two PBPs have also been reported in many insects, such as Sitotroga cerealella (Olivier) [78]. However, 58 OBPs were identified in P. flammans [77]. There is a possibility that some of them might act as a PBP in addition to PflaPBP1 and PflaPBP2 with a grain of salt because their functional studies have not yet been conducted.
Currently, studies on sex pheromone binding proteins of Lepidoptera are focused mainly on nocturnal moths, while similar studies on diurnal moths remain unclear. For the first time, we illustrated the interactions between the known sex pheromones and the identified pheromone binding proteins in vitro, which have a guiding role in probing the olfactory molecular mechanism of sex pheromone perception in the superfamily Zygaenoidea as well as other diurnal species.
In conclusion, PflaPBP1 and PflaPBP2 are responsible for the recognition of Z-9-hexadecenal and (Z, Z, Z)-9, 12, 15-octadecatrienal to varying degrees. These findings may facilitate pest control by exploring sex pheromone blocking agents. Our research will also help with the application of sex pheromones and their analogs in the diurnal moths of superfamily Zygaenoidea.

4. Materials and Methods

4.1. Insect Rearing and Sample Collection

From June to July 2018, P. flammans larvae were collected on Ficus benjamina L. trees located at the campus of Guangxi University (Nanning City, Guangxi Zhuang Autonomous Region, China; 108.17° E, 22.50° N). The collected larvae were then routinely placed into plastic boxes (radius = 8.0 cm, height = 12 cm; 10 individuals/box) and incubated in a standardized insect rearing room. The room was set to 26 (±1) °C, with a relative humidity of 60–80% and a photoperiod of L 14: D 10. Fresh young leaves of F. benjamina were replaced daily to feed the larvae until the pupae were collected. The pupae were then sexed following Mao et al. [79] and kept individually in plastic tubes (2.7 cm diameter, 10.3 cm height) with a plastic lid with 10 holes (2 mm diameter) in the middle for ventilation. Emerged adult moths were reared with 10% sucrose solution before use.
The antennae, heads (without antennae), thoraxes, abdomens, legs, and wings were dissected from 10 living individuals by surgical scissors (Shandong Xinhua Medical Devices Co., Ltd., Zibo, China) to prepare tissue samples. The sampled tissues were frozen immediately in liquid nitrogen after collection and stored at −80 °C. Three biological repeats were prepared.

4.2. RNA Extraction and Cloning of PflaPBPs

Total RNA was extracted from samples of P. flammans using TRIzol reagent (Takara, Beijing, China). Total RNA was examined by a NanoDrop 2000 system (Thermo Scientific™, Waltham, MA, USA) and 1% agarose gel electrophoresis (Newbio, San Francisco, CA, USA). Total RNA with a clear band and an OD260/280 value of 1.9–2.1 was used for further cDNA preparation. cDNA preparation was performed in accordance with the instructions of the PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Beijing, China, RR047A) and stored at −20 °C.
PBP and pheromone-binding protein were used as keywords to screen the annotated chemosensory genes by the results of Nr annotation from the antenna transcriptome database. So, candidate PBPs were identified from the antenna transcriptome database of P. flammans (unpublished data) and applied to primer design for the ORF (Table 4) by PCR with gene-specific primers. The total PCR mixture of 20.0 µL contained 14.6 µL of double-distilled (dd) H2O, 1.6 µL of dNTPs (2.5 mM, TransGen Biotech, Beijing, China), 2.0 µL of HiFi Buffer II, 0.2 µL of HiFi (TransTaq DNA Polymerase High Fidelity, TransGen Biotech, Beijing, China), 0.4 µL of forward primer (10 µM), 0.4 µL of reverse primer (10 µM), and 0.8 µL of sample cDNA. The PCR cycling conditions were as follows: initial denaturation at 95 °C for 1 min; then, 33 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 20 s; and a final extension at 72 °C for 5 min. ORF cloning was performed by PCR using polymerase. Then, the PCR product was linked to the pMD18-T vector (Takara, China) and transformed into Trans-t1 competent cells (preparation by us) according to the product manual. Sequence comparison of the cloned genes was performed.

4.3. Sequence Analysis

The homology was first compared by the BLAST of the NCBI database, and then, the amino acid sequence of the obtained sequence was predicted and deduced by using ExPASy online protein analysis website (https://web.expasy.org/translate/, accessed on 3 November 2022). Genedoc version 2.0 software was used for protein sequence alignment. MEGA 7.0 software was subsequently used to construct the phylogenetic tree of PflaPBPs and other lepidopteran PBPs [80].

4.4. Tissue Expression of PflaPBPs

The expression levels of PflaPBPs in different tissues of adult moths were measured by qRT-PCR. GAPDH and TUB2 were used as internal reference genes [81]. Each treatment had three biological repeats and three technical repeats. The related qRT-PCR primers are listed in Table 3. Primers for qRT-PCR were evaluated before the expression evaluation with five times gradient dilution of the cDNA as DNA template to calculate PCR efficiency(E): E = 10−1/k − 1, where k is the slope of standard curve and regression coefficient: Cq = −klgX0 + b, where Cq is the threshold cycle, k is the slope of standard curve, X0 is the template concentration. The PCR system (10 µL) was prepared on ice according to the following system: 5 µL of SYBR® Premix Ex Taq™ II (Tli RNaseH Plus), 2.6 µL of ddH2O, 0.2 µL of each primer (forward and reverse primers, 10 µM), and 2.0 µL of cDNA template. The qRT-PCR procedure was as follows: 95 °C for 3 s; 40 cycles at 95 °C for 5 s and at 60 °C for 30 s; and melting curve analysis at 95 °C for 15 s; 60 °C for 1 min; and 95 °C for 15 s. For tissue expression of PflaPBPs, cDNA samples were all diluted 20 times, and the obtained data were normalized by the 2−ΔΔCt method [82].

4.5. Expression and Purification

The target fragments PflaPBP1 and PflaPBP2 were subcloned into the BamHI and XhoI sites of pATX-sumo expression vectors. Single colonies containing recombinant plasmids were selected from the plate and inoculated in 5 mL of Luria-Bertani (LB) medium containing kanamycin (50 μg/mL) overnight at 37 °C. Subsequently, 200 μL was inoculated into 20 mL of LB medium containing antibiotics and incubated at 37 °C until OD600 = 0.6. Then, the cells were transformed into T7E and BL21 strains, and isopropyl-β-D-thiogalactopyranoside (IPTG) was added at 16 °C for 16 h. The target protein with an N-terminal 6*His tag was expressed and purified. Samples were collected, and 12,000 rpm centrifugation for 1 min was used to collect the bacteria. An ultrasound device was used to lyse bacterial cells suspended in 200 μL of phosphate-buffered saline (PBS). The ultrasound time was 2 s, and the interval was 2 s, totaling 4 min. The supernatant and precipitate were separated by centrifugation at 12,000 rpm for 2 min. The retained final PflaPBPs were in the supernatant and applied for purification by nickel column affinity chromatography (Thermo, USA) according to the manufacturer’s specifications with two washes. Recombinant bovine enterokinase was added to the eluted proteins and incubated at 26 °C for 10 h to remove the His-tags from the recombinant proteins. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (12%, 80 V concentrated gel, 20 min, 120 V separated gel, 45 min) was performed to assess the protein expression and purification. The purified protein was dialyzed in Tris buffer (pH 7.4 and pH 5.0), subpackaged and frozen in a −80 °C ultralow temperature refrigerator.

4.6. Probe Test and Fluorescence Binding Assays

An RF-5301PC fluorescence spectrophotometer (Shimadzu, Kyoto, Japan) was used in this experiment for fluorescence competitive binding analysis with a 1-cm quartz colorimetric cup at room temperature. N-Phenyl-1-naphthylamine (1-NPN) was used as the probe and applied for the suitability test. The 1-NPN was excited at 337 nm, in which the emission spectra were recorded between 350 and 660 nm. The purified PflaPBP1 and PflaPBP2 were diluted to a final concentration of 2 µM of the protein solution in Tris-HCl buffer and titrated with aliquots of 1 mM 1-NPN dissolved in methanol, which were 0, 2, 4, 8, 12, 16, 20 µM. The maximum fluorescence value (manipulate peak pick) of each excitation was recorded. The binding data were obtained from three independent measurements. The dissociation constants of PflaPBP1/PflaPBP2 for 1-NPN were calculated from Scatchard plots of the binding data by using Prism 5 software (GraphPad, La Jolla, CA, USA) with nonlinear regression for the one site-specific binding method.
The two sex pheromones Z-9-hexadecenal (Z9H, 96.3% chemical purity) and (Z, Z, Z)-9,12,15-octadecatrienal (Z9O, 93% chemical purity) were obtained from Shanghai T & W Pharmaceutical Co., Ltd. (Shanghai, China) and Pherobank BV (Wijk bij Duurstede, The Netherlands) [32]. The competitive binding of these two sex pheromone components was measured using 1-NPN (2 µM) as the fluorescent probe with a stoichiometry of 1:1 (protein: ligand). PflaPBP1 or PflaPBP2 was titrated to a final concentration of 2 μmol/L with 50 mM Tris-HCl buffer. The sex pheromone dissolved in methanol was gradually added to the mixed solution of protein and 1-NPN with the final concentration of each ligand added to the sample ranging from 0 μM to 20 μM. All sets of fluorescence spectrophotometers were the same as above. The binding data were obtained from three independent measurements. Reduction in relative fluorescence intensity indicated that the competing compound displaced 1-NPN from the binding site of PflaPBP1 or PflaPBP2. The following formula was adopted to calculate the binding affinities (Ki): K i = [ I C 50 ] 1 + [ 1 N P N / K 1 N P N ] ) where [1-NPN] is the free concentration of 1-NPN, [IC50] is the ligand concentration replacing 50% of the fluorescence reporter, and K1-NPN is the dissociation constant of the PflaPBP/1-NPN complex. The data were fitted with nonlinear regression model using Prism software (version 5.0).

4.7. Three-Dimensional Structures and Molecular Docking of PflaPBPs

With the SWISS MODEL website (https://swissmodel.expasy.org/interactive, accessed on 3 November 2022), PflaPBP1 and PflaPBP2 were compared to proteins in the CSBP Protein Data Bank (PDB). The selected template sequence must be more than 30% similar to the target sequence [83]. As a model insect, B. mori is the most advanced sex pheromone binding protein in the lepidopteran family. The similarity of BmorPBP (PDB ID: 1GM0.1) to PflaPBP1 and PflaPBP2 was 57.23% and 38.15%, respectively. Therefore, this BmorPBP was selected as the structural template to establish the three-dimensional structure model of PflaPBP1 and PflaPBP2.
The protein was pretreated by AutoTools and then calculated by AutoGrid. The active sites were defined as potential sites calculated by POCASA (http://altair.sci.hokudai.ac.jp/g6/service/pocasa/, accessed on 3 November 2022), and grid box coordinates were set. PflaPBP1 is (34.946, −11.031, 38.975), and the box size is 20 × 20 × 20 mesh points; PflaPBP2 is (9.028, 4.576, 32.343), the box size is 20 × 20 × 20 mesh points, and the distance of each small mesh point is 0.1 nm. AutoDock Vina was used to dock small molecules with the proteins. Finally, the dominant conformation was analyzed, and Schrodinger was used for mapping.

4.8. Statistical Analysis

Data analysis was performed using SPSS 19.0 (IBM Corp., Chicago, IL, USA). The expression of PflaPBPs was analyzed using two-way analysis of variance (ANOVA). A level of p < 0.05 was accepted as a significant difference.

Author Contributions

Conceptualization, X.-L.Z.; methodology, X.-L.Z., W.L. and X.-P.W.; software, L.C.; validation, L.C., Z.T. and J.H.; formal analysis, L.C.; investigation, X.-Y.W. and L.C.; writing—original draft preparation, X.-L.Z., L.C., W.L., M.-Q.W. and X.-Y.W.; writing—review and editing, L.C., Z.T., J.H. and X.-Y.W.; supervision, X.-L.Z., W.L., X.-Y.W., M.-Q.W. and X.-P.W.; project administration, X.-L.Z.; funding acquisition, X.-L.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (31660206 and 32260394) and the Guangxi Scholarship Fund of Guangxi Education Department.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We thank two anonymous reviewers for their constructive comments, which have significantly improved the article.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Figure A1. Nucleotides and deduced amino acid sequences of PflaPBP1 (A) and PflaPBP2 (B) of P. flammans.
Figure A1. Nucleotides and deduced amino acid sequences of PflaPBP1 (A) and PflaPBP2 (B) of P. flammans.
Ijms 24 00385 g0a1
Figure A2. Protein multiple sequence alignment of PBPs between PflaPBPs and lepidopteran insect PBPs. GenBank accession numbers: (A) P. flammans (PflaPBP1, MK948015); B. mori (BmorPBP1, AM403101); O. nubilalis (OnubPBP1, ADT78495); L. sticticalis (LstiPBP, ACD67881); D. abietella (DabiPBP, AZK90260). (B) P. flammans (PflaPBP2, MK948014); A. conjugella (AconPBP2, AFD34183); G. molesta (GmolPBP2, AHZ89398); P. rapae (PrapPBP2, XP_022118413); B. anynana (BanyPBP, XP_023936564). Red frame is six typical cysteine residues.
Figure A2. Protein multiple sequence alignment of PBPs between PflaPBPs and lepidopteran insect PBPs. GenBank accession numbers: (A) P. flammans (PflaPBP1, MK948015); B. mori (BmorPBP1, AM403101); O. nubilalis (OnubPBP1, ADT78495); L. sticticalis (LstiPBP, ACD67881); D. abietella (DabiPBP, AZK90260). (B) P. flammans (PflaPBP2, MK948014); A. conjugella (AconPBP2, AFD34183); G. molesta (GmolPBP2, AHZ89398); P. rapae (PrapPBP2, XP_022118413); B. anynana (BanyPBP, XP_023936564). Red frame is six typical cysteine residues.
Ijms 24 00385 g0a2
Figure A3. Rationality evaluation results of the PflaPBP1 3D model. The red points indicate amino acid residues, the green and light green areas indicate permitted areas, and the white areas indicate nonpermitted areas.
Figure A3. Rationality evaluation results of the PflaPBP1 3D model. The red points indicate amino acid residues, the green and light green areas indicate permitted areas, and the white areas indicate nonpermitted areas.
Ijms 24 00385 g0a3
Figure A4. Rationality evaluation results of the PflaPBP2 3D model. The red points indicate amino acid residues, the green and light green areas indicate permitted areas, and the white areas indicate nonpermitted areas.
Figure A4. Rationality evaluation results of the PflaPBP2 3D model. The red points indicate amino acid residues, the green and light green areas indicate permitted areas, and the white areas indicate nonpermitted areas.
Ijms 24 00385 g0a4

References

  1. Keil, T.A.; Steinbrecht, R.A. Insects as model systems in cell biology. Methods Cell Biol. 2010, 96, 363–394. [Google Scholar] [PubMed]
  2. Zhou, J.J. Odorant-binding proteins in insects. Vitam. Horm. 2010, 83, 241–272. [Google Scholar] [PubMed]
  3. Pelosi, P.; Zhou, J.J.; Ban, L.P.; Calvello, M. Soluble proteins in insect chemical communication. Cell Mol. Life Sci. 2006, 63, 1658–1676. [Google Scholar] [CrossRef] [Scilit]
  4. Fang, N.N.; Hu, Y.W.; Mao, B.; Bi, J.; Zheng, Y.; Guan, C.X.; Wang, Y.F.; Li, J.H.; Mao, Y.K.; Ai, H. Molecular characterization and functional differentiation of three pheromone-binding proteins from Tryporyza intacta. Sci. Rep. 2018, 8, 10774. [Google Scholar] [CrossRef] [Scilit]
  5. Stengl, M. Pheromone transduction in moths. Front. Cell Neurosci. 2010, 4, 133. [Google Scholar] [CrossRef] [Scilit]
  6. Gu, S.H.; Zhou, J.J.; Wang, G.R.; Zhang, Y.J.; Guo, Y.Y. Sex pheromone recognition and immunolocalization of three pheromone binding proteins in the black cutworm moth Agrotis ipsilon. Insect Biochem. Mol. Biol. 2013, 43, 237–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Holdcraft, R.; Rodriguez-Saona, C.; Stelinski, L.L. Pheromone autodetection: Evidence and implications. Insects 2016, 7, 17. [Google Scholar] [CrossRef] [Scilit]
  8. Györgyi, T.K.; Roby-Shemkovitz, A.J.; Lerner, M.R. Characterization and cDNA cloning of the pheromone-binding protein from the tobacco hornworm, Manduca sexta: A tissue-specific developmentally regulated protein. Proc. Natl. Acad. Sci. USA 1988, 85, 9851–9855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Krieger, J.; Grosse-Wilde, E.; Gohl, T.; Breer, H. Candidate pheromone receptors of the silkmoth Bombyx mori. Eur. J. Neurosci. 2005, 21, 2167–2176. [Google Scholar] [CrossRef] [Scilit]
  10. Forstner, M.; Breer, H.; Krieger, J. A receptor and binding protein interplay in the detection of a distinct pheromone component in the silkmoth Antheraea polyphemus. Int. J. Biol. Sci. 2009, 5, 745–757. [Google Scholar] [CrossRef] [Scilit]
  11. Laue, M.; Steinbrecht, R.A. Topochemistry of moth olfactory sensillae. Int. J. Insect Morphol. Embryol. 1997, 26, 217–228. [Google Scholar] [CrossRef] [Scilit]
  12. Callahan, F.E.; Vogt, R.G.; Tucker, M.L.; Dickens, J.C.; Mattoo, A.K. High level expression of “male specific” pheromone binding proteins (PBPs) in the antennae of female noctuiid moths. Insect Biochem. Mol. Biol. 2000, 30, 507–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Vogt, R.G.; Riddiford, L.M. Pheromone binding and inactivation by moth antennae. Nature 1981, 293, 161–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Feng, L.; Prestwich, G.D. Expression and characterization of a lepidopteran general odorant binding protein. Insect Biochem. Mol. Biol. 1997, 27, 405–412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Plettner, E.; Lazar, J.; Prestwich, E.G.; Prestwich, G.D. Discrimination of pheromone enantiomers by two pheromone binding proteins from the gypsy moth Lymantria dispar. Biochemistry 2000, 39, 8953–8962. [Google Scholar] [CrossRef] [Scilit]
  16. Xiu, W.M.; Dong, S.L. Molecular characterization of two pheromone binding proteins and quantitative analysis of their expression in the beet armyworm, Spodoptera exigua Hübner. J. Chem. Ecol. 2007, 33, 947–961. [Google Scholar] [CrossRef] [Scilit]
  17. Chang, H.T.; Liu, Y.; Yang, T.; Pelosi, P.; Dong, S.L.; Wang, G.R. Pheromone binding proteins enhance the sensitivity of olfactory receptors to sex pheromones in Chilo suppressalis. Sci. Rep. 2015, 5, 13093. [Google Scholar] [CrossRef] [Scilit]
  18. Tian, Z.; Qiu, G.; Li, Y.; Zhang, H.; Yan, W.; Yue, Q.; Sun, L. Molecular characterization and functional analysis of pheromone binding proteins and general odorant binding proteins from Carposina sasakii Matsumura (Lepidoptera: Carposinidae). Pest Manag. Sci. 2019, 75, 234–245. [Google Scholar] [CrossRef] [Scilit]
  19. Sun, M.; Liu, Y.; Walker, W.B.; Liu, C.; Lin, K.; Gu, S.; Zhang, Y.J.; Zhou, J.J.; Wang, G. Identification and characterization of pheromone receptors and interplay between receptors and pheromone binding proteins in the diamondback moth, Plutella xyllostella. PLoS ONE 2013, 8, e62098. [Google Scholar] [CrossRef] [Scilit]
  20. Dong, K.; Sun, L.; Liu, J.T.; Gu, S.H.; Zhou, J.J.; Yang, R.N.; Dhiloo, K.H.; Gao, X.W.; Guo, Y.Y.; Zhang, Y.J. RNAi-induced electrophysiological and behavioral changes reveal two pheromone binding proteins of Helicoverpa armigera involved in the perception of the main sex pheromone component Z11-16: Ald. J. Chem. Ecol. 2017, 43, 207–214. [Google Scholar] [CrossRef] [Scilit]
  21. Krieger, J.; Grosse-Wilde, E.; Gohl, T.; Dewer, Y.M.E.; Raming, K.; Breer, H. Genes encoding candidate pheromone receptors in a moth (Heliothis virescens). Proc. Natl. Acad. Sci. USA 2004, 101, 11845–11850. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Zielonka, M.; Breer, H.; Krieger, J. Molecular elements of pheromone detection in the female moth, Heliothis virescens. Insect Sci. 2018, 25, 389–400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Mao, A.; Zhou, J.; Mao, B.; Zheng, Y.; Wang, Y.F.; Li, D.Q.; Wang, P.; Liu, K.Y.; Wang, X.P. Sex pheromone recognition and characterization of three pheromone-binding proteins in the legume pod borer, Maruca vitrata Fabricius (Lepidoptera: Crambidae). Sci. Rep. 2016, 6, 34484. [Google Scholar] [CrossRef] [Scilit]
  24. Yu, Y.X.; Zhou, P.; Zhang, J.J.; Zheng, C.; Zhang, J.; Chen, N.Z. Pheromone-binding proteins in the Asian gypsy moth females, Lymantria dispar, recognizing the sex pheromone and plant volatiles. Arch. Insect Biochem. 2018, 99, e21477. [Google Scholar] [CrossRef] [Scilit]
  25. Ye, Z.F.; Liu, X.L.; Han, Q.; Liao, H.; Dong, X.T.; Zhu, G.H.; Dong, S.L. Functional characterization of PBP1 gene in Helicoverpa armigera (Lepidoptera: Noctuidae) by using the CRISPR/Cas9 system. Sci. Rep. 2017, 7, 8470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Shiota, Y.; Sakurai, T.; Daimon, T.; Mitsuno, H.; Fujii, T.; Matsuyama, S.; Sezutsu, H.; Ishikawa, Y.; Kanzaki, R. In vivo functional characterisation of pheromone binding protein-1 in the silkmoth, Bombyx mori. Sci. Rep. 2018, 8, 13529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Monteys, V.S.I.; Acín, P.; Rosell, G.; Quero, C.; Jiménez, M.A.; Guerrero, A. Moths behaving like butterflies. Evolutionary loss of long range attractant pheromones in Castniid moths: A paysandisia archon model. PLoS ONE 2012, 7, e29282. [Google Scholar]
  28. Subchev, M.A. Sex pheromone communication in the family Zygaenidae (Insecta: Lepidoptera): A review. Acta Zool. Bulg. 2014, 66, 147–157. [Google Scholar]
  29. Liu, J.Y. Reproductive Biology of Phauda flammans. Master’s Thesis, Guangxi University, Nanning, China, 2018. [Google Scholar]
  30. Sasaerila, Y.; Gries, G.; Khaskin, G.; Gries, R. Identification of sex pheromone components of nettle caterpillar, Setothosea asigna. J. Chem. Ecol. 1997, 23, 2187–2196. [Google Scholar] [CrossRef] [Scilit]
  31. Wakamura, S.; Tanaka, H.; Masumoto, Y.; Sawada, H.; Toyohara, N. Sex pheromone of the blue-striped nettle grub moth Parasa lepida (Cramer) (Lepidoptera: Limacodidae): Identification and field attraction. Appl. Entomol. Zool. 2007, 42, 347–352. [Google Scholar] [CrossRef] [Scilit]
  32. Zheng, X.L.; Liu, J.Y.; Zhang, Z.L.; Wang, P.; Lu, W. Diel rhythms of sexual behavior and pheromone responses in Phauda flammans Walker (Lepidoptera: Zygaenidae). Pest Manag. Sci. 2019, 75, 3070–3075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Subchev, M.A.; Harizanov, A.; Francke, W.; Franke, S.; Plass, E.; Reckziegel, A.; Schroder, F.; Pickett, J.A.; Wadhams, L.J.; Woodcock, C.M. Sex pheromone of the female vine bud moth, Theresimima ampellophaga Bayle-Barelle (Lepidoptera: Zygaenidae), comprises (2S)-butyl (7Z)-tetradeceonate. J. Chem. Ecol. 1998, 24, 1141–1151. [Google Scholar] [CrossRef] [Scilit]
  34. Subchev, M.A.; Toshova, T.; Tóth, M.; Voigt, E.; Mikulás, J.; Francke, W. Catches of vine bud moth Theresimima ampellophaga (Lepidoptera: Zygaenidae: Procridinae) males in pheromone traps: Effect of the purity and age of baits, design, colour and height of the traps, and daily sexual activity of males. J. Appl. Entomol. 2004, 128, 44–50. [Google Scholar] [CrossRef] [Scilit]
  35. Subchev, M.A.; Toshova, T.B.; Koshio, C.H.; Franke, S.; Tröger, A.; Twele, R.; Francke, W.; Pickett, J.A.; Wadhams, L.J.; Woodcock, C.M. Identification and biological activity of sex pheromone components from females of the plum moth Illiberis rotundata Jordan (Lepidoptera: Zygaenidae: Procridinae). Chemoecology 2009, 19, 47–54. [Google Scholar] [CrossRef] [Scilit]
  36. Subchev, M.A.; Efetov, K.A.; Toshova, T.B.; Koshio, C.H. Sex pheromones as isolating mechanisms in two closely related Illiberis species—1. (Primilliberis) rotundata Jordan, 1907, and I. (P.) pruni Dyar, 1905 (Lepidoptera: Zygaenidae: Procridinae). Entomol. Gaz. 2016, 67, 51–57. [Google Scholar]
  37. Efetov, K.A.; Can, F.; Toshova, T.B.; Subchev, M.A. New sex attractant for Jordanita anatolica (Naufock) (Lepidoptera: Zygaenidae: Procridinae). Acta Zool. Bulg. 2010, 62, 315–319. [Google Scholar]
  38. Efetov, K.A.; Kucherenko, E.E.; Parshkova, E.V.; Tarmann, G.M. 2-butyl 2-dodecenoate, a new sex attractant for Jordanita (Tremewania) notata (Zeller, 1847) and some other Procridinae species (Lepidoptera: Zygaenidae). SHILAP Revta. Lepid. 2016, 44, 519–527. [Google Scholar]
  39. Efetov, K.A.; Kucherenko, E.E.; Tarmann, G.M. New synthetic sex attractants for the males of two endemic Iberian Procridinae species (Lepidoptera: Zygaenidae). SHILAP Revta. lepid. 2019, 47, 307–315. [Google Scholar]
  40. Nageshchandra, B.K.; Rajagopal, B.K.; Balasubramanian, R. Occurrence of slug caterpillar Phauda flammans Wlk. (Lepidoptera: Zygaenidae) on Ficus racemosa L. in south India. Mysore. J. Agr. Sci. 1972, 6, 186–189. [Google Scholar]
  41. Verma, T.D.; Dogra, G.S. Occurrence of Phauda flammans Wlk. (Lepidoptera: Zygaenidae) on ficus species in Himachal Pradesh. J. Tree Sci. 1982, 1, 130–132. [Google Scholar]
  42. Fof. Diurnal Leaf Skeletonizing Moth from Vietnam: Phauda flammans. What’s That Bug. 2015. Available online: https://www.whatsthatbug.com/diurnal-leaf-skeletonizing-moth-from-vietnam-phauda-flammans/ (accessed on 3 November 2022).
  43. Liu, J.Y.; He, Q.L.; Wei, H.; Yang, J.; Li, J.; Lu, W.; Zheng, X.L. Biological characteristics of Phauda flammans (Lepidoptera: Zygaenidae). Plant Protect. 2015, 41, 188–192. [Google Scholar]
  44. Liu, J.Y.; Ma, Z.H.; Wu, S.Y.; Lin, M.Y.; Zhang, J.; Lu, W.; Zheng, X. L, Studies on the feeding preferences of Phauda flammans Walker (Lepidoptera: Zygaenidae). J. Environ. Entomol. 2016, 38, 924–930. [Google Scholar]
  45. Anonymous. Hosts—A Database of the World’s Lepidopteran Hostplants. The Natural History. 2019. Available online: http://www.nhm.ac.uk/our-science/data/hostplants/search/list.dsml?beginIndex=140280&browse.dsml=Callidulidae%253D%253D%253D%253DFamily (accessed on 3 November 2022).
  46. Zheng, X.L.; Li, J.; Su, L.; Liu, J.Y.; Meng, L.Y.; Lin, M.Y.; Zhang, J.; Lu, W. Ecological and morphological characteristics of parasitoids in Phauda flammans (Lepidoptera, Zygaenidae). Parasite 2015, 22, 36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Huang, A.L.; Meng, L.L.; Zhang, W.; Liu, J.Y.; Li, G.Y.; Tan, H.H.; Lu, W.; Zheng, X.L. Effects of five pesticides on toxicity, detoxifying and protective enzymes in Phauda flammans Walker (Lepidoptera: Zygaenidae). Pak. J. Zool. 2019, 51, 1457–1463. [Google Scholar] [CrossRef] [Scilit]
  48. Xu, R.; Kuang, R.P.; Pay, E.; Dou, H.; de Snoo, G.R. Factors contributing to overuse of pesticides in western China. Environ. Sci. 2008, 5, 235–249. [Google Scholar] [CrossRef] [Scilit]
  49. McNeil, J.N. Behavioral ecology of pheromone-mediated communication in moths and its importance in the use of pheromone traps. Annu. Rev. Entomol. 1991, 36, 407–430. [Google Scholar] [CrossRef]
  50. Liu, J.Y.; Zhang, Y.J.; Huang, Z.Y.; Dong, Z.S.; Duan, Y.B.; Lu, W.; Zheng, X.L. Ultrastructural observations of antennal sensilla in Phauda flammans Walker (Lepidoptera: Zygaenidae). J. Entomol. Sci. 2018, 53, 281–294. [Google Scholar] [CrossRef] [Scilit]
  51. Keil, T.A. Fine structure of the pheromone-sensitive sensilla on the antenna of the hawkmoth, Manduca sexta. Tissue Cell 1989, 21, 139–151. [Google Scholar] [CrossRef] [Scilit]
  52. Ebbinghaus, D.; Lösel, P.M.; Lindemann, M.; Scherkenbeck, J.; Zebitz, C.P.W. Detection of major and minor sex pheromone components by the male codling moth Cydia pomonella (Lepidoptera: Tortricidae). J. Insect Physiol. 1997, 44, 49–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Maida, R.; Mameli, M.; Muller, B.; Krieger, J.; Steinbrecht, R. The expression pattern of four odorant-binding proteins in male and female silk moths, Bombyx mori. J. Neurocytol. 2005, 34, 149–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Sakurai, T.; Namiki, S.; Kanzaki, R. Molecular and neural mechanisms of sex pheromone reception and processing in the silkmoth Bombyx mori. Front. Physiol. 2014, 5, 125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Lundberg, S.; Löfstedt, C. Intra-specific competition in the sex communication channel: A selective force in the evolution of moth pheromones? J. Theor. Biol. 1987, 125, 15–24. [Google Scholar] [CrossRef] [Scilit]
  56. Zheng, X.L.; Liu, J.Y.; Lu, W.; He, X.Z.; Wang, Q. Mating delay reduces reproductive performance but not longevity in a monandrous moth. J. Insect Sci. 2020, 20, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Harari, A.R.; Zahavi, T.; Thiéry, D. Fitness cost of pheromone production in signaling female moths. Evolution 2011, 65, 1572–1582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Harari, A.R.; Steinitz, H. The evolution of female sex pheromones. Curr. Zool. 2013, 59, 569–578. [Google Scholar] [CrossRef] [Scilit]
  59. Schneider, D.; Schulz, S.; Priesner, E.; Ziesmann, J.; Francke, W. Autodetection and chemistry of female and male pheromone in both sexes of the tiger moth Panaxia quadripunctaria. J. Comp. Physiol. A 1998, 182, 153–161. [Google Scholar] [CrossRef] [Scilit]
  60. Lim, H.; Greenfield, M.D. Female arctiid moths, Utetheisa ornatrix, orient towards and join pheromonal choruses. Anim. Behav. 2008, 75, 673–680. [Google Scholar] [CrossRef] [Scilit]
  61. Thode, A.B.; Kruse, S.W.; Nix, J.C.; Jones, D.N.M. The role of multiple hydrogen bonding groups in specific alcohol binding sites in proteins: Insights from structural studies of LUSH. J. Mol. Biol. 2008, 376, 1360–1376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Zhang, G.; Chen, J.; Yu, H.; Tian, X.; Wu, J. Molecular and functional characterization of pheromone binding protein 1 from the oriental fruit moth, Grapholita molesta (Busck). Sci. Rep. 2018, 8, 2276. [Google Scholar] [CrossRef] [Scilit]
  63. Zhu, J.; Ban, L.; Song, L.M.; Liu, Y.; Pelosi, P.; Wang, G. General odorant-binding proteins and sex pheromone guide larvae of Plutella xylostella to better food. Insect Biochem. Mol. Biol. 2016, 72, 10–19. [Google Scholar] [CrossRef] [Scilit]
  64. Liu, H.; Duan, H.; Wang, Q.; Xiao, Y.; Wang, Q.; Xiao, Q.; Sun, L.; Zhang, Y. Key Amino Residues Determining Binding Activities of the Odorant Binding Protein AlucOBP22 to Two Host Plant Terpenoids of Apolygus lucorum. J. Agric. Food Chem. 2019, 67, 5949–5956. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Zhang, X.Q.; Mang, D.Z.; Liao, H.; Ye, J.; Qian, J.L.; Dong, S.L.; Zhang, Y.N.; He, P.; Zhang, Q.H.; Purba, E.R.; et al. Functional Disparity of Three Pheromone-Binding Proteins to Different Sex Pheromone Components in Hyphantria cunea (Drury). J. Agric. Food Chem. 2021, 69, 55–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Iga, M.; Smagghe, G. Identification and expression profile of Halloween genes involved in ecdysteroid biosynthesis in Spodoptera littoralis. Peptides 2010, 31, 456–467. [Google Scholar] [CrossRef] [Scilit]
  67. Johnson, J.A.; Bitra, K.; Zhang, S.; Wang, L.; Lynn, D.E.; Strand, M.R. The UGACiE1 cell line from Chrysodeixis includens exhibits characteristics of granulocytes and is permissive to infection by two viruses. Insect Biochem. Mol. Biol. 2010, 40, 394–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Terenius, O.; Papanicolaou, A.; Garbutt, J.S.; Eleftherianos, I.; Huvenne, H.; Kanginakudru, S.; Albrechtsen, M.; An, C.; Aymeric, J.L.; Barthel, A.; et al. RNA interference in Lepidoptera: An overview of successful and unsuccessful studies and implications for experimental design. J. Insect Physiol. 2011, 57, 231–245. [Google Scholar] [CrossRef] [Scilit]
  69. Zhu, F.; Xu, J.J.; Palli, R.; Ferguson, J.; Palli, S.R. Ingested RNA interference for managing the populations of the Colorado potato beetle, Leptinotarsa decemlineata. Pest Manag. Sci. 2011, 67, 175–182. [Google Scholar] [CrossRef] [Scilit]
  70. Scott, J.G.; Michel, K.; Bartholomay, L.C.; Siegfried, B.D.; Hunter, W.B.; Smagghe, G.; Zhu, K.Y.; Douglas, A.E. Towards the elements of successful insect RNAi. J. Insect Physiol. 2013, 59, 1212–1221. [Google Scholar] [CrossRef] [Scilit]
  71. Palli, S.R. RNA interference in Colorado potato beetle: Steps toward development of dsRNA as a commercial insecticide. Curr. Opin. Insect Sci. 2014, 6, 1–8. [Google Scholar] [CrossRef] [Scilit]
  72. Shukla, J.N.; Kalsi, M.; Sethi, A.; Narva, K.E.; Fishilevich, E.; Singh, S.; Mogilicherla, K.; Palli, S.R. Reduced stability and intracellular transport of dsRNA contribute to poor RNAi response in lepidopteran insects. RNA Biol. 2016, 13, 656–669. [Google Scholar] [CrossRef] [Scilit]
  73. Groot, A.T.; Marr, M.; Schöfl, G.; Lorenz, S.; Svatos, A.; Heckel, D.G. Host strain specific sex pheromone variation in Spodoptera frugiperda. Front. Zool. 2008, 5, 20. [Google Scholar] [CrossRef] [Scilit]
  74. Sun, J.B.; Liu, N.Y.; Li, S.M.; Yan, Q.; Dong, S.L. Molecular cloning, tissue expression profiling and binding characterization of the pheromone binding protein SlitPBP4 from Spodoptera litura (Lepidoptera: Noctuidae). Acta Entomol. Sin. 2018, 61, 657–667. [Google Scholar]
  75. Hu, Y.; Liu, Y.; Bi, J.; Chen, Y.; Zheng, Y.; Mao, Y.; Mao, Y.; Xu, H.; Guan, C.; Chen, Y.; et al. Field evaluation of sex pheromones and binding specificity of pheromone binding protein 4 in Tryporyza intacta (Lepidoptera: Crambidae). Sci. Rep. 2020, 10, 5464. [Google Scholar] [CrossRef] [Scilit]
  76. Forstner, M.; Gohl, T.; Breer, H.; Krieger, J. Candidate pheromone binding proteins of the silkmoth Bombyx mori. Invert. Neurosci. 2006, 6, 177–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Hu, J.; Wang, X.Y.; Tan, L.S.; Lu, W.; Zheng, X.L. Identification of chemosensory genes, including candidate pheromone receptors, in Phauda flammans (Walker) (Lepidoptera: Phaudidae) through transcriptomic analyses. Front. Physiol. 2022, 13, 907694. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. Ma, M.; Chang, M.M.; Lei, C.L.; Yang, F.L. A garlic substance disrupts odorant-binding protein recognition of insect pheromones released from adults of the angoumois grain moth, Sitotroga cerealella(Lepidoptera: Gelechiidae). Insect Mol. Biol. 2016, 25, 530–540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Mao, Y.T.; Jia, R.J.; Zhu, C.Q.; Shi, X.H.; Zhang, S.N.; Ma, T.; Wen, X.J. Identification of sexing and observation on reproductive system of Phauda flammans. J. Zhejiang Forest. Sci. Technol. 2017, 37, 87–92. [Google Scholar]
  80. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
  81. Chen, L.; Tian, Z.; Wang, X.Y.; Chen, X.M.; Lu, W.; Wang, X.P.; Zheng, X.L. Screening of Reference Genes for Quantitative Real-Time PCR in Phauda flammans (Walker) (Lepidoptera: Phaudidae). J. Environ. Entomol. 2021, 43, 15–24. [Google Scholar]
  82. Shakeel, M.; Rodriguez, A.; Tahir, U.B.; Jin, F. Gene expression studies of reference genes for quantitative real-time PCR: An overview in insects. Biotechnol. Lett. 2018, 40, 227–236. [Google Scholar] [CrossRef] [Scilit]
  83. Schwede, T.; Kopp, J.; Guex, N.; Peitsch, M.C. Swiss-model: An automated protein homology-modeling server. Nucleic. Acids. Res. 2003, 31, 3381–3385. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Phylogenetic tree of PflaPBP amino acid sequences with other PBPs from different insect species. The tree was constructed by the maximum likelihood method of MEGA (v7.0). Bootstrap support values (%) based on 1000 replicates are indicated. The PBP of P. flammans is indicated with ▲. PBPs are from different Lepidoptera. GenBank accession numbers: P. flammans (PflaPBP1, MK948015; PflaPBP2, MK948014), B. mori (BmorPBP1, AGR44778; BmorPBP2, CAL47308), S. cerealella (ScerPBP, AII15786), Pectinophora gossypiella (PgosPBP, AAF06141), Hyposmocoma kahamanoa (HkahPBP, XP_026321043), Eogystia hippophaecolus (Ehip, AOG12881), M. sexta (MsexPBP, XP_030025610; MsexPBP2, AAF16710), Cnaphalocrocis medinalis (CmedPBP1, AFG72999), D. abietella (DabiPBP, AZK90260), O. nubilalis (OnubPBP1, ADT78495), L. sticticalis (LstiPBP, ACD67881), Atrijuglans hetaohei (AhetPBP2, AKA27976), Cydia pomonella (CpomPBP2, AFL91693), Grapholita molesta (GmolPBP2, AHZ89398), Argyresthia conjugella (AconPBP2, AFD34183), B. anynana (BanyPBP, XP_023936564), P. rapae (PrapPBP2, XP_022118413).
Figure 1. Phylogenetic tree of PflaPBP amino acid sequences with other PBPs from different insect species. The tree was constructed by the maximum likelihood method of MEGA (v7.0). Bootstrap support values (%) based on 1000 replicates are indicated. The PBP of P. flammans is indicated with ▲. PBPs are from different Lepidoptera. GenBank accession numbers: P. flammans (PflaPBP1, MK948015; PflaPBP2, MK948014), B. mori (BmorPBP1, AGR44778; BmorPBP2, CAL47308), S. cerealella (ScerPBP, AII15786), Pectinophora gossypiella (PgosPBP, AAF06141), Hyposmocoma kahamanoa (HkahPBP, XP_026321043), Eogystia hippophaecolus (Ehip, AOG12881), M. sexta (MsexPBP, XP_030025610; MsexPBP2, AAF16710), Cnaphalocrocis medinalis (CmedPBP1, AFG72999), D. abietella (DabiPBP, AZK90260), O. nubilalis (OnubPBP1, ADT78495), L. sticticalis (LstiPBP, ACD67881), Atrijuglans hetaohei (AhetPBP2, AKA27976), Cydia pomonella (CpomPBP2, AFL91693), Grapholita molesta (GmolPBP2, AHZ89398), Argyresthia conjugella (AconPBP2, AFD34183), B. anynana (BanyPBP, XP_023936564), P. rapae (PrapPBP2, XP_022118413).
Ijms 24 00385 g001
Figure 2. Relative transcript levels of PflaPBP1 (A) and PflaPBP2 (B) in different adult tissues of P. flammans. All values are shown as the mean ± standard error of the mean (SEM). N-values is 3.
Figure 2. Relative transcript levels of PflaPBP1 (A) and PflaPBP2 (B) in different adult tissues of P. flammans. All values are shown as the mean ± standard error of the mean (SEM). N-values is 3.
Ijms 24 00385 g002
Figure 3. Production and purification scale-up of target proteins. SDS-PAGE with Coomassie blue staining of PflaPBP1 (A) and PflaPBP2 (B). MW, molecular weight marker. 1. Before cleavage; 2. after cleavage; 3. final sample; 4. boiled Ni resin; His-sumo, histidine-small ubiquitin related modifier.
Figure 3. Production and purification scale-up of target proteins. SDS-PAGE with Coomassie blue staining of PflaPBP1 (A) and PflaPBP2 (B). MW, molecular weight marker. 1. Before cleavage; 2. after cleavage; 3. final sample; 4. boiled Ni resin; His-sumo, histidine-small ubiquitin related modifier.
Ijms 24 00385 g003
Figure 4. Binding curves of 1-NPN and relative Scatchard plots (insets) for PflaPBP1 ((A), R2 = 0.9597, p < 0.001; inset: R2 = 0.9971, p < 0.001) and PflaPBP2 ((B), R2 = 0.9833, p < 0.001; inset: R2 = 0.9585, p < 0.001) in P. flammans. All values are shown as the mean ± SEM. N-values is 3.
Figure 4. Binding curves of 1-NPN and relative Scatchard plots (insets) for PflaPBP1 ((A), R2 = 0.9597, p < 0.001; inset: R2 = 0.9971, p < 0.001) and PflaPBP2 ((B), R2 = 0.9833, p < 0.001; inset: R2 = 0.9585, p < 0.001) in P. flammans. All values are shown as the mean ± SEM. N-values is 3.
Ijms 24 00385 g004
Figure 5. Competitive binding curves of two sex pheromones to PflaPBP1 ((A), Z-9-hexadecenal, R2 = 0.9585, p < 0.001; (Z, Z, Z)-9, 12, 15-octadecatrienal, R2 = 0.9890, p < 0.001) and PflaPBP2 ((B), Z-9-hexadecenal, R2 = 0.9468, p < 0.001; (Z, Z, Z)-9, 12, 15-octadecatrienal, R2 = 0.9791, p < 0.001) of P. flammans. All values are shown as the mean ± SEM. N-values is 3.
Figure 5. Competitive binding curves of two sex pheromones to PflaPBP1 ((A), Z-9-hexadecenal, R2 = 0.9585, p < 0.001; (Z, Z, Z)-9, 12, 15-octadecatrienal, R2 = 0.9890, p < 0.001) and PflaPBP2 ((B), Z-9-hexadecenal, R2 = 0.9468, p < 0.001; (Z, Z, Z)-9, 12, 15-octadecatrienal, R2 = 0.9791, p < 0.001) of P. flammans. All values are shown as the mean ± SEM. N-values is 3.
Ijms 24 00385 g005
Figure 6. Three-dimensional structural models of PflaPBP1 (A) and PflaPBP2 (B) of P. flammans. The structural models were constructed by SWISS MODEL. N is the N-terminus, C is the C-terminus, and the seven helices are also labeled. (C) The amino acid sequence alignment of PflaPBP1, PflaPBP2, and BmorPBP.
Figure 6. Three-dimensional structural models of PflaPBP1 (A) and PflaPBP2 (B) of P. flammans. The structural models were constructed by SWISS MODEL. N is the N-terminus, C is the C-terminus, and the seven helices are also labeled. (C) The amino acid sequence alignment of PflaPBP1, PflaPBP2, and BmorPBP.
Ijms 24 00385 g006
Figure 7. Molecular docking of PflaPBPs to two sex pheromones of P. flammans. (A) Binding mode of PflaPBP1 with Z-9-hexadecenal. Z-9-hexadecenal is presented as a green stick model with the hydroxyl oxygen in red. The blue sticks represent Leu 169 and Ile 170, which form hydrogen bonds with Z-9-hexadecenal alcohol; (B) diagram of the van der Waals interactions and hydrophobic interactions of Z-9-hexadecenal alcohol with PflaPBP1 key binding site residues; (C) the orientation and conformation of Z-9-hexadecenal alcohol and the hydrogen bond reaction in the PflaPBP1 active area; (D) binding mode of PflaPBP1 with (Z, Z, Z)-9, 12, 15-octadecatrienal. (Z, Z, Z)-9, 12, 15-octadecatrienal is presented as a green stick model with the hydroxyl oxygen in red. Blue sticks represent Ile 170 that forms hydrogen bonds with (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol; (E) diagram of the van der Waals interactions and hydrophobic interactions of (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol with PflaPBP1 key binding site residues; (F) the orientation and conformation of (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol and the hydrogen bond reaction in the PflaPBP1 active area; (G) binding mode of PflaPBP2 with (Z, Z, Z)-9, 12, 15-octadecatrienal. (Z, Z, Z)-9, 12, 15-octadecatrienal is presented as a green stick model with the hydroxyl oxygen in red. Blue sticks represent Lys 69 that forms hydrogen bonds with (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol; (H) diagram of the van der Waals interactions and hydrophobic interactions of (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol with PflaPBP2 key binding site residues; (I) the orientation and conformation of (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol and the hydrogen bond reaction in the PflaPBP2 active area.
Figure 7. Molecular docking of PflaPBPs to two sex pheromones of P. flammans. (A) Binding mode of PflaPBP1 with Z-9-hexadecenal. Z-9-hexadecenal is presented as a green stick model with the hydroxyl oxygen in red. The blue sticks represent Leu 169 and Ile 170, which form hydrogen bonds with Z-9-hexadecenal alcohol; (B) diagram of the van der Waals interactions and hydrophobic interactions of Z-9-hexadecenal alcohol with PflaPBP1 key binding site residues; (C) the orientation and conformation of Z-9-hexadecenal alcohol and the hydrogen bond reaction in the PflaPBP1 active area; (D) binding mode of PflaPBP1 with (Z, Z, Z)-9, 12, 15-octadecatrienal. (Z, Z, Z)-9, 12, 15-octadecatrienal is presented as a green stick model with the hydroxyl oxygen in red. Blue sticks represent Ile 170 that forms hydrogen bonds with (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol; (E) diagram of the van der Waals interactions and hydrophobic interactions of (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol with PflaPBP1 key binding site residues; (F) the orientation and conformation of (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol and the hydrogen bond reaction in the PflaPBP1 active area; (G) binding mode of PflaPBP2 with (Z, Z, Z)-9, 12, 15-octadecatrienal. (Z, Z, Z)-9, 12, 15-octadecatrienal is presented as a green stick model with the hydroxyl oxygen in red. Blue sticks represent Lys 69 that forms hydrogen bonds with (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol; (H) diagram of the van der Waals interactions and hydrophobic interactions of (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol with PflaPBP2 key binding site residues; (I) the orientation and conformation of (Z, Z, Z)-9, 12, 15-octadecatrienal alcohol and the hydrogen bond reaction in the PflaPBP2 active area.
Ijms 24 00385 g007
Table 1. Effects of tissue and sex in the expression levels of PflaPBP1 in P. flammans.
Table 1. Effects of tissue and sex in the expression levels of PflaPBP1 in P. flammans.
NameType III Sum of SquaresdfMean SquareFp ValuePartial Eta Squared
Corrected Model2364.730 a11214.9751651.377p < 0.0010.999
Intercept507.9171507.9173901.664p < 0.0010.994
Tissue2233.9535446.7913432.113p < 0.0010.999
Sex21.300121.300163.621p < 0.0010.872
Tissue × Sex109.477521.895168.194p < 0.0010.972
Error3.124240.130
Total2875.77136
Corrected Total2367.85435
a R2 = 0.999 (adjusted R2 = 0.998).
Table 2. Effects of tissue and sex in the expression levels of PflaPBP2 in P. flammans.
Table 2. Effects of tissue and sex in the expression levels of PflaPBP2 in P. flammans.
NameType III Sum of SquaresdfMean SquareFp ValuePartial Eta Squared
Corrected Model 3,672,802.496 a 11 333,891.136 28.018 p < 0.001 0.928
Intercept 699,379.439 1 699,379.439 58.687 p < 0.001 0.710
Tissue 3,464,396.971 5 692,879.394 58.142 p < 0.001 0.924
Sex 34,945.539 1 34,945.539 2.932 p > 0.050 0.109
Tissue × Sex 173,459.986 5 34,691.997 2.911 p < 0.050 0.378
Error 286,009.418 24 11,917.059
Total 4,658,191.353 36
Corrected Total 3,958,811.915 35
a R2 = 0.928 (adjusted R2 = 0.895).
Table 3. Binding affinities of two sex pheromones to PflaPBPs of P. flammans.
Table 3. Binding affinities of two sex pheromones to PflaPBPs of P. flammans.
LigandsCAS No.PflaPBP1PflaPBP2
IC50 (μM)Ki (μM)IC50 (μM)Ki (μM)
Z-9-hexadecenal56219-04-629.1321.26148.92108.68
(Z, Z, Z)-9, 12, 15-octadecatrienal26537-71-352.7338.4833.9524.80
Table 4. Primers for gene cloning and qRT-PCR in P. flammans.
Table 4. Primers for gene cloning and qRT-PCR in P. flammans.
GenePrimer Sequence (5′-3′)Amplicon Length (bp)PCR EfficiencyRegression Coefficient
Gene cloning
PflaPBP1F: AGCAAAACTGGTACGTGAGA740n.a.n.a.
R: AAGCAAAGTGAATGCGTTTTATGT
PflaPBP2F: TGATCAGAGAGTTGAACGTGAA600n.a.n.a.
R: CCTTCATTCAATGCCTGGTCC
qRT-PCR
PflaPBP1F: TGAAGAGGGATACTGGGTGTGT1401.0110.999
R: TTGTGAAGCGGTTTCCTCGG
PflaPBP2F: GGAAATCGG TTCACGGGTTG1000.9940.999
R: TCATTGCGAATTCCTGGGCA
GAPDHF: AACTGCCTTGCTCCACTAGC1450.9880.998
R: GAGCACCACGACCATCTCTC
TUB2F: CAACTACGCACGAGGACACT1301.1360.998
R: CACCGCCAAACGAGTGAAAC
n.a., not applicable.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, L.; Tian, Z.; Hu, J.; Wang, X.-Y.; Wang, M.-Q.; Lu, W.; Wang, X.-P.; Zheng, X.-L. Molecular Characterization and Expression Patterns of Two Pheromone-Binding Proteins from the Diurnal Moth Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae). Int. J. Mol. Sci. 2023, 24, 385. https://doi.org/10.3390/ijms24010385

AMA Style

Chen L, Tian Z, Hu J, Wang X-Y, Wang M-Q, Lu W, Wang X-P, Zheng X-L. Molecular Characterization and Expression Patterns of Two Pheromone-Binding Proteins from the Diurnal Moth Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae). International Journal of Molecular Sciences. 2023; 24(1):385. https://doi.org/10.3390/ijms24010385

Chicago/Turabian Style

Chen, Lian, Zhong Tian, Jin Hu, Xiao-Yun Wang, Man-Qun Wang, Wen Lu, Xiao-Ping Wang, and Xia-Lin Zheng. 2023. "Molecular Characterization and Expression Patterns of Two Pheromone-Binding Proteins from the Diurnal Moth Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae)" International Journal of Molecular Sciences 24, no. 1: 385. https://doi.org/10.3390/ijms24010385

APA Style

Chen, L., Tian, Z., Hu, J., Wang, X.-Y., Wang, M.-Q., Lu, W., Wang, X.-P., & Zheng, X.-L. (2023). Molecular Characterization and Expression Patterns of Two Pheromone-Binding Proteins from the Diurnal Moth Phauda flammans (Walker) (Lepidoptera: Zygaenoidea: Phaudidae). International Journal of Molecular Sciences, 24(1), 385. https://doi.org/10.3390/ijms24010385

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop