Recruitment of Muscle Genes as an Effect of Brown Adipose Tissue Ablation in Cold-Acclimated Brandt’s Voles (Lasiopodomys brandtii)
Abstract
1. Introduction
2. Results
2.1. IBAT Ablation Did Not Affect Basal or Adaptive Thermogenic Capacity
2.2. IBAT Ablation Did Not Induce UCP1-Dependent Thermogenesis in other Sites of BAT
2.3. Cold and iBAT Removal Induced Browning of WAT
2.4. Cold Acclimation and iBAT Removal Up-Regulated Expression of Major Ca2+-Cycling Proteins in Skeletal Muscle
2.5. Cold Acclimation and iBAT Removal Increased Mitochondrial Numbers and Metabolism-Related Genes in the Skeletal Muscle
3. Discussion
3.1. Effect of Cold and Removal on Metabolic Phenotype, Thermogenesis in BAT and WAT
3.2. SER Ca2+ Handling Played a Central Role in Muscle NST
4. Material and Methods
4.1. Animals
4.2. Experimental Design
4.3. Surgical Removal of iBAT
4.4. Body Weight and Energy Intake
4.5. Metabolic Measurements
4.6. Body Temperature
4.7. Tissue Collection
4.8. Real-Time Quantitative PCR (RT-qPCR) for Measurements of Thermogenic and Metabolic Markers
4.9. Western Blotting (WB) for Measurements of Thermogenic Markers
4.10. Immunohistochemistry for Detecting Browning of WAT
4.11. Transmission Electron Microscopy for Visualizing Mitochondria of Muscle Tissues
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bal, N.C.; Maurya, S.K.; Singh, S.; Wehrens, X.H.; Periasamy, M. Increased Reliance on Muscle-based Thermogenesis upon Acute Minimization of Brown Adipose Tissue Function. J. Biol. Chem. 2016, 291, 17247–17257. [Google Scholar] [CrossRef]
- Bicudo, J.E.; Vianna, C.R.; Chaui-Berlinck, J.G. Thermogenesis in birds. Biosci. Rep. 2001, 21, 181–188. [Google Scholar] [CrossRef]
- Enerbäck, S.; Jacobsson, A.; Simpson, E.M.; Guerra, C.; Yamashita, H.; Harper, M.-E.; Kozak, L.P. Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 1997, 387, 90–94. [Google Scholar] [CrossRef]
- Dawkins, M.J.R.; Scopes, J.W. Non-shivering Thermogenesis and Brown Adipose Tissue in the Human New-born Infant. Nature 1965, 206, 201–202. [Google Scholar] [CrossRef]
- Cannon, B.; Nedergaard, J. Metabolic consequences of the presence or absence of the thermogenic capacity of brown adipose tissue in mice (and probably in humans). Int. J. Obes. 2010, 34, S7–S16. [Google Scholar] [CrossRef]
- Azzu, V.; Brand, M.D. The on-off switches of the mitochondrial uncoupling proteins. Trends Biochem. Sci. 2010, 35, 298–307. [Google Scholar] [CrossRef]
- Nedergaard, J.; Golozoubova, V.; Matthias, A.; Asadi, A.; Jacobsson, A.; Cannon, B. UCP1: The only protein able to mediate adaptive non-shivering thermogenesis and metabolic inefficiency. Biochim. Biophys. Acta BBA Bioenerg. 2001, 1504, 82–106. [Google Scholar] [CrossRef]
- Fedorenko, A.; Lishko, P.V.; Kirichok, Y. Mechanism of Fatty-Acid-Dependent UCP1 Uncoupling in Brown Fat Mitochondria. Cell 2012, 151, 400–413. [Google Scholar] [CrossRef]
- Kajimura, S.; Spiegelman, B.M.; Seale, P. Brown and Beige Fat: Physiological Roles beyond Heat Generation. Cell Metab. 2015, 22, 546–559. [Google Scholar] [CrossRef]
- Bal, N.C.; Singh, S.; Reis, F.C.; Maurya, S.K.; Pani, S.; Rowland, L.A.; Periasamy, M. Both brown adipose tissue and skeletal muscle thermogenesis processes are activated during mild to severe cold adaptation in mice. J. Biol. Chem. 2017, 292, 16616–16625. [Google Scholar] [CrossRef]
- De Meis, L. Brown adipose tissue Ca2+-ATPase: Uncoupled ATP hydrolysis and thermogenic activity. J. Biol. Chem. 2003, 278, 41856–41861. [Google Scholar] [CrossRef]
- Ikeda, K.; Kang, Q.; Yoneshiro, T.; Camporez, J.P.; Maki, H.; Homma, M.; Shinoda, K.; Chen, Y.; Lu, X.; Maretich, P.; et al. UCP1-independent signaling involving SERCA2b-mediated calcium cycling regulates beige fat thermogenesis and systemic glucose homeostasis. Nat. Med. 2017, 23, 1454–1465. [Google Scholar] [CrossRef]
- Silva, J.E. Physiological importance and control of non-shivering facultative thermogenesis. Front. Biosci. 2011, S3, 352–371. [Google Scholar] [CrossRef]
- Kjelstrup, S.; Barragán, D.; Bedeaux, D. Coefficients for Active Transport and Thermogenesis of Ca2+-ATPase Isoforms. Biophys. J. 2009, 96, 4376–4386. [Google Scholar] [CrossRef][Green Version]
- Anunciado-Koza, R.P.; Zhang, J.; Ukropec, J.; Bajpeyi, S.; Koza, R.A.; Rogers, R.C.; Cefalu, W.T.; Mynatt, R.L.; Kozak, L.P. Inactivation of the Mitochondrial Carrier SLC25A25 (ATP-Mg2+/Pi Transporter) Reduces Physical Endurance and Metabolic Efficiency in Mice. J. Biol. Chem. 2011, 286, 11659–11671. [Google Scholar] [CrossRef]
- Bal, N.C.; Maurya, S.K.; Sopariwala, D.H.; Sahoo, S.K.; Gupta, S.C.; A Shaikh, S.; Pant, M.; A Rowland, L.; Bombardier, E.; A Goonasekera, S.; et al. Sarcolipin is a newly identified regulator of muscle-based thermogenesis in mammals. Nat. Med. 2012, 18, 1575–1579. [Google Scholar] [CrossRef]
- Sahoo, S.K.; Shaikh, S.A.; Sopariwala, D.H.; Bal, N.C.; Periasamy, M. Sarcolipin Protein Interaction with Sarco(endo)plasmic Reticulum Ca2+ATPase (SERCA) Is Distinct from Phospholamban Protein, and Only Sarcolipin Can Promote Uncoupling of the SERCA Pump. J. Biol. Chem. 2013, 288, 6881–6889. [Google Scholar] [CrossRef]
- Pant, M.; Bal, N.C.; Periasamy, M. Cold adaptation overrides developmental regulation of sarcolipin expression in mice skeletal muscle: SOS for muscle-based thermogenesis? J. Exp. Biol. 2015, 218, 2321–2325. [Google Scholar] [CrossRef]
- Bhupathy, P.; Babu, G.J.; Periasamy, M. Sarcolipin and phospholamban as regulators of cardiac sarcoplasmic reticulum Ca2+ ATPase. J. Mol. Cell. Cardiol. 2007, 42, 903–911. [Google Scholar] [CrossRef]
- Meissner, G. Ryanodine Receptor/Ca2+ Release Channels and Their Regulation by Endogenous Effectors. Annu. Rev. Physiol. 1994, 56, 485–508. [Google Scholar] [CrossRef]
- Zhang, Z.B.; Wang, Z.W. Ecology and Management of Rodent Pests in Agriculture; Ocean Press: Beijing, China, 1998; ISBN 7502746633. [Google Scholar]
- Shi, D.Z.; Hai, S.Z. Observation on Brandt’s vole at low temperature in experimental condition. Acta Theriol. Sin. 1996, 16, 291–296. [Google Scholar]
- Zhang, X.-Y.; Wang, D.-H. Energy metabolism, thermogenesis and body mass regulation in Brandt’s voles (Lasiopodomys brandtii) during cold acclimation and rewarming. Horm. Behav. 2006, 50, 61–69. [Google Scholar] [CrossRef]
- Grav, H.J.; Blix, A.S. A Source of Nonshivering Thermogenesis in Fur Seal Skeletal Muscle. Science 1979, 204, 87–89. [Google Scholar] [CrossRef]
- Davis, T.R. Contribution of skeletal muscle to nonshivering thermogenesis in the dog. Am. J. Physiol. 1967, 213, 1423–1426. [Google Scholar] [CrossRef][Green Version]
- Greenway, D.C.; Himms-Hagen, J. Increased calcium uptake by muscle mitochondria of cold-acclimated rats. Am. J. Physiol. 1978, 234, C7–C13. [Google Scholar] [CrossRef]
- Janský, L. Non-shivering thermogenesis and its thermoregulatory significance. Biol. Rev. 1973, 48, 85–132. [Google Scholar] [CrossRef]
- Janský, L.; Lukásová, G.; Vybíral, S.; Bazenov, J. Thermoregulatory response of the rabbit to local peripheral cooling. Physiol. Bohemoslov. 1973, 22, 125–136. [Google Scholar]
- Hofmann, W.E.; Liu, X.; Bearden, C.M.; Harper, M.-E.; Kozak, L.P. Effects of Genetic Background on Thermoregulation and Fatty Acid-induced Uncoupling of Mitochondria in UCP1-deficient Mice. J. Biol. Chem. 2001, 276, 12460–12465. [Google Scholar] [CrossRef]
- Pani, P.; Bal, N.C. Avian adjustments to cold and non-shivering thermogenesis: Whats, wheres and hows. Biol. Rev. 2022, 97, 2106–2126. [Google Scholar] [CrossRef]
- Saarela, S.; Keith, J.S.; Hohtola, E.; Trayhurn, P. Is the “mammalian” brown fat-specific mitochondrial uncoupling protein present in adipose tissues of birds? Comp. Biochem. Physiol. Part B Comp. Biochem. 1991, 100, 45–49. [Google Scholar] [CrossRef]
- Walter, I.; Seebacher, F. Endothermy in birds: Underlying molecular mechanisms. J. Exp. Biol. 2009, 212, 2328–2336. [Google Scholar] [CrossRef]
- Newman, S.A.; Mezentseva, N.V.; Badyaev, A.V. Gene loss, thermogenesis, and the origin of birds. Ann. N. Y. Acad. Sci. 2013, 1289, 36–47. [Google Scholar] [CrossRef]
- Polymeropoulos, E.T.; Jastroch, M.; Frappell, P.B. Absence of adaptive nonshivering thermogenesis in a marsupial, the fat-tailed dunnart (Sminthopsis crassicaudata). J. Comp. Physiol. B 2011, 182, 393–401. [Google Scholar] [CrossRef]
- Hayward, J.S.; Lisson, P.A. Evolution of brown fat: Its absence in marsupials and monotremes. Can. J. Zool. 1992, 70, 171–179. [Google Scholar] [CrossRef]
- Rose, R.W.; West, A.K.; Ye, J.; McCormack, G.H.; Colquhoun, E.Q. Nonshivering Thermogenesis in a Marsupial (the Tasmanian Bettong Bettongia gaimardi) Is Not Attributable to Brown Adipose Tissue. Physiol. Biochem. Zool. 1999, 72, 699–704. [Google Scholar] [CrossRef]
- Trayhurn, P.; Temple, N.J.; Van Aerde, J. Evidence from immunoblotting studies on uncoupling protein that brown adipose tissue is not present in the domestic pig. Can. J. Physiol. Pharmacol. 1989, 67, 1480–1485. [Google Scholar] [CrossRef]
- Nowack, J.; Giroud, S.; Arnold, W.; Ruf, T. Muscle Non-Shivering Thermogenesis and Its Role in the Evolution of Endothermy. Front. Physiol. 2017, 8, 889. [Google Scholar] [CrossRef]
- Grigg, G.; Nowack, J.; Bicudo, J.E.P.W.; Bal, N.C.; Woodward, H.N.; Seymour, R.S. Whole-body endothermy: Ancient, homologous and widespread among the ancestors of mammals, birds and crocodylians. Biol. Rev. 2021, 97, 766–801. [Google Scholar] [CrossRef]
- Lovegrove, B.G. Seasonal thermoregulatory responses in mammals. J. Comp. Physiol. B 2005, 175, 231–247. [Google Scholar] [CrossRef]
- Tast, J. Annual variations in the weights of wintering root voles, Microtus oeconomus, in relation to their food conditions. Ann. Zool. Fennici. Soc. Biol. Fenn. Vanamo 1972, 9, 116–119. [Google Scholar]
- Song, Z.-G.; Wang, D.-H. Basal metabolic rate and organ size in Brandt’s voles (Lasiopodomys brandtii): Effects of photoperiod, temperature and diet quality. Physiol. Behav. 2006, 89, 704–710. [Google Scholar] [CrossRef]
- Oelkrug, R.; Polymeropoulos, E.T.; Jastroch, M. Brown adipose tissue: Physiological function and evolutionary significance. J. Comp. Physiol. B 2015, 185, 587–606. [Google Scholar] [CrossRef]
- Cannon, B.; Nedergaard, J. Brown Adipose Tissue: Function and Physiological Significance. Physiol. Rev. 2004, 84, 277–359. [Google Scholar] [CrossRef]
- Sepa-Kishi, D.M.; Jani, S.; Da Eira, D.; Ceddia, R.B. Cold acclimation enhances UCP1 content, lipolysis, and triacylglycerol resynthesis, but not mitochondrial uncoupling and fat oxidation, in rat white adipocytes. Am. J. Physiol. Physiol. 2019, 316, C365–C376. [Google Scholar] [CrossRef]
- Jia, R.; Luo, X.-Q.; Wang, G.; Lin, C.-X.; Qiao, H.; Wang, N.; Yao, T.; Barclay, J.L.; Whitehead, J.P.; Yan, J.-Q. Characterization of cold-induced remodelling reveals depot-specific differences across and within brown and white adipose tissues in mice. Acta Physiol. 2016, 217, 311–324. [Google Scholar] [CrossRef]
- Coulson, S.Z.; Robertson, C.E.; Mahalingam, S.; McClelland, G.B. Plasticity of non-shivering thermogenesis and brown adipose tissue in high-altitude deer mice. J. Exp. Biol. 2021, 224, jeb242279. [Google Scholar] [CrossRef]
- Maurya, S.K.; Herrera, J.L.; Sahoo, S.K.; dos Reis, F.C.G.; Vega, R.B.; Kelly, D.P.; Periasamy, M. Sarcolipin Signaling Promotes Mitochondrial Biogenesis and Oxidative Metabolism in Skeletal Muscle. Cell Rep. 2018, 24, 2919–2931. [Google Scholar] [CrossRef]
- Tulp, O.L.; Gregory, M.H.; Danforth, E., Jr. Characteristics of diet-induced brown adipose tissue growth and thermogenesis in rats. Life Sci. 1982, 30, 1525–1530. [Google Scholar] [CrossRef]
- Li, M.; Hao, Z.; Wanlong, Z.; Zhengkun, W. Seasonal variations of adipose tissue in Tupaia belangeri (Mammalia: Scandentia: Tupaiidae). Eur. Zool. J. 2019, 86, 54–62. [Google Scholar] [CrossRef]
- Piao, Z.; Zhai, B.; Jiang, X.; Dong, M.; Yan, C.; Lin, J.; Jin, W. Reduced adiposity by compensatory WAT browning upon iBAT removal in mice. Biochem. Biophys. Res. Commun. 2018, 501, 807–813. [Google Scholar] [CrossRef]
- Aydin, J.; Shabalina, I.G.; Place, N.; Reiken, S.; Zhang, S.; Bellinger, A.M.; Nedergaard, J.; Cannon, B.; Marks, A.R.; Bruton, J.D.; et al. Nonshivering thermogenesis protects against defective calcium handling in muscle. FASEB J. 2008, 22, 3919–3924. [Google Scholar] [CrossRef] [PubMed]
- Sahoo, S.K.; Shaikh, S.A.; Sopariwala, D.H.; Bal, N.C.; Bruhn, D.S.; Kopec, W.; Khandelia, H.; Periasamy, M. The N Terminus of Sarcolipin Plays an Important Role in Uncoupling Sarco-endoplasmic Reticulum Ca2+-ATPase (SERCA) ATP Hydrolysis from Ca2+ Transport. J. Biol. Chem. 2015, 290, 14057–14067. [Google Scholar] [CrossRef] [PubMed]
- Shaikh, S.A.; Sahoo, S.K.; Periasamy, M. Phospholamban and sarcolipin: Are they functionally redundant or distinct regulators of the Sarco(Endo)Plasmic Reticulum Calcium ATPase? J. Mol. Cell Cardiol. 2016, 91, 81–91. [Google Scholar] [CrossRef]
- Maurya, S.K.; Periasamy, M. Sarcolipin is a novel regulator of muscle metabolism and obesity. Pharmacol. Res. 2015, 102, 270–275. [Google Scholar] [CrossRef] [PubMed]
- Dumonteil, E.; Barre, H.; Meissner, G. Sarcoplasmic reticulum Ca(2+)-ATPase and ryanodine receptor in cold-acclimated ducklings and thermogenesis. Am. J. Physiol. Physiol. 1993, 265, C507–C513. [Google Scholar] [CrossRef] [PubMed]
- Dumonteil, E.; Barre, H.; Meissner, G. Expression of sarcoplasmic reticulum Ca2+ transport proteins in cold-acclimating ducklings. Am. J. Physiol. Physiol. 1995, 269, C955–C960. [Google Scholar] [CrossRef] [PubMed]
- Wehrens, X.H.T.; Lehnart, S.E.; Reiken, S.R.; Marks, A.R. Ca2+/Calmodulin-Dependent Protein Kinase II Phosphorylation Regulates the Cardiac Ryanodine Receptor. Circ. Res. 2004, 94, e61–e70. [Google Scholar] [CrossRef] [PubMed]
- Neef, S.; Dybkova, N.; Sossalla, S.; Ort, K.R.; Fluschnik, N.; Neumann, K.; Seipelt, R.; Schöndube, F.A.; Hasenfuss, G.; Maier, L.S. CaMKII-Dependent Diastolic SR Ca 2+ Leak and Elevated Diastolic Ca 2+ Levels in Right Atrial Myocardium of Patients with Atrial Fibrillation. Circ. Res. 2010, 106, 1134–1144. [Google Scholar] [CrossRef]
- Gehlert, S.; Bloch, W.; Suhr, F. Ca2+-Dependent Regulations and Signaling in Skeletal Muscle: From Electro-Mechanical Coupling to Adaptation. Int. J. Mol. Sci. 2015, 16, 1066–1095. [Google Scholar] [CrossRef]
- Meizoso-Huesca, A.; Pearce, L.; Barclay, C.J.; Launikonis, B.S. Ca 2+ leak through ryanodine receptor 1 regulates thermogenesis in resting skeletal muscle. Proc. Natl. Acad. Sci. USA 2022, 119, e2119203119. [Google Scholar] [CrossRef]
- Chen, H.; Vermulst, M.; Wang, Y.E.; Chomyn, A.; Prolla, T.A.; McCaffery, J.M.; Chan, D.C. Mitochondrial Fusion Is Required for mtDNA Stability in Skeletal Muscle and Tolerance of mtDNA Mutations. Cell 2010, 141, 280–289. [Google Scholar] [CrossRef] [PubMed]
- Santo-Domingo, J.; Demaurex, N. Perspectives on: SGP symposium on mitochondrial physiology and medicine: The renaissance of mitochondrial pH. J. Gen. Physiol. 2012, 139, 415–423. [Google Scholar] [CrossRef] [PubMed]
- Soriano, F.X.; Liesa, M.; Bach, D.; Chan, D.C.; Palacín, M.; Zorzano, A. Evidence for a Mitochondrial Regulatory Pathway Defined by Peroxisome Proliferator–Activated Receptor-γ Coactivator-1α, Estrogen-Related Receptor-α, and Mitofusin 2. Diabetes 2006, 55, 1783–1791. [Google Scholar] [CrossRef] [PubMed]
- Lin, B.; Coughlin, S.; Pilch, P.F. Bidirectional regulation of uncoupling protein-3 and GLUT-4 mRNA in skeletal muscle by cold. Am. J. Physiol. Metab. 1998, 275, E386–E391. [Google Scholar] [CrossRef]
- Bal, N.C.; Maurya, S.K.; Pani, S.; Sethy, C.; Banerjee, A.; Das, S.; Patnaik, S.; Kundu, C.N. Mild cold induced thermogenesis: Are BAT and skeletal muscle synergistic partners? Biosci. Rep. 2017, 37, BSR20171087. [Google Scholar] [CrossRef]
- Haim, A.; Izhaki, I. The ecological significance of resting metabolic rate and non-shivering thermogenesis for rodents. J. Therm. Biol. 1993, 18, 71–81. [Google Scholar] [CrossRef]
- Burton, T.; Killen, S.S.; Armstrong, J.D.; Metcalfe, N.B. What causes intraspecific variation in resting metabolic rate and what are its ecological consequences? Proc. R. Soc. B Boil. Sci. 2011, 278, 3465–3473. [Google Scholar] [CrossRef]
- Wang, J.M.; Wang, D.H. Comparison of nonshivering thermogenesis induced by dosages of norepinephrine from 3 allometric equations in Brandt’s voles (Lasiopodomys brandtii). Acta Theriol. Sin. 2006, 26, 84. [Google Scholar] [CrossRef]
- Guo, Y.-Y.; Chi, Q.-S.; Zhang, X.-Y.; Liu, W.; Hao, S.-Y.; Wang, D.-H. Brown adipose tissue plays thermoregulatory role within the thermoneutral zone in Mongolian gerbils (Meriones unguiculatus). J. Therm. Biol. 2019, 81, 137–145. [Google Scholar] [CrossRef]
- Bo, T.-B.; Zhang, X.-Y.; Kohl, K.D.; Wen, J.; Tian, S.-J.; Wang, D.-H. Coprophagy prevention alters microbiome, metabolism, neurochemistry, and cognitive behavior in a small mammal. ISME J. 2020, 14, 2625–2645. [Google Scholar] [CrossRef]
Primers | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
SERCA1 | GATCCGAGACCAGATGGCTG | CAGGGTCGTTGAAGTGACCA |
SERCA2 | GTCTGTCATTCGGGAGTGGG | GCTGAGTCTTCCAGGTGCAT |
SLN | GTCTGCCTGGAGTTCTCACC | ACGGCCCCTCAGTATTGGTA |
RYR1 | TGGTGGGCGAAATCTTCATCT | GGTCTGAGCCACCTGACTTG |
PLB | AGCAAGCACGGCAAAATCTC | GGTGGCAGCCGTACTTCATA |
UCP3 | GCACAGTTGACAATGGCGTT | CTGCCTGAACTTGGCCCATA |
CSY | GCTAAGGGTGGGGAAGAACC | ACCACATGAGAAGGCAGAGC |
ACACβ | TCAACACAGCCTACGTCACC | GGGTACTTTTCTGGGGAGCC |
COX II | CCCATAGAGCTCCCAATCCG | GTCGTCCTGGGATAGCATCTG |
GAPDH | TGCTCCTCCCTGTTTTGGAG | TCCAATACGGCCAAATCCGT |
Primary Antibody | Host | Antibody Type | Article Number | Manufacturer |
---|---|---|---|---|
PCNA (PC10) Mouse mAb | Mouse | mAb | 2586 | Cell Signaling Technology |
anti-UCP1 antibody | Rabbit | pAb | ab10983 | Abcam |
PPARγ (C26H12) Rabbit mAb | Rabbit | mAb | 2435 | Cell Signaling Technology |
Rabbit Anti-PPARGC1A (PGC-1α) Polyclonal Antibody | Rabbit | pAb | bs-1832R | Bioss |
Polyclonal Antibody to DIO2 | Rabbit | pAb | PAC903Ra01 | Cloud-Clone Corp. |
Anti-Tyrosine Hydroxylase Antibody | Rabbit | pAb | AB152 | Merck Millipore |
ATP2A1/SERCA1 (L24) Antibody | Rabbit | pAb | 4219 | Cell Signaling Technology |
Phospho-Phospholamban (Ser16/Thr17) Antibody | Rabbit | pAb | 8496 | Cell Signaling Technology |
β-Tubulin Mouse mAb | Mouse | mAb | 30301ES40 | Yeasen |
GAPDH (Clone:1A6) Mouse mAb | Mouse | mAb | 30201ES20 | Yeasen |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, M.; Zhang, X.-Y.; Wang, C.-Z.; Wang, D.-H. Recruitment of Muscle Genes as an Effect of Brown Adipose Tissue Ablation in Cold-Acclimated Brandt’s Voles (Lasiopodomys brandtii). Int. J. Mol. Sci. 2023, 24, 342. https://doi.org/10.3390/ijms24010342
Liu M, Zhang X-Y, Wang C-Z, Wang D-H. Recruitment of Muscle Genes as an Effect of Brown Adipose Tissue Ablation in Cold-Acclimated Brandt’s Voles (Lasiopodomys brandtii). International Journal of Molecular Sciences. 2023; 24(1):342. https://doi.org/10.3390/ijms24010342
Chicago/Turabian StyleLiu, Min, Xue-Ying Zhang, Chen-Zhu Wang, and De-Hua Wang. 2023. "Recruitment of Muscle Genes as an Effect of Brown Adipose Tissue Ablation in Cold-Acclimated Brandt’s Voles (Lasiopodomys brandtii)" International Journal of Molecular Sciences 24, no. 1: 342. https://doi.org/10.3390/ijms24010342
APA StyleLiu, M., Zhang, X.-Y., Wang, C.-Z., & Wang, D.-H. (2023). Recruitment of Muscle Genes as an Effect of Brown Adipose Tissue Ablation in Cold-Acclimated Brandt’s Voles (Lasiopodomys brandtii). International Journal of Molecular Sciences, 24(1), 342. https://doi.org/10.3390/ijms24010342